array(12) { [0]=> array(49) { ["IBLOCK_SECTION_ID"]=> string(3) "211" ["~IBLOCK_SECTION_ID"]=> string(3) "211" ["ID"]=> string(4) "2058" ["~ID"]=> string(4) "2058" ["IBLOCK_ID"]=> string(1) "2" ["~IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(222) "Биологические маркеры тройного негативного рака молочной железы: поиск мишеней для иммунотаргетной и клеточной терапии" ["~NAME"]=> string(222) "Биологические маркеры тройного негативного рака молочной железы: поиск мишеней для иммунотаргетной и клеточной терапии" ["ACTIVE_FROM"]=> NULL ["~ACTIVE_FROM"]=> NULL ["TIMESTAMP_X"]=> string(22) "08/08/2022 03:24:57 pm" ["~TIMESTAMP_X"]=> string(22) "08/08/2022 03:24:57 pm" ["DETAIL_PAGE_URL"]=> string(143) "/en/archive/tom-11-nomer-2/obzornye-stati/biologicheskie-markery-troynogo-negativnogo-raka-molochnoy-zhelezy-poisk-misheney-dlya-immunotargetn/" ["~DETAIL_PAGE_URL"]=> string(143) "/en/archive/tom-11-nomer-2/obzornye-stati/biologicheskie-markery-troynogo-negativnogo-raka-molochnoy-zhelezy-poisk-misheney-dlya-immunotargetn/" ["LIST_PAGE_URL"]=> string(12) "/en/archive/" ["~LIST_PAGE_URL"]=> string(12) "/en/archive/" ["DETAIL_TEXT"]=> string(81363) "

Introduction

Breast cancer (BC) is a malignant disease with heterogeneous biological characteristics and different clinical course. It ranks first in the world (about 25%) in terms of morbidity and mortality among other tumors in women. According to the global cancer database (GLOBOCAN), 34650951 cases of breast cancer were detected in the world in 2020, and 11210413 patients died from this disease [1, 2]. 66,990 new cases of breast cancer were diagnosed in Russian Federation in 2019 (489.6 cases per 100,000 people) [3].

Combined chemo- and hormone therapy is, generally, efficient in breast cancer treatment, in terms of overall and disease-free survival. Special advances are achieved in HER-positive tumors using targeted therapy with drugs which suppress the tumor cell growth factors (trastuzumab, herceptin).

A number of protein markers could be used as diagnostic and therapeutic targets in BC, as follows:
1) estrogen receptors (α-subunit, ERα);
2) progesterone receptors (PR);
3) epidermal growth factor receptors of the second type (HER2/new);
4) epidermal growth factor receptors (EGFR);
5) vascular endothelial growth factor (VEGF);
6) cytokeratins (CK5/6, CK14, CK17);
7) nuclear protein reflecting the level of proliferative activity (Ki-67) [4, 5].

Moreover, novel molecular biology approaches, first introduced by Perou et al., using DNA microarray technology, have discerned 4 molecular subtypes of breast cancer, which, in part, corresponded to the previously accepted immunohistochemical (IHC) markers, i.e., luminal A (PR+, ER+, Her-2-), luminal B (PR±, ER+, Her-2+), with Her-2 overexpression (PR-, ER-, Her-2 overexpression), basal-like or triple negative cancer (PR-, ER-, Her-2 -, as well as CK5/6+, CK14+, CK17+, EGFR+). Subsequent works revealed some other molecular variants of breast cancer [6-10].

Basal-like triple-negative breast cancer (TNBC) makes up 12-20% among other histological types, displaying a number of clinicopathological and molecular features that affect treatment strategy. It occurs in women under 50 years of age being characterized by a high recurrence rate, low differentiation levels, and high risk of metastases to parenchymal organs and brain. Molecular defects are often represented by hereditary BRCA (Breast cancer gene) mutations leading to altered DNA repair, thus presuming higher efficiency of DNA-damaging agents, such as platinum drugs and poly-ADP-ribose polymerase (PARP) inhibitors. Moreover, somatic mutations in the P53 gene are detected in 60-80% of cases [11]

The relatively low immunogenicity of this type of tumor seems to be the main obstacle in cellular and immune therapy for breast cancer, compared with many other types of solid malignancies. At the present time, specific TNBC markers are required to determine molecular targets for personalized therapy, e.c., monoclonal antibodies or antigen-oriented immune cells (for example, CAR- T cells). Meanwhile, there exist a lot of molecular markers for diagnostics and therapy [12]. Recent meta-analysis of available data from clinical trials [13] highlighted some potential TNBC biomarkers and therapeutically relevant protein factors on the surface of tumor cells, as well as some blood biomarkers in the patients at different clinical risk. The informative markers of tumor cells were selected, i.e., EGFR, IGF -binding protein, c-Kit, c-Met, and PD-L1. Plasma markers included PIK3CA, pAKT/S6/p4E-BP1, PTEN, ALDH 1 and metabolites of the regulatory pathway PIK3CA/AKT/mTOR, as well as nuclear biomarkers (BRCA1, glucocorticoid receptors, TP53 and Ki-67).

Clinical significance of the TNBC molecular subtypes

To date, several classifications of TNBC have been proposed. They are based on histological signs, characteristic mutations or RNA expression in tumor tissues (Table 1).

Table 1. Molecular classifications of triple negative breast cancer

The clinically oriented classifications based on the gene expression profiles offer an advanced tool for the disease prognosis and prediction, in addition to the common IHC approaches. E.g., in 2012 Curtis C. et al. developed a classification based on the assessment of the frequency of point mutations and duplications of several genes in 997 primary tumors [14]. The authors identified 10 integrative transcriptional clusters that differ in dominant mode of gene expression. Tumors of the basal-like type, mainly (80% of the cases), have the characteristics of integrative clusters 4 and 10, with pronounced lymphoid infiltration in cases of cluster 4 transcriptional profile, and multiple chromosomal aberrations in the patients with cluster 10 expression [14].

In 2014, Lehmann et al. analyzed the expression profiles of 2188 genes in 587 patients and identified 6 types of tumors that differ in biological properties: basal-like 1, 2 (BL 1, BL 2); mesenchymal (M), mesenchymal-stem (MSL), immunomodulatory (IM), androgen receptor (LAR). The rest of the variants were classified as Unstable Type (UNS). Moreover, the authors divided these triple negative breast cancer cell types using this classification [15].

In 2013, Masuda et al. analyzed the prognostic significance of molecular subtypes of breast cancer [18]. The following conclusions were drawn: 1) molecular subtypes clearly correlate with the rate of complete responses during chemotherapy with anthracycline antibiotics and taxanes (BL1, 52%; BL2, 0%; LAR, 10%; MSL, 23%); 2) molecular subtype is an independent predictor of complete response (p=0.043); 3) molecular subtypes have greater prognostic value compared to PAM 50 (Prediction Analysis of Microarray 50). This parameter tests a sample of the tumor for a group of 50 genes to predict the chance of progression.

The study by Burstein et al. (2015) aimed at modifying the criteria and clarifying the number of molecular subtypes in triple negative breast cancer in accordance with expression profiles of 80 genes [16]. The workers have identified 4 molecular subgroups determined by overexpression of different genes, and specific biomarkers were shown for each of them: 1) luminal AR (LAR): androgen receptors, mucin (MUC 1); 2) mesenchymal (MES): IGF -1, ADRB 2, EDBRB, PTGER 3/4, PTGFR, PTGFRA; 3) basal-like immunosuppressive (BLIS): VTCN 1; 4) basal-like immunoactivated (BLIA): CTLA-4. The subgroups proved to be predictive for the relapse-free (p=0.019) and tumor-specific survival (p=0.07). The group-specific biomarkers can be considered as targets in the development of treatment for triple-negative breast cancer [17].

At the same time, it should be noted that the molecular typing of breast cancer tissues do not always correlate with spectrum and amount of appropriate proteins, i.e, with results of immunohistochemical studies. Hence, the existing classifications require further improvement.

Altered signaling pathways in breast cancer stem cells

Over recent decades, there has been increasing evidence that the characteristics of cancer stem cells (CSC) may determine high risk of metastases and drug resistance. Hence, the CSCs are one of the promising biomarkers for TNBC prognosis. Their quantitative and functional evaluation may inform about degree of tumor aggressiveness, whereas defective signaling pathways could be affected by targeted therapy.

Compared to other tumors, the TNBC clinical samples and cell lines show much higher contents of the cells with a CD 44+/CD 24-/ phenotype and high ALDH 1 expression. Clinical studies have shown that the expression of CD 44+/CD 24-/ is associated with decreased efficacy of chemotherapy, high incidence of distant metastasis, lymph node involvement, and recurrence, whereas ALDH 1 is an independent prognostic factor for long-term treatment outcomes. Detectable markers of the epithelial-mesenchymal transition (EMT) combined with high CSC concentration are also associated with resistance to chemotherapy and, in particular, to PARP inhibitors [19].

Self-renewal of malignant stem cells and other features providing invasiveness, resistance to therapy, and high metastatic potential, are associated with hyperactivation of several key signaling pathways, e.g., Notch, Wnt/β-catenin, Hedgehog, STAT 3. Thus, the Notch signaling cascade includes a family of transmembrane ligands and their receptors, which are critical for the processes of cell proliferation and differentiation. Disturbances of this cascade are detected in patients with lung cancer, prostate cancer, colorectal cancer, breast cancer and leukemia, thus regarded as prospective targets for anticancer drugs [20, 21].

To date, a lot of experimental and clinical data has been obtained confirming that dysregulation of the classical Wnt/β-catenin signaling pathway leads to increased incidence of distant metastases. The members of non-canonical Wnt-signaling pathway (FZD6 and FZD8) are also associated with aggressive behavior of the tumor and its chemoresistance [22, 23]. These molecules are considered potential targets for the newly developed drugs [24].

HH (Hedgehog) is a signaling pathway that promotes self-renewal of the CSC population. The HH family includes three secretory ligands: SHH (Sonic), expressed in embryonic cells; IHH (Indian), found predominantly in hematopoietic stem cells; DHH (Desert) found in cells of the peripheral nervous system and testicles. Overexpression of HH components (SHH, GLI 1/2, SMO) is associated with tumor invasion, angiogenesis, and chemoresistance and, therefore, with poor clinical prognosis. The components of this signaling pathway, especially SMO and GLI, are considered targets for the novel anticancer drugs [25].

TGF-β is a member of the cytokine superfamily, which includes more than 30 functionally related growth factors, including 3 TGF-β isoforms (TGF-β1-3) involved in the regulation of cell growth, adhesion, apoptosis, differentiation and immunoregulation. It inhibits the secretion and regulation of the functions of a number of cytokines, including IFN-γ, TNF-α, IL-2. The role of TGF-β in carcinogenesis is to promote proliferation, angiogenesis, metastasis, chemoresistance, immunosuppression. In addition, the presence of TGF-β is critical for CSC. TGF-β is secreted by the cells from tumor microenvironment which supports CSC population, and, in turn, promotes alternative polarization of immunocompetent cell precursors. In clinical practice, overexpression of TGF-β is a marker of chemoresistance and poor prognosis. TGF-β receptors are considered targets for some prospective drugs [26].

JAK/STAT signaling pathway plays an important role in a number of carcinogenesis-associated events, including proliferation, inflammation, and the pathological changes of microenvironment. E.g., JAK is a family of non-receptor tyrosine kinases that includes 4 components: JAK 1, JAK 2, JAK 3 and TYK 2. JAK 1, JAK 2 and TYK 2 are expressed in many cell types, whereas JAK 3 is specific to hematopoietic stem cells. Under the influence of cytokines and growth factors (IL-6, IL-8, TGF-β, IGF, EGF), the JAK/STAT 3 complex is activated causing overexpression of the genes providing synthesis of growth factors and cytokines (TGF-β, IL-6) which stimulate proliferation of TNBC cells. Experimental and clinical studies have shown that expression of IL-6, IL-8, and STAT 3 is associated with poor prognosis and chemoresistance [27-29].

Circulating tumor cells

Circulating tumor cells (CTC) are considered a potential biomarker associated with prognosis, prediction of efficacy, and treatment monitoring in TNBC. CellSearch technology is the conventional approach to CTCs isolation offered by Menarini Silicon Biosystems, based on recognition of EpCAM adhesion molecules [30]. In 2004, Cristofanilli et al. have shown that detection of >5 CTCs per 7.5 ml of blood is an independent predictor of overall and relapse-free survival of the patients with metastatic breast cancer. In 2019, the prognostic role of this marker was proven in the study in 1944 TNBC patients stratified into two large groups: indolent, for which standard treatment is adequate, and aggressive course, for which new, including experimental, methods of treatment were required [31].

However, the data on significance of CTC as a prognostic factor in TNBC patients still remain contradictory. E.g., Munzone E. et al., in retrospective analysis of data from 203 patients, showed that the number of CTCs correlated with overall survival, but not with progression-free survival. Meanwhile, in the SWOG study S0500, the CTC scores were found to be predictive of overall survival and predictive of chemotherapy efficacy [32]. At present, the most promising areas of CTC research are their molecular biology characterization, cluster studies, and combined assays with other biomarkers. The study which involved 360 TNBC cases has shown that occurrence of CTC clusters correlated with the median time to progression [33].

Genetic biomarkers

Molecular markers of TNBC include gene mutations affecting DNA repair systems, signaling molecules, growth factors and their receptors, as well as microsatellite instability and general mutation load. Among the mutated or overexpressed genes, specific targets are searched for the recently used and novel immunotherapeutic drugs. A separate group consists of immunological biomarkers. These indexes reflect the state of tumor microenvironment, peripheral immunological components, and tertiary lymphoid structures.

Mutations in genes associated with DNA repair

Finding the relationships between BRCA 1/2 gene mutations and inherited ovarian and breast tumors was a key discovery in clinical oncology, opening up new opportunities for screening and prevention. Detailed studies of appropriate mechanisms has led to the development of new treatment options. BRCA 1 and BRCA 2 are autosomal dominant genes that are critical in DNA repair by homologous recombination (homologus recombination repair, HRR). Mutations of BRCA 1 and BRCA 2 (gBRCAm) occur in a small part of the population (approximately 0.25%), whereas in women with TNBC their frequency varies from 11% to 31%. The risk of developing breast cancer with hereditary BRCA mutations is 65% and 45%, respectively [34]. These mutations may trigger an alternative DNA repair mechanism, i.e., a non-homologous end joining (NHEJ). This process depends on poly-ADP-ribose polymerase activity (PARP), and its inactivation leads to cell death. Currently, a number of PARP-blocking drugs entered the clinical practice, e.g., Olaparib, Talazoparib, Niraparib, Rucaparib, Veliparib [35].

In 2015, Domogala P. et al. studied the distribution of 36 mutations in genes involved in homologous recombination. They were found in 22% (35 out of 158) of the patients with TNBC [36], thus suggesting usage of PARP inhibitors and other DNA damaging agents for defects in other genes associated with HRD (homologus recombination deficiency) [37, 38]. Microsatellite instability (MSI) is an additional feature of malignant disease progression сaused by deficient DNA mismatch repair (dMMR). MSI is associated with highly frequent neoantigen production, thus affecting sensitivity to immunooncological drugs. Some tumor variants (colorectal cancer, endometrial cancer) are characterized by increased MSI rates (20%-30% of the cases).

Immunological markers for TNBC

Mutual interactions between the tumor and host immune system were studied for decades. In the mid-20th century, animal experiments on tumor xenotransplantation showed that effective antitumor immune response is possible only at high levels of tumor-specific antigens. Based on these data, in 1957 M. Burnet formulated the "clonal selection theory" and coined the term "immunological surveillance" [39]. In particular, it was suggested that the transformed cells expressing foreign antigens permanently occur in the body, being normally eliminated by the host immune system. This immune response is similar to classic "immunological surveillance" as described by M. Bernet. Over this period, the tumor cells are recognized and eliminated by factors of innate and adaptive immunity. Both immune cells of tumor microenvironment and peripheral blood may be of prognostic and predictive value. In both cases, quantitative characteristics and ratios of different populations, as well as concentration and production of cytokines (spontaneous and induced) should be assessed.

Lymphocytes and mononuclear cells in peripheral blood

In several studies concerning prognostic cellular markers in TNBC, an assessment was made of lymphocytes or peripheral blood mononuclear cells, as well as the ratios of different leukocyte subpopulations. E.g., a prognostic significance of lymphocytosis, monocytosis, and lymphocyte: monocyte ratio (LMR ≥ 4.7; p <0.001) was shown by He et al. (2016) in 230 patients with local and locally advanced forms of TNBC. Moreover, LMR correlated with tumor size (p <0.005) and disease stage (p=0.013) [40]. Losada B. et al., when studying a group of older BC patients have revealed by univariate analysis that еру platelet-lymphocyte ratio (PLR) is the only independent predictor of disease-free (p=0.04) and overall three-year survival (p=0.03), whereas, among the 3-year survivors (n=69), whereas only ALC has predictive properties in a multivariate analysis at the marginal significance level (p=0.04) [41].

Evaluation of myeloid and lymphoid cell subpopulations, either in peripheral blood, or in tumor microenvironment is a more accurate method for assessing the prognosis. Among lymphoid cells, the role of lymphocytes (CTL, Treg, B-lymphocytes), myeloid cells – monocytes/macrophages (M 1.2), dendritic cells (DC), and suppressor cells of myeloid origin (MDSC) have been studied [42].

Monocyte/macrophage cell lineage

To date, monocytes and macrophages (MFs) are shown to be associated with carcinogenesis in breast cancer, as well as with prognosis and efficiency of various treatment approaches. There are two macrophage subpopulations, M1 and M2, discerned in the tumor microenvironment and peripheral blood of the patients. M1 represents classical activated MFs, that develop from their precursors under the action of lipopolysaccharide, IFN-γ and TNF-α. M2 is the collective name for the macrophages induced via IL-4, IL-13, IL-10, TGF-β, Fc receptors, complement and glucocorticoids. M2 are derived from peripheral blood monocytes recruited to the affected site by chemokine ligands (CCL – 2, MCP – 1), colony-stimulating factors (M – CSF, CSF – 1) and vascular endothelial growth factor (VEGF), due to their higher concentration in the areas with low oxygenation. Under the chronic local hypoxia, the macrophages produce hypoxia-induced factors (HIF-1 and HIF-2) which derepress the synthesis of several proteins that increase angiogenic potential (VEGF, bFGF, PDGF), invasive and metastatic ability of tumor cells (MMP, CCL 2, CCL 18). Moreover, they promote arginase (Arg) and IDO expression, thus reducing local contents of arginine and tryptophan, which are essential to the normal functioning of T-lymphocytes and NK cells [43].

Concentration of M2 cells in peripheral blood is significantly higher compared to M1 population, thus correlating with a short relapse-free period in TNBC patients. The M2 macrophages are more common in the blood of patients with distant metastases. The ratio of monocyte subpopulations in TNBC differs from other types of breast cancer, i.e., the alternative polarization variant (CD 14+CD 16+) dominates over the classical one (CD 14hi CD 16-). High concentration of monocytes (CD 14+) is a predictor of good response to high-dose systemic therapy with cyclophosphamide and taxanes [44-46].

Dendritic cells (DCs) comprise a highly specialized subpopulation which performs uptake, processing, and antigen presentation within major MHC I and II histocompatibility complexes, along in combination with co-stimulatory Th molecules (CD 4+), acting with CTL in direct and indirect manner. They are activated by the "danger signals" from the tumor cells, including chemokines and neoantigens. The DC maturation, along with antigen-presenting functions includes expression of costimulatory molecules (CD40, ICAM I, CD80/86, CD 83), secretion of numerous cytokines (IFN-γ, IL-4, IL-5, IL-6, IL-10, IL-13), and migration to the lymph nodes, where the T-cell activation program is launched. In humans, two subpopulations of DC are morphologically and functionally distinguished. I.e., myeloid DC (mDCs) comprise classical DCs of the CD11c+ CD4+ CD45RO+ phenotype expressing MHC I, II which trigger the immune response upon contact with soluble antigens.

Plasmacytoid DCs (pDCs) display the CD11c- CD4+ CD45RA+ CD123+ phenotype and MHC I expression, being reactive for the cell-associated antigens. The DCs in TNBC patients showed reduced expression of cytokines (IL-12), co-stimulatory molecules (CD 80, CD 86), activation markers (HLA-DR), and lower ability to present antigens [47].

There are some controversial data on prognostic and predictive role of DC in the patients with TNBC. Despite conflicting data on the role of dendritic cells, considerable attention is paid to this cell population, in terms of vaccine therapy for cancer, in particular, breast cancer. According to several studies, their high levels may be a favorable prognostic factor for overall survival [48, 49]. However, further research is needed to determine their therapeutic potential in TNBC.

The populations of natural killer cells (NKs) are formed from a common lymphoid precursor in the bone marrow, from where they further spread to the primary and secondary lymphoid organs, as well as to the lungs, liver, and blood. Two NK subpopulations are identified in humans: CD56^bright CD 16- (cytokine-producing) and CD56^dim CD16+ (cytotoxic). In addition, there are several groups of NK depending on the degree of maturity, determined by the expression of CD 27 and CD11b surface markers which are not expressed by the immature NKs. In the course of maturation, CD 27 appears first, followed by CD11b. NK with the CD 27+ phenotype show the best ability for cytokine secretion, whereas the NK cells with CD11b+ CD27 phenotype demonstrate maximal cytolytic activity. NK can eliminate cells that do not express MHC I, and this mechanism is used by malignant cells and CSCs to prevent attack by CTLs. Potentially, NK cells are the most effective cells against the tumor, but they may acquire the CD56^bright CD16- phenotype under the influence of microenvironmental factors (TGF-β, adenosine), and express pro-angiogenic factors (MMP 9, VEGF), thus increasing the invasive potential, leading to T-cell depletion [59]. Low blood levels of NKs seem to predict low efficacy of neoadjuvant chemotherapy in TNBC. Expression of CD 163 and CXCR 4 in the NK microenvironment is a marker of early relapse [50, 51].

Tumor microenvironment

The study of the tumor microenvironment in TNBC is an important component of assessing the prognosis of the disease. From a clinical point of view, the cellular microenvironment can be assessed both quantitatively and qualitatively, taking into account the population profile, by the presence of a specific "immunological signature". Moreover, it is currently possible to assess the contents and production levels of cytokines by lymphoid cells of peripheral blood and tumor microenvironment. The lymphoid component, which makes up to 50-60% of the stromal volume in all molecular subtypes of TNBC, as a rule, suggests good prognosis and potential sensitivity to immuno-oncological drugs and chemotherapy [52, 53].

In 2020 He L. et al. conducted a meta-analysis of randomized trials with assessment of tumor-infiltrating lymphocytes (TIL) which reflected the results of treatment in 15,676 patients with breast cancer, including 3847 TNBC cases. The results of multivariate analysis showed that any 10% increase in TIL density was associated with increase in overall survival and complete morphological response rates for all molecular subtypes. High TIL density (≥50%) leads to a 2.7-fold increase in the complete response rates in TNB [54].

A similar study was done by Mao et al. [55]. They analyzed data from 25 works (22964 patients) concerning the major TIL subsets: CD 8+, Foxp 3+, PD-1+, γδ T cells, CD3+, CD4+. CD8+ TIL in the infiltrate proved to be a favorable prognostic factor for disease-free and tumor-specific survival in all subgroups. Foxp3+ TILs seem to be a dismal unfavorable prognostic factor for relapse-free and overall survival in all the subgroups except of TNBC. PD-1+ TIL and γδT TILs are poor prognostic factors for overall survival in all subgroups, whereas CD3+ TIL and CD4+ TIL did not show any predictive potential [55]. Thus, in most behavioral studies, the authors conclude that the formation of tertiary lymphoid organs is a favorable prognostic factor for TNBC.

Local and systemic concentrations of cytokines

Cytokines are currently considered universal regulators of homeostasis for many cell types. In TNBC, they are involved in regulation of angiogenesis, arrangement of immunosuppressive networks, tumor metastasis, and metabolic processes associated with obesity, chronic inflammation, and carcinogenesis. Involvement in carcinogenesis enables usage of the cytokines as prognostic markers. Cytokines can be measured in blood or in tumor microenvironment. Their contents, as well as spontaneous and induced production, may be assessed in these samples. IL-1, -6, -8, -10, -11, -17, -19, -20, -23, like as TNF-α; TGF-β, adipokines (leptin, adiponectin) are involved in TNBC carcinogenesis. Many of them have predictive potential (Table 2).

Table 2. Prognostic role of functional overexpression in microenvironment, or increased levels of cytokines in blood plasma in patients with triple-negative breast cancer

IL-6, 8, 10, TNF-α and TGF-β are the most studied cytokines associated with carcinogenesis and prognosis of TNBC. IL-6 is a cytokine that functionally integrates the immune and neuroendocrine systems, being produced by T cells, macrophages, myocytes, endotheliocytes, fibroblasts, and tumor cells. IL-6 promotes cell proliferation and synthesis of antibodies by B-lymphocytes, CTL proliferation, stimulates the granulocytic hematopoietic lineage, and induces the expression of acute phase proteins in the liver. Overexpression of IL-6 in malignant tumor and increased concentration in peripheral blood is considered an unfavorable prognostic factor in terms of overall and disease-free survival [67-69].

Interleukin-8 (IL -8) belongs to the chemokine family, being produced by the MF and endothelial cells. In the course of carcinogenesis, IL -8 can act as an autocrine growth factor and stimulate angiogenesis. Serum IL -8 is not a favorable prognostic factor for overall and disease-free survival [70-72].

IL-10 is a key regulator of the antitumor immune response. Treg, Th0, Th1, Th2, CTL, monocytes, MF, tumor cells, TAM and NK are the main producers of IL-10 in humans. Maturation by reducing MHC expression II, adhesion molecules and cytokines (IL-12), as well as reducing the sensitivity of receptors that respond to "danger signals". IL-10 inhibits proliferative activity and production of Th 1 cytokines, T-dependent activation of CTL and CD 19 [73]. The main biological effects of TNF – α in carcinogenesis are associated with the maintenance of the peritumoral inflammation, increased capillary permeability and stimulation of angiogenesis. The role of TNF-α in TNBC is twofold. On the one hand, it promotes EMT, on the other hand, it activates antitumor CTLs [74-76].

Recently, the workers at A.M.Granov Research Centre for Radiology and Surgical Technologies and Pavlov University have performed a pilot study to assess prognostic significance of subpopulations of lymphocytes and cytokines which involved 29 TNBC patients. Before and after neoadjuvant chemotherapy, the amounts of lymphocyte subpopulations and cytokine contents were measured in peripheral blood, as follows: CD3+CD8+ (cytotoxic lymphocytes); CD3+CD4+ (T helpers); CD4+CD8+ (double positive T cells); CD16+CD56+HLADR+ (activated natural killers); CD3+CD16+CD56+ (TNK cells); CD4+CD25+FoxP3 (T-regulatory cells); CD3+HLA DR+ (activated T cells); αβ T cells (alpha/beta T cells); γδ T cells (gamma/delta T cells); interleukin-1β (IL-1); interleukin-2 (IL-2); interleukin-4 (IL-4); interleukin-6 (IL-6); interleukin-8 (IL-8); interleukin-10 (IL-10); interleukin-12 (IL-12); interferon-α (IFN-α); interferon-γ (IFN-γ); tumor necrosis factor-α (TNF-α). The assays were carried out at Laboratory of Immunology, A.M. Nikiforov Center for Emergency and Radiation Medicine (St. Petersburg) using the Cytomics laser flow cytometer FC 500 (BECKMAN COULTER, USA). As a result of multivariate analysis, we have revealed that, among these parameters, the concentrations of T regulatory cells in peripheral blood (CD4+CD25+FoxP3) (p=0.045), as well as spontaneous production of IL-6 (p <0.005) and IL-10 (p <0.005) proved to be independent predictors of early relapse in triple-negative breast cancer.

The use of monoclonal antibodies in TNBC treatment

As already noted, specific tumor target antigens for immunotherapy have not yet been identified in breast cancer. Therefore, in recent years, much attention has been paid to the mobilization of immune surveillance of cells in the microenvironment. For example, many cancers are undergoing extensive clinical trials of immune checkpoint (ICT) inhibitors. These drugs relieve the state of local immunosuppression in these patients and enhance the activity of antitumor immunity. Reviewed by [77] Radoza et al. (2020) provide results from the IMpassion 130 program and other trials where therapy with antibodies to the programmed death receptor or its ligand (PD-1/PD-L1) and paclitaxel was used as first-line therapy for PDL 1-positive metastatic TNBC. Other ICT trials have used carboplatin or other cytotoxic drugs. The biological meaning of such combined schemes is the death of malignant cells and, which leads to the appearance of neoantigens – additional targets for activated immune cells of the patient. Along with this, within the framework of the generally accepted concept of targeted therapy for malignant neoplasms, programs of clinical trials of monoclonal antibodies are being carried out, against EGFR2 (epidermal growth factor receptor 2).

Potential targets for immunoconjugates of anticancer antibodies

A separate group of biomarkers is regarded as potential targets for a new group of drugs – conjugates of monoclonal antibodies with cytotoxic agents. Monoclonal antibodies bind to the target, and the complex is internalized into the tumor cell, realizing selective cytotoxicity. The target molecule for the conjugate must be overexpressed on the cell surface and have the property of internalization upon interaction with the ligand. Currently, several molecules have been identified in TNBC cells with the following properties: 1) non-metastatic glycoprotein b (GPNMB); 2) surface trophoblastic antigen-2 (Trop -2); 3) zinc-containing transport protein (LIV-1); 4) sialoglycomucin (CA 6).

GPNMB is involved in several processes associated with carcinogenesis, including cell migration, invasion, angiogenesis, and EMT. In addition, it is a biomarker of poor prognosis [90]. GPNMB is a target for Glematumumab vedotin (CDX -011), a conjugate containing a microtubule-destroying chemical agent, monomethyl auristatin E (MMAE), as an effector. Phase II data from the EMERGE study demonstrated that CDX -011 is more effective and less toxic than chemotherapy in TNBC patients with GPNMB overexpression [78, 79].

Trop -2 is a transmembrane glycoprotein involved in the processes of migration and proliferation, which is a target for Saccituzumab govitecan (IMMU -132), which contains a topoisomerase I inhibitor as an active agent. SN -38. Results of a phase II study of 33.3% objective responses in patients with TNBC in the third line of therapy [80, 81].

LIV -1 is involved in the regulation of STAT -3 expression, cell adhesion, and EMT. Preclinical studies have demonstrated the efficacy of Ladiratuzumab vedotin, which binds to the extracellular domain of LIV -1 [82].

CA 6 is selectively expressed on many solid tumor cells. It is a target for SAR 566658, which contains microtubule-destroying DM 4 as an active component [83].

Immune response inhibitors: PD1/PDL

Biomarkers that predict the effectiveness of immunotherapy in patients with TNBC include co-inhibitory molecules – targets of immunooncological drugs, microsatellite instability, mutation load, and tumor-infiltrating lymphocytes.

PD-1 is a co-inhibitory molecule that regulates the functions of components of the innate and adaptive immune response. It is expressed on the surface of T-lymphocytes, B-lymphocytes, MF, monocytes, DC. Under physiological conditions, it contributes to the formation of tolerance to autoantigens; in the tumor microenvironment, it promotes tumor immunological tolerance [84]. The PD-1 ligand (PD-L1) is a transmembrane protein that is expressed both on tumor and immunocompetent cells (T, B-lymphocytes, DC, MF). The interaction of PD-1/PD-L1 leads to deactivation of T-lymphocytes, activation of T-regulatory cells, and persistence of tumor cells [85, 86].

PD-L1 is expressed in 20% of TNBC cases. PD-L1 is expressed in about 10% on tumor cells, and 40-65% on cells of the tumor microenvironment. Expression of PD-L1 on tumor cells is a predictor of a favorable prognosis and a marker of sensitivity to chemotherapy [87]. Expression of PD-L1 on lymphocytes in the microenvironment is a marker of sensitivity to blockers of co-inhibiting molecules [88].

PD-1 and PD-L1 blockers are currently the standard treatment for TNBC. Atezolizumab (anti-PD-L1) was the first approved drug in this group for the treatment of its metastatic forms. The Phase III study IMPASSION 130 evaluated the efficacy and safety of atezolizumab and included 451 participants. The median overall survival in the group where the expression of PD-L1 ≥ 1% on the cells of the lymphoid infiltrate was significantly higher in the group where patients received atezolizumab in combination with nab-paclitaxel (25 and 18 months). To assess the expression of PD-L1 in the study, the test system VENTATA was used [89]. The efficacy and safety of pembrolizumab (anti-PD-1) in previously untreated patients in phase III was assessed in the KEYNOTE -355 protocol. The study included 847 patients who received various chemotherapy regimens (paclitaxel, nab-paclitaxel, platinum drugs and gemcitabine) in combination with placebo or pembrolizumab. Expression of PD-L1 was assessed in points using the 22С3 test system (DAKO PharmaDx), which considered the ratio of PD-L1 on tumor cells, lymphocytes and macrophages to the total number of detected tumor cells, multiplied by 100 (CPS, combined positive score). Significant differences in median relapse-free survival were found only at CPS ≥ 10 (9.7 months in the pembrolizumab group and 5.6 months in the placebo group). PD-1 and PD-L1 in patients with TNBC are associated with prognosis. PD-L1, in addition, plays the role of a predictive factor in relation to the effectiveness of blockers of co-inhibitory molecules [90, 91].

Cellular and immunotherapy of breast cancer

Early attempts of hematopoietic stem cell transplantation (HSCT)

In the 1980s, with the development of cytostatic therapy for solid tumors, it became necessary to maintain and restore hematopoiesis in patients with intensification of chemotherapy regimens. Therefore, methods of bone marrow transplantation taken from the patient himself (autologous BMT) before the start of intensive chemotherapy, in combination with hematopoiesis stimulation factors, were proposed. At the same time, the main problem was the purification of the harvested bone marrow of patients from metastatic tumor cells. At that time, there were no sufficiently effective immunological markers for the detection of malignant cells and their elimination in transplants. However, the first clinical studies of the 90s according to the use of auto-TKM in breast cancer, an increase in overall and recurrence-free survival was revealed in some patients [92]. However, later these positive results were not confirmed in larger samples and in randomized trials [93].

Subsequently, with the development of transplantation of hematopoietic and immune cells from HLA -compatible donors (allo-HSCT), there were proposals to use allogeneic cells to implement the immune effect "graft-versus-tumor", by analogy with the "graft-versus-leukemia" reaction in oncohematological diseases [94]. A positive effect of allo-HSCT was noted in some patients with solid neoplasms, including breast cancer. In general, the clinical response here was associated with the development of acute and chronic graft-versus-host disease. The authors pointed to low specificity and pronounced undesirable effects in this type of treatment.

The use of individual fractions of donor immune cells (primarily lymphocytes) for the adoptive therapy of solid cancers is considered. However, the authors express doubts about the duration of the therapeutic effects of adoptive immunotherapy [95]. It is possible that adoptive immunotherapy will find its place in combined regimens for the treatment of solid tumors, along with targeted drugs.

Current opportunities of cell therapy of breast cancer

One of the long-standing methods of biotherapy is the use of individual cell-based vaccines that have a therapeutic effect in breast cancer. Their clinical development is in the 2^nd-3^rd phases. Early work in this area consisted of short-term incubation of the patient's tumor tissues with his lymphocytes/monocytes with the addition of several cytokines to induce the presentation of these antigens and activate the response of immune cells (both T-lymphocytes and macrophages) to tumor antigens, after which these stimulated, the cells were returned to the patient. More modern approaches involve targeting antigens that are expressed mainly in malignant tumors and, to a much lesser extent, on normal cells. Typically, T-lymphocytes targeting these antigens are eliminated by the tolerance system. However, in this clinical situation, cell-based vaccines must be immunogenic enough to activate, among other things, T cells with low affinity for these antigens. Here it becomes expedient to use ICT to activate these cell populations. In addition, there is currently a search for individual mutations in the genome of cancer cells, based on which it is supposed to create cell-based vaccines for specific patients with cancer [96].

A few works [97] consider the possibility of using activated populations of natural killer (NK) cells of malignant killer T cells in oncological diseases. Most often, peripheral blood mononuclear cells are used for this and stimulated with interferon gamma and/or IL-2 for 2-3 days. In particular, Sommaggio et al. (2020), cytokine-induced killer cells (CECs) in combination with cetuximab (an EGFR inhibitor) showed good antitumor and antimetastatic efficacy in NOD/SCID (NSG) mice with human breast transplants [98].

One of the latest trends is the development of CAR-T cells as a selective means of eliminating malignant cells that carry a specific antigen.

Thus, some authors are considering the possibility of using CAR-T cells against the MAGE-A4 antigen, which is considered a promising target for the treatment of lung cancer and TNBC [99]. The main objective of this work was to select T cells directed against a small MAGE-A4 region recognized by the corresponding HLA-A2 allele. These TCR-T cells with CD4 markers showed a direct selective cytotoxic effect in vitro and in vivo (in mice with xenografts) against various human malignant tumors expressing the antigen MAGE-A4.

Epidermal growth factor receptor (EGFR) is one of the most promising targets in cell therapy for breast cancer, against which effective T-cell products with a chimeric antigen receptor have been developed. Chinese authors have created EGFR lines using a lentiviral vector. CAR-T cells against TNTC, which was tested on cells in vitro. The 3^rd-generation drugs caused a pronounced and specific suppression of the growth of tumor cells. At the same time, only minimal toxicity was noted in relation to normal breast cells. The antitumor effect was confirmed and in vivo in mice with transplanted human tumors. It is hypothesized that EGFR stimulation CAR T cells cause this population to proliferate and support their growth. Transcriptome studies have shown that the effect of CAR T cells consists in the activation of systems of ќ≥-interferon, granzyme-perforin, and enzymes of apoptosis of tumor cells.

Another possible target antigen for immunotherapy is the so-called ROR1 (tyrosine kinase-like orphan receptor 1). A group of German authors developed ROR 1-specific CARs T cells [100]. Their biological activity was assessed in 3D models of lung and breast tumors based on the corresponding cell lines similar in structure and phenotype to primary tumors. ROR 1- CAR T cells in this model had a pronounced antitumor effect, actively inhabiting the tumor tissue and destroying its cell layers. Thus, the fundamental possibility of bioeffects of these genetically modified T cells under conditions close to the situation in vivo was shown.

At the same time, the action of CAR T cells against tumors may be defective. Thus, the suppression of the cellular immune response under the influence of the widespread factor TGF-β is supposed. The already mentioned group of German authors [101] studied the issue of this pronounced immune suppression, and the ways of neutralizing this effect. For this purpose, the lines CD 8 + and CD 4 + were prepared. ROR 1- CAR T cells from healthy blood donors, and their antitumor activity was determined on TNBC cells (MDA-MB-231) in vitro and in 3D models. It turned out that adding TGF-β led to decreased viability, cytolytic activity, cytokine production, and ROR 1 – CAR proliferation. T cells in mixed culture with tumor cells. Blockade of the TGF-β receptor with a specific inhibitor SD-208 protected CD 8+ and CD 4+ ROR 1- CAR T cells from this inhibitory effect and maintained the antitumor properties of CAR T cells. Thus, to preserve the effects of CAR T cells may need combined exposure, in particular – and in subsequent testing of these cell products. Among the factors of tumor resistance is called immunosuppression, which may develop with the introduction of CAR T cells against EGFR, as shown by the same group of authors in experiments on mice with TNBC [102]. This negative effect of CAR T cell therapy is associated with the induction of interferons, suppression of the activity of a number of immune response genes and can be overcome with epigenesis inhibitors (for example, inhibitors of the CDK7 gene).

In addition to the generally accepted cell therapy for oncological diseases, additional means of enhancing the effects of chemotherapy on the tumor are also possible. Thus, it is known that the system of macrophages and other phagocytic cells is able to capture and inactivate most of the drug when it is administered in a free form. To solve this problem, various means are proposed for its microencapsulation and targeted delivery to the tumor tissue. Chinese authors proposed preparations of the so-called "analogs of apoptotic bodies" (AAT) prepared from malignant cells containing CD47 and adhesion molecules [103]. These artificial structures, according to the authors, combine antiphagocytic properties and, at the same time, can be used for more efficient delivery of chemotherapy drugs to the tumor. An increased accumulation of AAT and, accordingly, increased efficiency of encapsulated drugs has been shown in an experimental model of metastasis.

Conclusions

1. The search for new biomarkers of TNBC, as well as the assessment of their prognostic and therapeutic potential, is currently one of the main tasks in the development of effective individualized treatment programs.

2. Several lines of research seem to be the most promising. The first (diagnostic) is associated with the development of "liquid biopsy" technology and evaluation of biomarkers in the blood, including subpopulations of lymphocytes, spontaneous and induced production of cytokines.

3. To address these standardization issues, an international working group on tumor immunological biomarkers has now been established, as well as analytical centers for immunological monitoring, whose tasks include identification, assessment of prognostic and predictive potential, and validation of biomarkers.

4. Another direction is related to the improvement of the technology of 3D tumor models, which allow modeling the microenvironment and selecting the most specific effects on the tumor, in accordance with the individual biomarkers of a given patient.

5. In the field of TNBC cell therapy, the data of numerous clinical trials are gradually accumulating. The results obtained so far make it possible to determine the dosage, the frequency of administration and the possibility of combination with conventional cytostatic anticancer drugs. To date, EGFR may be a suitable target for cellular immunotherapy in TNBC, and appropriate CAR-T cell products may be promising in the future in the clinical setting.

Conflicting interests

Not declared.

Funding

The research was supported financially by Ministry of Health of the Russian Federation. State assignment 37.15-2021; 121040200135-3.

References

1. Hwang S-Y, Park S, Kwon Y. Recent therapeutic trends and promising targets in triple negative breast cancer. Pharmacol Ther. 2019;199: 30-57. doi: 10.1016/j.pharmthera.2019.02.006
2. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021; caac.21660. doi: 10.3322/caac.21660
3. Kaprin A, Starinsky V, Shakhzadova A. State of oncological care for Russian population in 2019. P.A. Herzen Moscov Res Inst Oncol. 2020, 239 p. (In Russian).
4. Gucalp A, Traina TA. Triple-Negative Breast Cancer: Adjuvant Therapeutic Options. Chemother Res Pract. 2011;2011: 1-13.
   doi: 10.1155/2011/696208
5. Zhang MH, Man HT, Zhao XD, Dong N, Ma SL. Estrogen receptor-positive breast cancer molecular signatures and therapeutic potentials (Review). Biomed Reports. 2014;2: 41-52. doi: 10.3892/br.2013.187
6. Perou CM, Sørlie T, Eisen MB, van de Rijn M, Jeffrey SS, Rees CA, et al. Molecular portraits of human breast tumours. Nature. 2000;406: 747-752. doi: 10.1038/35021093
7. Penault-Llorca F, Viale G. Pathological and molecular diagnosis of triple-negative breast cancer: a clinical perspective. Ann Oncol. 2012;23: vi19-vi22. doi: 10.1093/annonc/mds190
8. Yeh I-T, Mies C. Application of Immunohistochemistry to Breast Lesions. Arch Pathol Lab Med. 2008;132: 349-358.
   doi: 10.5858/2008-132-349-AOITBL
9. Prat A, Parker JS, Karginova O, Fan C, Livasy C, Herschkowitz JI, et al. Phenotypic and molecular characterization of the claudin-low intrinsic subtype of breast cancer. Breast Cancer Res. 2010;12: R68. doi: 10.1186/bcr2635
10. Prat A, Perou CM. Deconstructing the molecular portraits of breast cancer. Mol Oncol. 2011;5: 5-23. doi: 10.1016/j.molonc.2010.11.003
11. Sharma P. Biology and management of patients with triple-negative breast cancer. Oncologist. 2016;21: 1050-1062. doi: 10.1634/theoncologist.2016-0067
12. Fleisher B, Clarke C, Ait-Oudhia S. Current advances in biomarkers for targeted therapy in triple-negative breast cancer. Breast Cancer. 2016;8: 183-197. doi: 10.2147/BCTT.S114659
13. https://clinicaltrials.gov/
14. Curtis C, Shah SP, Chin S-F, Turashvili G, Rueda OM, Dunning MJ, et al. The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups. Nature. 2012;486: 346-352. doi: 10.1038/nature10983
15. Lehmann BD, Pietenpol JA. Identification and use of biomarkers in treatment strategies for triple-negative breast cancer subtypes. J Pathol. 2014;232: 142-150. doi: 10.1002/path.4280
16. Burstein MD, Tsimelzon A, Poage GM, Covington KR, Contreras A, Fuqua SAW, et al. Comprehensive genomic analysis identifies novel subtypes and targets of triple-negative breast cancer. Clin Cancer Res. 2015;21: 1688-1698. doi: 10.1158/1078-0432.CCR-14-0432
17. Liu Y-R, Jiang Y-Z, Xu X-E, Yu K-D, Jin X, Hu X, et al. Comprehensive transcriptome analysis identifies novel molecular subtypes and subtype-specific RNAs of triple-negative breast cancer. Breast Cancer Res. 2016;18: 33. doi: 10.1186/s13058-016-0690-8
18. Masuda H, Baggerly KA, Wang Y, Zhang Y, Gonzalez-Angulo AM, Meric-Bernstam F, et al. Differential Response to Neoadjuvant Chemotherapy Among 7 Triple-Negative Breast Cancer Molecular Subtypes. Clin Cancer Res. 2013;19: 5533-5540. doi: 10.1158/1078-0432.CCR-13-0799
19. Talukdar Y, Rashkow JT, Lalwani G, Kanakia S, Sitharaman B. The effects of graphene nanostructures on mesenchymal stem cells. Biomaterials. 2014;35: 4863-4877. doi: 10.1016/j.biomaterials.2014.02.054
20. Speiser JJ, Erşahin Ç, Osipo C. The functional role of notch signaling in triple-negative breast cancer. Vitamins & Hormones. 2013; 93: 277-306. doi: 10.1016/B978-0-12-416673-8.00013-7
21. Miele L, Espinoza I, Pochampally, Watabe, Xing F. Notch signaling: targeting cancer stem cells and epithelial-to-mesenchymal transition. Onco Targets Ther. 2013; 1249. doi: 10.2147/OTT.S36162
22. Corda G, Sala G, Lattanzio R, Iezzi M, Sallese M, Fragassi G, et al. Functional and prognostic significance of the genomic amplification of frizzled 6 ( FZD6 ) in breast cancer. J Pathol. 2017;241: 350-361. doi: 10.1002/path.4841
23. Yin S, Xu L, Bonfil RD, Banerjee S, Sarkar FH, Sethi S, et al. Tumor-Initiating Cells and FZD8 Play a Major Role in Drug Resistance in Triple-Negative Breast Cancer. Mol Cancer Ther. 2013;12: 491-498. doi: 10.1158/1535-7163.MCT-12-1090
24. Li W, Yang H, Li X, Han L, Xu N, Shi A. Signaling pathway inhibitors target breast cancer stem cells in triple-negative breast cancer. Oncol Rep. 2018. doi: 10.3892/or.2018.6805
25. Bhateja P, Cherian M, Majumder S, Ramaswamy B. The hedgehog signaling pathway: a viable target in breast cancer? Cancers (Basel). 2019;11: 1126. doi: 10.3390/cancers11081126
26. Xu X, Zhang L, He X, Zhang P, Sun C, Xu X, et al. TGF-β plays a vital role in triple-negative breast cancer (TNBC) drug-resistance through regulating stemness, EMT and apoptosis. Biochem Biophys Res Commun. 2018;502: 160-165. doi: 10.1016/j.bbrc.2018.05.139
27. He L, Gu J, Lim LY, Yuan Z, Mo J. Nanomedicine-mediated therapies to target breast cancer stem cells. Front Pharmacol. 2016;7.
    doi: 10.3389/fphar.2016.00313
28. Guanizo AC, Fernando CD, Garama DJ, Gough DJ. STAT3: a multifaceted oncoprotein. Growth Factors. 2018;36: 1-14. doi: 10.1080/08977194.2018.1473393
29. Moreira MP, da Conceição Braga L, Cassali GD, Silva LM. STAT3 as a promising chemoresistance biomarker associated with the CD44 +/high /CD24 -/low /ALDH + BCSCs-like subset of the triple-negative breast cancer (TNBC) cell line. Exp Cell Res. 2018;363: 283-290. doi: 10.1016/j.yexcr.2018.01.018
30. Cristofanilli M, Hayes DF, Budd GT, Ellis MJ, Stopeck A, Reuben JM, et al. Circulating tumor cells: a novel prognostic factor for newly diagnosed metastatic breast cancer. J Clin Oncol. 2005;23: 1420-1430. doi: 10.1200/JCO.2005.08.140
31. Cristofanilli M, Pierga J-Y, Reuben J, Rademaker A, Davis AA, Peeters DJ, et al. The clinical use of circulating tumor cells (CTCs) enumeration for staging of metastatic breast cancer (MBC): International expert consensus paper. Crit Rev Oncol Hematol. 2019;134: 39-45. doi: 10.1016/j.critrevonc.2018.12.004
32. Munzone E, Botteri E, Sandri MT, Esposito A, Adamoli L, Zorzino L, et al. Prognostic value of circulating tumor cells according to immunohistochemically defined molecular subtypes in advanced breast cancer. Clin Breast Cancer. 2012;12: 340-346. doi: 10.1016/j.clbc.2012.07.001
33. Smerage JB, Barlow WE, Hortobagyi GN, Winer EP, Leyland-Jones B, Srkalovic G, et al. Circulating tumor cells and response to chemotherapy in metastatic breast cancer: SWOG S0500. J Clin Oncol. 2014;32: 3483-3489. doi: 10.1200/JCO.2014.56.2561
34. Qin J-J, Yan L, Zhang J, Zhang W-D. STAT3 as a potential therapeutic target in triple negative breast cancer: a systematic review.
    J Exp Clin Cancer Res. 2019;38: 195. doi: 10.1186/s13046-019-1206-z
35. Evans DG, Howell A, Ward D, Lalloo F, Jones JL, Eccles DM. Prevalence of BRCA1 and BRCA2 mutations in triple negative breast cancer. J Med Genet. 2011;48: 520-522. doi: 10.1136/jmedgenet-2011-100006
36. Kuroda H, Sakamoto G, Ohnisi K, Itoyama S. Clinical and pathological features of glycogen-rich clear cell carcinoma of the breast. Breast Cancer. 2005;12: 189-195. doi: 10.2325/jbcs.12.189
37. Domagala P, Jakubowska A, Jaworska-Bieniek K, Kaczmarek K, Durda K, Kurlapska A, et al. Prevalence of germline mutations in genes engaged in dna damage repair by homologous recombination in patients with triple-negative and hereditary non-triple-negative breast cancers. PLoS One. 2015;10: e0130393. doi: 10.1371/journal.pone.0130393
38. Sun K, Mikule K, Wang Z, Poon G, Vaidyanathan A, Smith G, et al. A comparative pharmacokinetic study of PARP inhibitors demonstrates favorable properties for niraparib efficacy in preclinical tumor models. Oncotarget. 2018;9: 37080-7096. doi: 10.18632/oncotarget.26354
39. Burnet M. Cancer. A Biological Approach: I. The Processes Of Control. II. The Significance of Somatic Mutation. BMJ. 1957;1: 779-786. doi: 10.1136/bmj.1.5022.779
40. He J, Lv P, Yang X, Chen Y, Liu C, Qiu X. Pretreatment lymphocyte to monocyte ratio as a predictor of prognosis in patients with early-stage triple-negative breast cancer. Tumor Biol. 2016;37: 9037-9043. doi: 10.1007/s13277-016-4793-8
41. Losada B, Guerra JA, Malón D, Jara C, Rodriguez L, Del Barco S. Pretreatment neutrophil/lymphocyte, platelet/lymphocyte, lymphocyte/monocyte, and neutrophil/monocyte ratios and outcome in elderly breast cancer patients. Clin Transl Oncol. 2019;21: 855-863. doi: 10.1007/s12094-018-1999-9
42. Batalha S, Ferreira S, Brito C. The Peripheral immune landscape of breast cancer: clinical findings and in vitro models for biomarker discovery. Cancers (Basel). 2021;13: 1305. doi: 10.3390/cancers13061305
43. Hung C-H, Chen F-M, Lin Y-C, Tsai M-L, Wang S-L, Chen Y-C, et al. Altered monocyte differentiation and macrophage polarization patterns in patients with breast cancer. BMC Cancer. 2018;18: 366. doi: 10.1186/s12885-018-4284-y
44. Zhang B, Cao M, He Y, Liu Y, Zhang G, Yang C, et al. Increased circulating M2-like monocytes in patients with breast cancer. Tumor Biol. 2017;39: 101042831771157. doi: 10.1177/1010428317711571
45. Lafrenie RM, Speigl L, Buckner CA, Pawelec G, Conlon MS, Shipp C. Frequency of immune cell subtypes in peripheral blood correlates with outcome for patients with metastatic breast cancer treated with high-dose chemotherapy. Clin Breast Cancer. 2019;19: 433-442. doi: 10.1016/j.clbc.2019.05.002
46. Holl EK, Frazier VN, Landa K, Beasley GM, Hwang ES, Nair SK. Examining peripheral and tumor cellular immunome in patients with cancer. Front Immunol. 2019;10. doi: 10.3389/fimmu.2019.01767
47. Wculek SK, Cueto FJ, Mujal AM, Melero I, Krummel MF, Sancho D. Dendritic cells in cancer immunology and immunotherapy. Nat Rev Immunol. 2020;20: 7-24. doi: 10.1038/s41577-019-0210-z
48. Lee H, Lee HJ, Song IH, Bang WS, Heo S-H, Gong G, et al. CD11c-positive dendritic cells in triple-negative breast cancer. In Vivo. 2018;32: 1561-1569. doi: 10.21873/invivo.11415
49. Kini Bailur J, Gueckel B, Pawelec G. Prognostic impact of high levels of circulating plasmacytoid dendritic cells in breast cancer.
    J Transl Med. 2016;14: 151. doi: 10.1186/s12967-016-0905-x
50. Verma C, Kaewkangsadan V, Eremin JM, Cowley GP, Ilyas M, El-Sheemy MA, et al. Natural killer (NK) cell profiles in blood and tumour in women with large and locally advanced breast cancer (LLABC) and their contribution to a pathological complete response (PCR) in the tumour following neoadjuvant chemotherapy (NAC): differential rest. J Transl Med. 2015;13: 180. doi: 10.1186/s12967-015-0535-8
51. Foulds GA, Vadakekolathu J, Abdel-Fatah TMA, Nagarajan D, Reeder S, Johnson C, et al. Immune-phenotyping and transcriptomic profiling of peripheral blood mononuclear cells from patients with breast cancer: identification of a 3 gene signature which predicts relapse of triple negative breast cancer. Front Immunol. 2018;9. doi: 10.3389/fimmu.2018.02028
52. Bates JP, Derakhshandeh R, Jones L, Webb TJ. Mechanisms of immune evasion in breast cancer. BMC Cancer. 2018;18: 556. doi: 10.1186/s12885-018-4441-3
53. Adams S, Gray RJ, Demaria S, Goldstein L, Perez EA, Shulman LN, et al. Prognostic value of tumor-infiltrating lymphocytes in triple-negative breast cancers from two Phase III randomized adjuvant breast cancer trials: ECOG 2197 and ECOG 1199. J Clin Oncol. 2014;32: 2959-2966. doi: 10.1200/JCO.2013.55.0491
54. He L, Wang Y, Wu Q, Song Y, Ma X, Zhang B, et al. Association between levels of tumor-infiltrating lymphocytes in different subtypes of primary breast tumors and prognostic outcomes: a meta-analysis. BMC Womens Health. 2020;20: 194.
    doi: 10.1186/s12905-020-01038-x
55. Mao Y, Qu Q, Chen X, Huang O, Wu J, Shen K. The prognostic value of tumor-infiltrating lymphocytes in breast cancer: a systematic review and meta-analysis. Tagliabue E, editor. PLoS One. 2016;11: e0152500. doi: 10.1371/journal.pone.0152500
56. Salimi M, Wang R, Yao X, Li X, Wang X, Hu Y, et al. Activated innate lymphoid cell populations accumulate in human tumour tissues. BMC Cancer. 2018;18: 341. doi: 10.1186/s12885-018-4262-4
57. Onesti CE, Josse C, Boulet D, Thiry J, Beaumecker B, Bours V, et al. Blood eosinophilic relative count is prognostic for breast cancer and associated with the presence of tumor at diagnosis and at time of relapse. Oncoimmunology. 2020;9. doi: 10.1080/2162402X.2020.1761176
58. Varricchi G, Galdiero MR, Loffredo S, Lucarini V, Marone G, Mattei F, et al. Eosinophils: The unsung heroes in cancer? Oncoimmunology. 2018;7: e1393134. doi: 10.1080/2162402X.2017.1393134
59. Aponte-López A, Fuentes-Pananá EM, Cortes-Muñoz D, Muñoz-Cruz S. Mast Cell, the Neglected Member of the Tumor Microenvironment: Role in Breast Cancer. J Immunol Res. 2018;2018: 1-11. doi: 10.1155/2018/2584243
60. Rajput AB, Turbin DA, Cheang MC, Voduc DK, Leung S, Gelmon KA, et al. Stromal mast cells in invasive breast cancer are a marker of favourable prognosis: a study of 4,444 cases. Breast Cancer Res Treat. 2008;107: 249-257. doi: 10.1007/s10549-007-9546-3
61. Yu X, Zhang Z, Wang Z, Wu P, Qiu F, Huang J. Prognostic and predictive value of tumor-infiltrating lymphocytes in breast cancer: a systematic review and meta-analysis. Clin Transl Oncol. 2016;18: 497-506. doi: 10.1007/s12094-015-1391-y
62. Mahmoud SMA, Paish EC, Powe DG, Macmillan RD, Grainge MJ, Lee AHS, et al. Tumor-infiltrating CD8+ lymphocytes predict clinical outcome in breast cancer. J Clin Oncol. 2011;29: 1949-1955. doi: 10.1200/JCO.2010.30.5037
63. Irshad S, Flores-Borja F, Lawler K, Monypenny J, Evans R, Male V, et al. RORγt+ Innate lymphoid cells promote lymph node metastasis of breast cancers. Cancer Res. 2017;77: 1083-1096. doi: 10.1158/0008-5472.CAN-16-0598
64. Iwamoto M, Shinohara H, Miyamoto A, Okuzawa M, Mabuchi H, Nohara T, et al. Prognostic value of tumor-infiltrating dendritic cells expressing CD83 in human breast carcinomas. Int J Cancer. 2003;104: 92-97. doi: 10.1002/ijc.10915
65. Brown JR, Wimberly H, Lannin DR, Nixon C, Rimm DL, Bossuyt V. Multiplexed Quantitative analysis of CD3, CD8, and CD20 predicts response to neoadjuvant chemotherapy in breast cancer. Clin Cancer Res. 2014;20: 5995-6005. doi: 10.1158/1078-0432.CCR-14-1622
66. Gu-Trantien C, Loi S, Garaud S, Equeter C, Libin M, de Wind A, et al. CD4+ follicular helper T cell infiltration predicts breast cancer survival. J Clin Invest. 2013;123: 2873-2892. doi: 10.1172/JCI67428
67. Oshi M, Newman S, Tokumaru Y, Yan L, Matsuyama R, Endo I, et al. Inflammation is associated with worse outcome in the whole cohort but with better outcome in triple-negative subtype of breast cancer patients. J Immunol Res. 2020;2020: 1-17. doi: 10.1155/2020/5618786
68. Martínez-Pérez C, Kay C, Meehan J, Gray M, Dixon JM, Turnbull AK. The IL6-like cytokine family: Role and biomarker potential in breast cancer. J Pers Med. 2021;11: 1073. doi: 10.3390/jpm11111073
69. Ma Y, Ren Y, Dai Z-J, Wu C-J, Ji Y-H, Xu J. IL-6, IL-8 and TNF-α levels correlate with disease stage in breast cancer patients. Adv Clin Exp Med. 2017;26: 421-426. doi: 10.17219/acem/62120
70. Zuccari DAP de C, Leonel C, Castro R, Gelaleti GB, Jardim BV, Moscheta MG, et al. An immunohistochemical study of interleukin-8 (IL-8) in breast cancer. Acta Histochem. 2012;114: 571-576. doi: 10.1016/j.acthis.2011.10.007
71. Singh JK, Simões BM, Howell SJ, Farnie G, Clarke RB. Recent advances reveal IL-8 signaling as a potential key to targeting breast cancer stem cells. Breast Cancer Res. 2013;15: 210. doi: 10.1186/bcr3436
72. Todorović-Raković N, Milovanović J. Interleukin-8 in breast cancer progression. J Interf Cytokine Res. 2013;33: 563-570.
    doi: 10.1089/jir.2013.0023
73. Chang C-M, Lam HP, Hsu H-J, Jiang S-J. Interleukin-10: A double-edged sword in breast cancer. Tzu Chi Med J. 2021;33: 203.
    doi: 10.4103/tcmj.tcmj_162_20
74. Gao W, Wen H, Liang L, Dong X, Du R, Zhou W, et al. IL20RA signaling enhances stemness and promotes the formation of an immunosuppressive microenvironment in breast cancer. Theranostics. 2021;11: 2564-2580. doi: 10.7150/thno.45280
75. Li C-J, Chu P-Y, Yiang G-T, Wu M-Y. The Molecular Mechanism of Epithelial-Mesenchymal Transition for Breast Carcinogenesis. Biomolecules. 2019;9: 476. doi: 10.3390/biom9090476
76. Yu Y, Wang Y, Ren X, Tsuyada A, Li A, Liu LJ, et al. Context-dependent bidirectional regulation of the MutS homolog 2 by transforming growth factor β contributes to chemoresistance in breast cancer cells. Mol Cancer Res. 2010;8: 1633-1642.
    doi: 10.1158/1541-7786.MCR-10-0362
77. Radosa JC, Stotz L, Müller C, Kaya AC, Solomayer E-F, Radosa MP. Clinical data on immunotherapy in breast cancer. Breast Care. 2020;15: 450-469. doi: 10.1159/000511788
78. Yardley DA, Weaver R, Melisko ME, Saleh MN, Arena FP, Forero A, et al. EMERGE: A randomized Phase II study of the antibody-drug conjugate glembatumumab vedotin in advanced glycoprotein NMB-expressing breast cancer. J Clin Oncol. 2015;33: 1609-1619.
    doi: 10.1200/JCO.2014.56.2959
79. Wolska-Washer A, Robak T. Safety and tolerability of antibody-drug conjugates in cancer. Drug Saf. 2019;42: 295-314.
    doi: 10.1007/s40264-018-0775-7
80. Goldenberg DM, Sharkey RM. Antibody-drug conjugates targeting TROP-2 and incorporating SN-38: A case study of anti-TROP-2 sacituzumab govitecan. MAbs. 2019;11: 987-995. doi: 10.1080/19420862.2019.1632115
81. Bardia A, Mayer IA, Vahdat LT, Tolaney SM, Isakoff SJ, Diamond JR, et al. Sacituzumab Govitecan-hziy in refractory metastatic triple-negative breast cancer. N Engl J Med. 2019;380: 741-751. doi: 10.1056/NEJMoa1814213
82. Nejadmoghaddam M-R, Minai-Tehrani A, Ghahremanzadeh R, Mahmoudi M, Dinarvand R, Zarnani A-H. Antibody-Drug conjugates: Possibilities and challenges. Avicenna J Med Biotechnol. 11: 3-23. Available: http://www.ncbi.nlm.nih.gov/pubmed/30800238
83. Gomez-Roca CA, Boni V, Moreno V, Morris JC, Delord J-P, Calvo E, et al. A phase I study of SAR566658, an anti CA6-antibody drug conjugate (ADC), in patients (Pts) with CA6-positive advanced solid tumors (STs)(NCT01156870). J Clin Oncol. 2016;34: 2511-2511. doi: 10.1200/JCO.2016.34.15_suppl.2511
84. Ahmadzadeh M, Johnson LA, Heemskerk B, Wunderlich JR, Dudley ME, White DE, et al. Tumor antigen-specific CD8 T cells infiltrating the tumor express high levels of PD-1 and are functionally impaired. Blood. 2009;114: 1537-1544. doi: 10.1182/blood-2008-12-195792
85. Salmaninejad A, Khoramshahi V, Azani A, Soltaninejad E, Aslani S, Zamani MR, et al. PD-1 and cancer: molecular mechanisms and polymorphisms. Immunogenetics. 2018;70: 73-86. doi: 10.1007/s00251-017-1015-5
86. Boussiotis VA. Molecular and biochemical aspects of the PD-1 checkpoint pathway. Longo DL, editor. N Engl J Med. 2016;375: 1767-1778. doi: 10.1056/NEJMra1514296
87. Van Berckelaer C, Rypens C, van Dam P, Pouillon L, Parizel M, Schats KA, et al. Infiltrating stromal immune cells in inflammatory breast cancer are associated with an improved outcome and increased PD-L1 expression. Breast Cancer Res. 2019;21: 28.
    doi: 10.1186/s13058-019-1108-1
88. Bertucci F, Gonçalves A. Immunotherapy in breast cancer: the emerging role of PD-1 and PD-L1. Curr Oncol Rep. 2017;19: 64.
    doi: 10.1007/s11912-017-0627-0
89. Stover DG, Parsons HA, Ha G, Freeman SS, Barry WT, Guo H, et al. Association of cell-free DNA tumor fraction and somatic copy number alterations with survival in metastatic triple-negative breast cancer. J Clin Oncol. 2018;36: 543-553. doi: 10.1200/JCO.2017.76.0033
90. Schmid P, Rugo HS, Adams S, Schneeweiss A, Barrios CH, Iwata H, et al. Atezolizumab plus nab-paclitaxel as first-line treatment for unresectable, locally advanced or metastatic triple-negative breast cancer (IMpassion130): updated efficacy results from a randomised, double-blind, placebo-controlled, phase 3 trial. Lancet Oncol. 2020;21: 44-59. doi: 10.1016/S1470-2045(19)30689-8
91. Cortes J, Cescon DW, Rugo HS, Nowecki Z, Im S-A, Yusof MM, et al. Pembrolizumab plus chemotherapy versus placebo plus chemotherapy for previously untreated locally recurrent inoperable or metastatic triple-negative breast cancer (KEYNOTE-355): a randomised, placebo-controlled, double-blind, phase 3 clinical trial. Lancet. 2020;396: 1817-1828. doi: 10.1016/S0140-6736(20)32531-9
92. Myers SE, Williams SF. Role of high-dose chemotherapy and autologous stem cell support in treatment of breast cancer. Hematol Oncol Clin North Am. 1993;7: 631-645. PMID: 8102137
93. Hamilton RF, Tsuruoka S, Wu N, Wolfarth M, Porter DW, Bunderson-Schelvan M, et al. Length, but not reactive edges, of cup-stack MWCNT is responsible for toxicity and acute lung inflammation. Toxicol Pathol. 2018;46: 62-74. doi: 10.1177/0192623317732303
94. Demirer T, Barkholt L, Blaise D, Pedrazzoli P, Aglietta M, Carella AM, et al. Transplantation of allogeneic hematopoietic stem cells: an emerging treatment modality for solid tumors. Nat Clin Pract Oncol. 2008;5: 256-67. doi: 10.1038/ncponc1104
95. Mondino A, Manzo T. To Remember or to Forget: The Role of good and bad memories in adoptive T cell therapy for tumors. Front Immunol. 2020;11: 1915. doi: 10.3389/fimmu.2020.01915
96. Sahin U, Derhovanessian E, Miller M, Kloke B-P, Simon P, Löwer M, et al. Personalized RNA mutanome vaccines mobilize poly-specific therapeutic immunity against cancer. Nature. 2017;547: 222-226. doi: 10.1038/nature23003
97. Davari K, Holland T, Prassmayer L, Longinotti G, Ganley KP, Pechilis LJ, et al. Development of a CD8 co-receptor independent T-cell receptor specific for tumor-associated antigen MAGE-A4 for next generation T-cell-based immunotherapy. J Immunother cancer. 2021;9. doi: 10.1136/jitc-2020-002035
98. Sommaggio R, Cappuzzello E, Dalla Pietà A, Tosi A, Palmerini P, Carpanese D, et al. Adoptive cell therapy of triple negative breast cancer with redirected cytokine-induced killer cells. Oncoimmunology. 2020;9. doi: 10.1080/2162402X.2020.1777046
99. Xia L, Zheng Z-Z, Liu J-Y, Chen Y-J, Ding J-C, Xia N-S, et al. EGFR-targeted CAR-T cells are potent and specific in suppressing triple-negative breast cancer both in vitro and in vivo. Clin Transl Immunol. 2020;9: e01135. doi: 10.1002/cti2.1135
100. Wallstabe L, Göttlich C, Nelke LC, Kühnemundt J, Schwarz T, Nerreter T, et al. ROR1-CAR T cells are effective against lung and breast cancer in advanced microphysiologic 3D tumor models. JCI insight. 2019;4. doi: 10.1172/jci.insight.126345
101. Stüber T, Monjezi R, Wallstabe L, Kühnemundt J, Nietzer SL, Dandekar G, et al. Inhibition of TGF-β-receptor signaling augments the antitumor function of ROR1-specific CAR T-cells against triple-negative breast cancer. J Immunother Cancer. 2020;8: e000676.
     doi: 10.1136/jitc-2020-000676
102. Xia L, Zheng Z, Liu J, Chen Y, Ding J, Hu G, et al. Targeting Triple-Negative Breast Cancer with Combination Therapy of EGFR CAR T Cells and CDK7 Inhibition. Cancer Immunol Res. 2021;9: 707-722. doi: 10.1158/2326-6066.CIR-20-0405
103. Zhang K, Fu H, Xing C, Luo Y, Cheng F, Fu Q, et al. "Don’t eat me/eat me" – combined apoptotic body analogues for efficient targeted therapy of triple-negative breast cancer. J Mater Chem B. 2021;9: 8472-8479. doi: 10.1039/d1tb01116b

" ["~DETAIL_TEXT"]=> string(81363) "

Introduction

Breast cancer (BC) is a malignant disease with heterogeneous biological characteristics and different clinical course. It ranks first in the world (about 25%) in terms of morbidity and mortality among other tumors in women. According to the global cancer database (GLOBOCAN), 34650951 cases of breast cancer were detected in the world in 2020, and 11210413 patients died from this disease [1, 2]. 66,990 new cases of breast cancer were diagnosed in Russian Federation in 2019 (489.6 cases per 100,000 people) [3].

Combined chemo- and hormone therapy is, generally, efficient in breast cancer treatment, in terms of overall and disease-free survival. Special advances are achieved in HER-positive tumors using targeted therapy with drugs which suppress the tumor cell growth factors (trastuzumab, herceptin).

A number of protein markers could be used as diagnostic and therapeutic targets in BC, as follows:
1) estrogen receptors (α-subunit, ERα);
2) progesterone receptors (PR);
3) epidermal growth factor receptors of the second type (HER2/new);
4) epidermal growth factor receptors (EGFR);
5) vascular endothelial growth factor (VEGF);
6) cytokeratins (CK5/6, CK14, CK17);
7) nuclear protein reflecting the level of proliferative activity (Ki-67) [4, 5].

Moreover, novel molecular biology approaches, first introduced by Perou et al., using DNA microarray technology, have discerned 4 molecular subtypes of breast cancer, which, in part, corresponded to the previously accepted immunohistochemical (IHC) markers, i.e., luminal A (PR+, ER+, Her-2-), luminal B (PR±, ER+, Her-2+), with Her-2 overexpression (PR-, ER-, Her-2 overexpression), basal-like or triple negative cancer (PR-, ER-, Her-2 -, as well as CK5/6+, CK14+, CK17+, EGFR+). Subsequent works revealed some other molecular variants of breast cancer [6-10].

Basal-like triple-negative breast cancer (TNBC) makes up 12-20% among other histological types, displaying a number of clinicopathological and molecular features that affect treatment strategy. It occurs in women under 50 years of age being characterized by a high recurrence rate, low differentiation levels, and high risk of metastases to parenchymal organs and brain. Molecular defects are often represented by hereditary BRCA (Breast cancer gene) mutations leading to altered DNA repair, thus presuming higher efficiency of DNA-damaging agents, such as platinum drugs and poly-ADP-ribose polymerase (PARP) inhibitors. Moreover, somatic mutations in the P53 gene are detected in 60-80% of cases [11]

The relatively low immunogenicity of this type of tumor seems to be the main obstacle in cellular and immune therapy for breast cancer, compared with many other types of solid malignancies. At the present time, specific TNBC markers are required to determine molecular targets for personalized therapy, e.c., monoclonal antibodies or antigen-oriented immune cells (for example, CAR- T cells). Meanwhile, there exist a lot of molecular markers for diagnostics and therapy [12]. Recent meta-analysis of available data from clinical trials [13] highlighted some potential TNBC biomarkers and therapeutically relevant protein factors on the surface of tumor cells, as well as some blood biomarkers in the patients at different clinical risk. The informative markers of tumor cells were selected, i.e., EGFR, IGF -binding protein, c-Kit, c-Met, and PD-L1. Plasma markers included PIK3CA, pAKT/S6/p4E-BP1, PTEN, ALDH 1 and metabolites of the regulatory pathway PIK3CA/AKT/mTOR, as well as nuclear biomarkers (BRCA1, glucocorticoid receptors, TP53 and Ki-67).

Clinical significance of the TNBC molecular subtypes

To date, several classifications of TNBC have been proposed. They are based on histological signs, characteristic mutations or RNA expression in tumor tissues (Table 1).

Table 1. Molecular classifications of triple negative breast cancer

The clinically oriented classifications based on the gene expression profiles offer an advanced tool for the disease prognosis and prediction, in addition to the common IHC approaches. E.g., in 2012 Curtis C. et al. developed a classification based on the assessment of the frequency of point mutations and duplications of several genes in 997 primary tumors [14]. The authors identified 10 integrative transcriptional clusters that differ in dominant mode of gene expression. Tumors of the basal-like type, mainly (80% of the cases), have the characteristics of integrative clusters 4 and 10, with pronounced lymphoid infiltration in cases of cluster 4 transcriptional profile, and multiple chromosomal aberrations in the patients with cluster 10 expression [14].

In 2014, Lehmann et al. analyzed the expression profiles of 2188 genes in 587 patients and identified 6 types of tumors that differ in biological properties: basal-like 1, 2 (BL 1, BL 2); mesenchymal (M), mesenchymal-stem (MSL), immunomodulatory (IM), androgen receptor (LAR). The rest of the variants were classified as Unstable Type (UNS). Moreover, the authors divided these triple negative breast cancer cell types using this classification [15].

In 2013, Masuda et al. analyzed the prognostic significance of molecular subtypes of breast cancer [18]. The following conclusions were drawn: 1) molecular subtypes clearly correlate with the rate of complete responses during chemotherapy with anthracycline antibiotics and taxanes (BL1, 52%; BL2, 0%; LAR, 10%; MSL, 23%); 2) molecular subtype is an independent predictor of complete response (p=0.043); 3) molecular subtypes have greater prognostic value compared to PAM 50 (Prediction Analysis of Microarray 50). This parameter tests a sample of the tumor for a group of 50 genes to predict the chance of progression.

The study by Burstein et al. (2015) aimed at modifying the criteria and clarifying the number of molecular subtypes in triple negative breast cancer in accordance with expression profiles of 80 genes [16]. The workers have identified 4 molecular subgroups determined by overexpression of different genes, and specific biomarkers were shown for each of them: 1) luminal AR (LAR): androgen receptors, mucin (MUC 1); 2) mesenchymal (MES): IGF -1, ADRB 2, EDBRB, PTGER 3/4, PTGFR, PTGFRA; 3) basal-like immunosuppressive (BLIS): VTCN 1; 4) basal-like immunoactivated (BLIA): CTLA-4. The subgroups proved to be predictive for the relapse-free (p=0.019) and tumor-specific survival (p=0.07). The group-specific biomarkers can be considered as targets in the development of treatment for triple-negative breast cancer [17].

At the same time, it should be noted that the molecular typing of breast cancer tissues do not always correlate with spectrum and amount of appropriate proteins, i.e, with results of immunohistochemical studies. Hence, the existing classifications require further improvement.

Altered signaling pathways in breast cancer stem cells

Over recent decades, there has been increasing evidence that the characteristics of cancer stem cells (CSC) may determine high risk of metastases and drug resistance. Hence, the CSCs are one of the promising biomarkers for TNBC prognosis. Their quantitative and functional evaluation may inform about degree of tumor aggressiveness, whereas defective signaling pathways could be affected by targeted therapy.

Compared to other tumors, the TNBC clinical samples and cell lines show much higher contents of the cells with a CD 44+/CD 24-/ phenotype and high ALDH 1 expression. Clinical studies have shown that the expression of CD 44+/CD 24-/ is associated with decreased efficacy of chemotherapy, high incidence of distant metastasis, lymph node involvement, and recurrence, whereas ALDH 1 is an independent prognostic factor for long-term treatment outcomes. Detectable markers of the epithelial-mesenchymal transition (EMT) combined with high CSC concentration are also associated with resistance to chemotherapy and, in particular, to PARP inhibitors [19].

Self-renewal of malignant stem cells and other features providing invasiveness, resistance to therapy, and high metastatic potential, are associated with hyperactivation of several key signaling pathways, e.g., Notch, Wnt/β-catenin, Hedgehog, STAT 3. Thus, the Notch signaling cascade includes a family of transmembrane ligands and their receptors, which are critical for the processes of cell proliferation and differentiation. Disturbances of this cascade are detected in patients with lung cancer, prostate cancer, colorectal cancer, breast cancer and leukemia, thus regarded as prospective targets for anticancer drugs [20, 21].

To date, a lot of experimental and clinical data has been obtained confirming that dysregulation of the classical Wnt/β-catenin signaling pathway leads to increased incidence of distant metastases. The members of non-canonical Wnt-signaling pathway (FZD6 and FZD8) are also associated with aggressive behavior of the tumor and its chemoresistance [22, 23]. These molecules are considered potential targets for the newly developed drugs [24].

HH (Hedgehog) is a signaling pathway that promotes self-renewal of the CSC population. The HH family includes three secretory ligands: SHH (Sonic), expressed in embryonic cells; IHH (Indian), found predominantly in hematopoietic stem cells; DHH (Desert) found in cells of the peripheral nervous system and testicles. Overexpression of HH components (SHH, GLI 1/2, SMO) is associated with tumor invasion, angiogenesis, and chemoresistance and, therefore, with poor clinical prognosis. The components of this signaling pathway, especially SMO and GLI, are considered targets for the novel anticancer drugs [25].

TGF-β is a member of the cytokine superfamily, which includes more than 30 functionally related growth factors, including 3 TGF-β isoforms (TGF-β1-3) involved in the regulation of cell growth, adhesion, apoptosis, differentiation and immunoregulation. It inhibits the secretion and regulation of the functions of a number of cytokines, including IFN-γ, TNF-α, IL-2. The role of TGF-β in carcinogenesis is to promote proliferation, angiogenesis, metastasis, chemoresistance, immunosuppression. In addition, the presence of TGF-β is critical for CSC. TGF-β is secreted by the cells from tumor microenvironment which supports CSC population, and, in turn, promotes alternative polarization of immunocompetent cell precursors. In clinical practice, overexpression of TGF-β is a marker of chemoresistance and poor prognosis. TGF-β receptors are considered targets for some prospective drugs [26].

JAK/STAT signaling pathway plays an important role in a number of carcinogenesis-associated events, including proliferation, inflammation, and the pathological changes of microenvironment. E.g., JAK is a family of non-receptor tyrosine kinases that includes 4 components: JAK 1, JAK 2, JAK 3 and TYK 2. JAK 1, JAK 2 and TYK 2 are expressed in many cell types, whereas JAK 3 is specific to hematopoietic stem cells. Under the influence of cytokines and growth factors (IL-6, IL-8, TGF-β, IGF, EGF), the JAK/STAT 3 complex is activated causing overexpression of the genes providing synthesis of growth factors and cytokines (TGF-β, IL-6) which stimulate proliferation of TNBC cells. Experimental and clinical studies have shown that expression of IL-6, IL-8, and STAT 3 is associated with poor prognosis and chemoresistance [27-29].

Circulating tumor cells

Circulating tumor cells (CTC) are considered a potential biomarker associated with prognosis, prediction of efficacy, and treatment monitoring in TNBC. CellSearch technology is the conventional approach to CTCs isolation offered by Menarini Silicon Biosystems, based on recognition of EpCAM adhesion molecules [30]. In 2004, Cristofanilli et al. have shown that detection of >5 CTCs per 7.5 ml of blood is an independent predictor of overall and relapse-free survival of the patients with metastatic breast cancer. In 2019, the prognostic role of this marker was proven in the study in 1944 TNBC patients stratified into two large groups: indolent, for which standard treatment is adequate, and aggressive course, for which new, including experimental, methods of treatment were required [31].

However, the data on significance of CTC as a prognostic factor in TNBC patients still remain contradictory. E.g., Munzone E. et al., in retrospective analysis of data from 203 patients, showed that the number of CTCs correlated with overall survival, but not with progression-free survival. Meanwhile, in the SWOG study S0500, the CTC scores were found to be predictive of overall survival and predictive of chemotherapy efficacy [32]. At present, the most promising areas of CTC research are their molecular biology characterization, cluster studies, and combined assays with other biomarkers. The study which involved 360 TNBC cases has shown that occurrence of CTC clusters correlated with the median time to progression [33].

Genetic biomarkers

Molecular markers of TNBC include gene mutations affecting DNA repair systems, signaling molecules, growth factors and their receptors, as well as microsatellite instability and general mutation load. Among the mutated or overexpressed genes, specific targets are searched for the recently used and novel immunotherapeutic drugs. A separate group consists of immunological biomarkers. These indexes reflect the state of tumor microenvironment, peripheral immunological components, and tertiary lymphoid structures.

Mutations in genes associated with DNA repair

Finding the relationships between BRCA 1/2 gene mutations and inherited ovarian and breast tumors was a key discovery in clinical oncology, opening up new opportunities for screening and prevention. Detailed studies of appropriate mechanisms has led to the development of new treatment options. BRCA 1 and BRCA 2 are autosomal dominant genes that are critical in DNA repair by homologous recombination (homologus recombination repair, HRR). Mutations of BRCA 1 and BRCA 2 (gBRCAm) occur in a small part of the population (approximately 0.25%), whereas in women with TNBC their frequency varies from 11% to 31%. The risk of developing breast cancer with hereditary BRCA mutations is 65% and 45%, respectively [34]. These mutations may trigger an alternative DNA repair mechanism, i.e., a non-homologous end joining (NHEJ). This process depends on poly-ADP-ribose polymerase activity (PARP), and its inactivation leads to cell death. Currently, a number of PARP-blocking drugs entered the clinical practice, e.g., Olaparib, Talazoparib, Niraparib, Rucaparib, Veliparib [35].

In 2015, Domogala P. et al. studied the distribution of 36 mutations in genes involved in homologous recombination. They were found in 22% (35 out of 158) of the patients with TNBC [36], thus suggesting usage of PARP inhibitors and other DNA damaging agents for defects in other genes associated with HRD (homologus recombination deficiency) [37, 38]. Microsatellite instability (MSI) is an additional feature of malignant disease progression сaused by deficient DNA mismatch repair (dMMR). MSI is associated with highly frequent neoantigen production, thus affecting sensitivity to immunooncological drugs. Some tumor variants (colorectal cancer, endometrial cancer) are characterized by increased MSI rates (20%-30% of the cases).

Immunological markers for TNBC

Mutual interactions between the tumor and host immune system were studied for decades. In the mid-20th century, animal experiments on tumor xenotransplantation showed that effective antitumor immune response is possible only at high levels of tumor-specific antigens. Based on these data, in 1957 M. Burnet formulated the "clonal selection theory" and coined the term "immunological surveillance" [39]. In particular, it was suggested that the transformed cells expressing foreign antigens permanently occur in the body, being normally eliminated by the host immune system. This immune response is similar to classic "immunological surveillance" as described by M. Bernet. Over this period, the tumor cells are recognized and eliminated by factors of innate and adaptive immunity. Both immune cells of tumor microenvironment and peripheral blood may be of prognostic and predictive value. In both cases, quantitative characteristics and ratios of different populations, as well as concentration and production of cytokines (spontaneous and induced) should be assessed.

Lymphocytes and mononuclear cells in peripheral blood

In several studies concerning prognostic cellular markers in TNBC, an assessment was made of lymphocytes or peripheral blood mononuclear cells, as well as the ratios of different leukocyte subpopulations. E.g., a prognostic significance of lymphocytosis, monocytosis, and lymphocyte: monocyte ratio (LMR ≥ 4.7; p <0.001) was shown by He et al. (2016) in 230 patients with local and locally advanced forms of TNBC. Moreover, LMR correlated with tumor size (p <0.005) and disease stage (p=0.013) [40]. Losada B. et al., when studying a group of older BC patients have revealed by univariate analysis that еру platelet-lymphocyte ratio (PLR) is the only independent predictor of disease-free (p=0.04) and overall three-year survival (p=0.03), whereas, among the 3-year survivors (n=69), whereas only ALC has predictive properties in a multivariate analysis at the marginal significance level (p=0.04) [41].

Evaluation of myeloid and lymphoid cell subpopulations, either in peripheral blood, or in tumor microenvironment is a more accurate method for assessing the prognosis. Among lymphoid cells, the role of lymphocytes (CTL, Treg, B-lymphocytes), myeloid cells – monocytes/macrophages (M 1.2), dendritic cells (DC), and suppressor cells of myeloid origin (MDSC) have been studied [42].

Monocyte/macrophage cell lineage

To date, monocytes and macrophages (MFs) are shown to be associated with carcinogenesis in breast cancer, as well as with prognosis and efficiency of various treatment approaches. There are two macrophage subpopulations, M1 and M2, discerned in the tumor microenvironment and peripheral blood of the patients. M1 represents classical activated MFs, that develop from their precursors under the action of lipopolysaccharide, IFN-γ and TNF-α. M2 is the collective name for the macrophages induced via IL-4, IL-13, IL-10, TGF-β, Fc receptors, complement and glucocorticoids. M2 are derived from peripheral blood monocytes recruited to the affected site by chemokine ligands (CCL – 2, MCP – 1), colony-stimulating factors (M – CSF, CSF – 1) and vascular endothelial growth factor (VEGF), due to their higher concentration in the areas with low oxygenation. Under the chronic local hypoxia, the macrophages produce hypoxia-induced factors (HIF-1 and HIF-2) which derepress the synthesis of several proteins that increase angiogenic potential (VEGF, bFGF, PDGF), invasive and metastatic ability of tumor cells (MMP, CCL 2, CCL 18). Moreover, they promote arginase (Arg) and IDO expression, thus reducing local contents of arginine and tryptophan, which are essential to the normal functioning of T-lymphocytes and NK cells [43].

Concentration of M2 cells in peripheral blood is significantly higher compared to M1 population, thus correlating with a short relapse-free period in TNBC patients. The M2 macrophages are more common in the blood of patients with distant metastases. The ratio of monocyte subpopulations in TNBC differs from other types of breast cancer, i.e., the alternative polarization variant (CD 14+CD 16+) dominates over the classical one (CD 14hi CD 16-). High concentration of monocytes (CD 14+) is a predictor of good response to high-dose systemic therapy with cyclophosphamide and taxanes [44-46].

Dendritic cells (DCs) comprise a highly specialized subpopulation which performs uptake, processing, and antigen presentation within major MHC I and II histocompatibility complexes, along in combination with co-stimulatory Th molecules (CD 4+), acting with CTL in direct and indirect manner. They are activated by the "danger signals" from the tumor cells, including chemokines and neoantigens. The DC maturation, along with antigen-presenting functions includes expression of costimulatory molecules (CD40, ICAM I, CD80/86, CD 83), secretion of numerous cytokines (IFN-γ, IL-4, IL-5, IL-6, IL-10, IL-13), and migration to the lymph nodes, where the T-cell activation program is launched. In humans, two subpopulations of DC are morphologically and functionally distinguished. I.e., myeloid DC (mDCs) comprise classical DCs of the CD11c+ CD4+ CD45RO+ phenotype expressing MHC I, II which trigger the immune response upon contact with soluble antigens.

Plasmacytoid DCs (pDCs) display the CD11c- CD4+ CD45RA+ CD123+ phenotype and MHC I expression, being reactive for the cell-associated antigens. The DCs in TNBC patients showed reduced expression of cytokines (IL-12), co-stimulatory molecules (CD 80, CD 86), activation markers (HLA-DR), and lower ability to present antigens [47].

There are some controversial data on prognostic and predictive role of DC in the patients with TNBC. Despite conflicting data on the role of dendritic cells, considerable attention is paid to this cell population, in terms of vaccine therapy for cancer, in particular, breast cancer. According to several studies, their high levels may be a favorable prognostic factor for overall survival [48, 49]. However, further research is needed to determine their therapeutic potential in TNBC.

The populations of natural killer cells (NKs) are formed from a common lymphoid precursor in the bone marrow, from where they further spread to the primary and secondary lymphoid organs, as well as to the lungs, liver, and blood. Two NK subpopulations are identified in humans: CD56^bright CD 16- (cytokine-producing) and CD56^dim CD16+ (cytotoxic). In addition, there are several groups of NK depending on the degree of maturity, determined by the expression of CD 27 and CD11b surface markers which are not expressed by the immature NKs. In the course of maturation, CD 27 appears first, followed by CD11b. NK with the CD 27+ phenotype show the best ability for cytokine secretion, whereas the NK cells with CD11b+ CD27 phenotype demonstrate maximal cytolytic activity. NK can eliminate cells that do not express MHC I, and this mechanism is used by malignant cells and CSCs to prevent attack by CTLs. Potentially, NK cells are the most effective cells against the tumor, but they may acquire the CD56^bright CD16- phenotype under the influence of microenvironmental factors (TGF-β, adenosine), and express pro-angiogenic factors (MMP 9, VEGF), thus increasing the invasive potential, leading to T-cell depletion [59]. Low blood levels of NKs seem to predict low efficacy of neoadjuvant chemotherapy in TNBC. Expression of CD 163 and CXCR 4 in the NK microenvironment is a marker of early relapse [50, 51].

Tumor microenvironment

The study of the tumor microenvironment in TNBC is an important component of assessing the prognosis of the disease. From a clinical point of view, the cellular microenvironment can be assessed both quantitatively and qualitatively, taking into account the population profile, by the presence of a specific "immunological signature". Moreover, it is currently possible to assess the contents and production levels of cytokines by lymphoid cells of peripheral blood and tumor microenvironment. The lymphoid component, which makes up to 50-60% of the stromal volume in all molecular subtypes of TNBC, as a rule, suggests good prognosis and potential sensitivity to immuno-oncological drugs and chemotherapy [52, 53].

In 2020 He L. et al. conducted a meta-analysis of randomized trials with assessment of tumor-infiltrating lymphocytes (TIL) which reflected the results of treatment in 15,676 patients with breast cancer, including 3847 TNBC cases. The results of multivariate analysis showed that any 10% increase in TIL density was associated with increase in overall survival and complete morphological response rates for all molecular subtypes. High TIL density (≥50%) leads to a 2.7-fold increase in the complete response rates in TNB [54].

A similar study was done by Mao et al. [55]. They analyzed data from 25 works (22964 patients) concerning the major TIL subsets: CD 8+, Foxp 3+, PD-1+, γδ T cells, CD3+, CD4+. CD8+ TIL in the infiltrate proved to be a favorable prognostic factor for disease-free and tumor-specific survival in all subgroups. Foxp3+ TILs seem to be a dismal unfavorable prognostic factor for relapse-free and overall survival in all the subgroups except of TNBC. PD-1+ TIL and γδT TILs are poor prognostic factors for overall survival in all subgroups, whereas CD3+ TIL and CD4+ TIL did not show any predictive potential [55]. Thus, in most behavioral studies, the authors conclude that the formation of tertiary lymphoid organs is a favorable prognostic factor for TNBC.

Local and systemic concentrations of cytokines

Cytokines are currently considered universal regulators of homeostasis for many cell types. In TNBC, they are involved in regulation of angiogenesis, arrangement of immunosuppressive networks, tumor metastasis, and metabolic processes associated with obesity, chronic inflammation, and carcinogenesis. Involvement in carcinogenesis enables usage of the cytokines as prognostic markers. Cytokines can be measured in blood or in tumor microenvironment. Their contents, as well as spontaneous and induced production, may be assessed in these samples. IL-1, -6, -8, -10, -11, -17, -19, -20, -23, like as TNF-α; TGF-β, adipokines (leptin, adiponectin) are involved in TNBC carcinogenesis. Many of them have predictive potential (Table 2).

Table 2. Prognostic role of functional overexpression in microenvironment, or increased levels of cytokines in blood plasma in patients with triple-negative breast cancer

IL-6, 8, 10, TNF-α and TGF-β are the most studied cytokines associated with carcinogenesis and prognosis of TNBC. IL-6 is a cytokine that functionally integrates the immune and neuroendocrine systems, being produced by T cells, macrophages, myocytes, endotheliocytes, fibroblasts, and tumor cells. IL-6 promotes cell proliferation and synthesis of antibodies by B-lymphocytes, CTL proliferation, stimulates the granulocytic hematopoietic lineage, and induces the expression of acute phase proteins in the liver. Overexpression of IL-6 in malignant tumor and increased concentration in peripheral blood is considered an unfavorable prognostic factor in terms of overall and disease-free survival [67-69].

Interleukin-8 (IL -8) belongs to the chemokine family, being produced by the MF and endothelial cells. In the course of carcinogenesis, IL -8 can act as an autocrine growth factor and stimulate angiogenesis. Serum IL -8 is not a favorable prognostic factor for overall and disease-free survival [70-72].

IL-10 is a key regulator of the antitumor immune response. Treg, Th0, Th1, Th2, CTL, monocytes, MF, tumor cells, TAM and NK are the main producers of IL-10 in humans. Maturation by reducing MHC expression II, adhesion molecules and cytokines (IL-12), as well as reducing the sensitivity of receptors that respond to "danger signals". IL-10 inhibits proliferative activity and production of Th 1 cytokines, T-dependent activation of CTL and CD 19 [73]. The main biological effects of TNF – α in carcinogenesis are associated with the maintenance of the peritumoral inflammation, increased capillary permeability and stimulation of angiogenesis. The role of TNF-α in TNBC is twofold. On the one hand, it promotes EMT, on the other hand, it activates antitumor CTLs [74-76].

Recently, the workers at A.M.Granov Research Centre for Radiology and Surgical Technologies and Pavlov University have performed a pilot study to assess prognostic significance of subpopulations of lymphocytes and cytokines which involved 29 TNBC patients. Before and after neoadjuvant chemotherapy, the amounts of lymphocyte subpopulations and cytokine contents were measured in peripheral blood, as follows: CD3+CD8+ (cytotoxic lymphocytes); CD3+CD4+ (T helpers); CD4+CD8+ (double positive T cells); CD16+CD56+HLADR+ (activated natural killers); CD3+CD16+CD56+ (TNK cells); CD4+CD25+FoxP3 (T-regulatory cells); CD3+HLA DR+ (activated T cells); αβ T cells (alpha/beta T cells); γδ T cells (gamma/delta T cells); interleukin-1β (IL-1); interleukin-2 (IL-2); interleukin-4 (IL-4); interleukin-6 (IL-6); interleukin-8 (IL-8); interleukin-10 (IL-10); interleukin-12 (IL-12); interferon-α (IFN-α); interferon-γ (IFN-γ); tumor necrosis factor-α (TNF-α). The assays were carried out at Laboratory of Immunology, A.M. Nikiforov Center for Emergency and Radiation Medicine (St. Petersburg) using the Cytomics laser flow cytometer FC 500 (BECKMAN COULTER, USA). As a result of multivariate analysis, we have revealed that, among these parameters, the concentrations of T regulatory cells in peripheral blood (CD4+CD25+FoxP3) (p=0.045), as well as spontaneous production of IL-6 (p <0.005) and IL-10 (p <0.005) proved to be independent predictors of early relapse in triple-negative breast cancer.

The use of monoclonal antibodies in TNBC treatment

As already noted, specific tumor target antigens for immunotherapy have not yet been identified in breast cancer. Therefore, in recent years, much attention has been paid to the mobilization of immune surveillance of cells in the microenvironment. For example, many cancers are undergoing extensive clinical trials of immune checkpoint (ICT) inhibitors. These drugs relieve the state of local immunosuppression in these patients and enhance the activity of antitumor immunity. Reviewed by [77] Radoza et al. (2020) provide results from the IMpassion 130 program and other trials where therapy with antibodies to the programmed death receptor or its ligand (PD-1/PD-L1) and paclitaxel was used as first-line therapy for PDL 1-positive metastatic TNBC. Other ICT trials have used carboplatin or other cytotoxic drugs. The biological meaning of such combined schemes is the death of malignant cells and, which leads to the appearance of neoantigens – additional targets for activated immune cells of the patient. Along with this, within the framework of the generally accepted concept of targeted therapy for malignant neoplasms, programs of clinical trials of monoclonal antibodies are being carried out, against EGFR2 (epidermal growth factor receptor 2).

Potential targets for immunoconjugates of anticancer antibodies

A separate group of biomarkers is regarded as potential targets for a new group of drugs – conjugates of monoclonal antibodies with cytotoxic agents. Monoclonal antibodies bind to the target, and the complex is internalized into the tumor cell, realizing selective cytotoxicity. The target molecule for the conjugate must be overexpressed on the cell surface and have the property of internalization upon interaction with the ligand. Currently, several molecules have been identified in TNBC cells with the following properties: 1) non-metastatic glycoprotein b (GPNMB); 2) surface trophoblastic antigen-2 (Trop -2); 3) zinc-containing transport protein (LIV-1); 4) sialoglycomucin (CA 6).

GPNMB is involved in several processes associated with carcinogenesis, including cell migration, invasion, angiogenesis, and EMT. In addition, it is a biomarker of poor prognosis [90]. GPNMB is a target for Glematumumab vedotin (CDX -011), a conjugate containing a microtubule-destroying chemical agent, monomethyl auristatin E (MMAE), as an effector. Phase II data from the EMERGE study demonstrated that CDX -011 is more effective and less toxic than chemotherapy in TNBC patients with GPNMB overexpression [78, 79].

Trop -2 is a transmembrane glycoprotein involved in the processes of migration and proliferation, which is a target for Saccituzumab govitecan (IMMU -132), which contains a topoisomerase I inhibitor as an active agent. SN -38. Results of a phase II study of 33.3% objective responses in patients with TNBC in the third line of therapy [80, 81].

LIV -1 is involved in the regulation of STAT -3 expression, cell adhesion, and EMT. Preclinical studies have demonstrated the efficacy of Ladiratuzumab vedotin, which binds to the extracellular domain of LIV -1 [82].

CA 6 is selectively expressed on many solid tumor cells. It is a target for SAR 566658, which contains microtubule-destroying DM 4 as an active component [83].

Immune response inhibitors: PD1/PDL

Biomarkers that predict the effectiveness of immunotherapy in patients with TNBC include co-inhibitory molecules – targets of immunooncological drugs, microsatellite instability, mutation load, and tumor-infiltrating lymphocytes.

PD-1 is a co-inhibitory molecule that regulates the functions of components of the innate and adaptive immune response. It is expressed on the surface of T-lymphocytes, B-lymphocytes, MF, monocytes, DC. Under physiological conditions, it contributes to the formation of tolerance to autoantigens; in the tumor microenvironment, it promotes tumor immunological tolerance [84]. The PD-1 ligand (PD-L1) is a transmembrane protein that is expressed both on tumor and immunocompetent cells (T, B-lymphocytes, DC, MF). The interaction of PD-1/PD-L1 leads to deactivation of T-lymphocytes, activation of T-regulatory cells, and persistence of tumor cells [85, 86].

PD-L1 is expressed in 20% of TNBC cases. PD-L1 is expressed in about 10% on tumor cells, and 40-65% on cells of the tumor microenvironment. Expression of PD-L1 on tumor cells is a predictor of a favorable prognosis and a marker of sensitivity to chemotherapy [87]. Expression of PD-L1 on lymphocytes in the microenvironment is a marker of sensitivity to blockers of co-inhibiting molecules [88].

PD-1 and PD-L1 blockers are currently the standard treatment for TNBC. Atezolizumab (anti-PD-L1) was the first approved drug in this group for the treatment of its metastatic forms. The Phase III study IMPASSION 130 evaluated the efficacy and safety of atezolizumab and included 451 participants. The median overall survival in the group where the expression of PD-L1 ≥ 1% on the cells of the lymphoid infiltrate was significantly higher in the group where patients received atezolizumab in combination with nab-paclitaxel (25 and 18 months). To assess the expression of PD-L1 in the study, the test system VENTATA was used [89]. The efficacy and safety of pembrolizumab (anti-PD-1) in previously untreated patients in phase III was assessed in the KEYNOTE -355 protocol. The study included 847 patients who received various chemotherapy regimens (paclitaxel, nab-paclitaxel, platinum drugs and gemcitabine) in combination with placebo or pembrolizumab. Expression of PD-L1 was assessed in points using the 22С3 test system (DAKO PharmaDx), which considered the ratio of PD-L1 on tumor cells, lymphocytes and macrophages to the total number of detected tumor cells, multiplied by 100 (CPS, combined positive score). Significant differences in median relapse-free survival were found only at CPS ≥ 10 (9.7 months in the pembrolizumab group and 5.6 months in the placebo group). PD-1 and PD-L1 in patients with TNBC are associated with prognosis. PD-L1, in addition, plays the role of a predictive factor in relation to the effectiveness of blockers of co-inhibitory molecules [90, 91].

Cellular and immunotherapy of breast cancer

Early attempts of hematopoietic stem cell transplantation (HSCT)

In the 1980s, with the development of cytostatic therapy for solid tumors, it became necessary to maintain and restore hematopoiesis in patients with intensification of chemotherapy regimens. Therefore, methods of bone marrow transplantation taken from the patient himself (autologous BMT) before the start of intensive chemotherapy, in combination with hematopoiesis stimulation factors, were proposed. At the same time, the main problem was the purification of the harvested bone marrow of patients from metastatic tumor cells. At that time, there were no sufficiently effective immunological markers for the detection of malignant cells and their elimination in transplants. However, the first clinical studies of the 90s according to the use of auto-TKM in breast cancer, an increase in overall and recurrence-free survival was revealed in some patients [92]. However, later these positive results were not confirmed in larger samples and in randomized trials [93].

Subsequently, with the development of transplantation of hematopoietic and immune cells from HLA -compatible donors (allo-HSCT), there were proposals to use allogeneic cells to implement the immune effect "graft-versus-tumor", by analogy with the "graft-versus-leukemia" reaction in oncohematological diseases [94]. A positive effect of allo-HSCT was noted in some patients with solid neoplasms, including breast cancer. In general, the clinical response here was associated with the development of acute and chronic graft-versus-host disease. The authors pointed to low specificity and pronounced undesirable effects in this type of treatment.

The use of individual fractions of donor immune cells (primarily lymphocytes) for the adoptive therapy of solid cancers is considered. However, the authors express doubts about the duration of the therapeutic effects of adoptive immunotherapy [95]. It is possible that adoptive immunotherapy will find its place in combined regimens for the treatment of solid tumors, along with targeted drugs.

Current opportunities of cell therapy of breast cancer

One of the long-standing methods of biotherapy is the use of individual cell-based vaccines that have a therapeutic effect in breast cancer. Their clinical development is in the 2^nd-3^rd phases. Early work in this area consisted of short-term incubation of the patient's tumor tissues with his lymphocytes/monocytes with the addition of several cytokines to induce the presentation of these antigens and activate the response of immune cells (both T-lymphocytes and macrophages) to tumor antigens, after which these stimulated, the cells were returned to the patient. More modern approaches involve targeting antigens that are expressed mainly in malignant tumors and, to a much lesser extent, on normal cells. Typically, T-lymphocytes targeting these antigens are eliminated by the tolerance system. However, in this clinical situation, cell-based vaccines must be immunogenic enough to activate, among other things, T cells with low affinity for these antigens. Here it becomes expedient to use ICT to activate these cell populations. In addition, there is currently a search for individual mutations in the genome of cancer cells, based on which it is supposed to create cell-based vaccines for specific patients with cancer [96].

A few works [97] consider the possibility of using activated populations of natural killer (NK) cells of malignant killer T cells in oncological diseases. Most often, peripheral blood mononuclear cells are used for this and stimulated with interferon gamma and/or IL-2 for 2-3 days. In particular, Sommaggio et al. (2020), cytokine-induced killer cells (CECs) in combination with cetuximab (an EGFR inhibitor) showed good antitumor and antimetastatic efficacy in NOD/SCID (NSG) mice with human breast transplants [98].

One of the latest trends is the development of CAR-T cells as a selective means of eliminating malignant cells that carry a specific antigen.

Thus, some authors are considering the possibility of using CAR-T cells against the MAGE-A4 antigen, which is considered a promising target for the treatment of lung cancer and TNBC [99]. The main objective of this work was to select T cells directed against a small MAGE-A4 region recognized by the corresponding HLA-A2 allele. These TCR-T cells with CD4 markers showed a direct selective cytotoxic effect in vitro and in vivo (in mice with xenografts) against various human malignant tumors expressing the antigen MAGE-A4.

Epidermal growth factor receptor (EGFR) is one of the most promising targets in cell therapy for breast cancer, against which effective T-cell products with a chimeric antigen receptor have been developed. Chinese authors have created EGFR lines using a lentiviral vector. CAR-T cells against TNTC, which was tested on cells in vitro. The 3^rd-generation drugs caused a pronounced and specific suppression of the growth of tumor cells. At the same time, only minimal toxicity was noted in relation to normal breast cells. The antitumor effect was confirmed and in vivo in mice with transplanted human tumors. It is hypothesized that EGFR stimulation CAR T cells cause this population to proliferate and support their growth. Transcriptome studies have shown that the effect of CAR T cells consists in the activation of systems of ќ≥-interferon, granzyme-perforin, and enzymes of apoptosis of tumor cells.

Another possible target antigen for immunotherapy is the so-called ROR1 (tyrosine kinase-like orphan receptor 1). A group of German authors developed ROR 1-specific CARs T cells [100]. Their biological activity was assessed in 3D models of lung and breast tumors based on the corresponding cell lines similar in structure and phenotype to primary tumors. ROR 1- CAR T cells in this model had a pronounced antitumor effect, actively inhabiting the tumor tissue and destroying its cell layers. Thus, the fundamental possibility of bioeffects of these genetically modified T cells under conditions close to the situation in vivo was shown.

At the same time, the action of CAR T cells against tumors may be defective. Thus, the suppression of the cellular immune response under the influence of the widespread factor TGF-β is supposed. The already mentioned group of German authors [101] studied the issue of this pronounced immune suppression, and the ways of neutralizing this effect. For this purpose, the lines CD 8 + and CD 4 + were prepared. ROR 1- CAR T cells from healthy blood donors, and their antitumor activity was determined on TNBC cells (MDA-MB-231) in vitro and in 3D models. It turned out that adding TGF-β led to decreased viability, cytolytic activity, cytokine production, and ROR 1 – CAR proliferation. T cells in mixed culture with tumor cells. Blockade of the TGF-β receptor with a specific inhibitor SD-208 protected CD 8+ and CD 4+ ROR 1- CAR T cells from this inhibitory effect and maintained the antitumor properties of CAR T cells. Thus, to preserve the effects of CAR T cells may need combined exposure, in particular – and in subsequent testing of these cell products. Among the factors of tumor resistance is called immunosuppression, which may develop with the introduction of CAR T cells against EGFR, as shown by the same group of authors in experiments on mice with TNBC [102]. This negative effect of CAR T cell therapy is associated with the induction of interferons, suppression of the activity of a number of immune response genes and can be overcome with epigenesis inhibitors (for example, inhibitors of the CDK7 gene).

In addition to the generally accepted cell therapy for oncological diseases, additional means of enhancing the effects of chemotherapy on the tumor are also possible. Thus, it is known that the system of macrophages and other phagocytic cells is able to capture and inactivate most of the drug when it is administered in a free form. To solve this problem, various means are proposed for its microencapsulation and targeted delivery to the tumor tissue. Chinese authors proposed preparations of the so-called "analogs of apoptotic bodies" (AAT) prepared from malignant cells containing CD47 and adhesion molecules [103]. These artificial structures, according to the authors, combine antiphagocytic properties and, at the same time, can be used for more efficient delivery of chemotherapy drugs to the tumor. An increased accumulation of AAT and, accordingly, increased efficiency of encapsulated drugs has been shown in an experimental model of metastasis.

Conclusions

1. The search for new biomarkers of TNBC, as well as the assessment of their prognostic and therapeutic potential, is currently one of the main tasks in the development of effective individualized treatment programs.

2. Several lines of research seem to be the most promising. The first (diagnostic) is associated with the development of "liquid biopsy" technology and evaluation of biomarkers in the blood, including subpopulations of lymphocytes, spontaneous and induced production of cytokines.

3. To address these standardization issues, an international working group on tumor immunological biomarkers has now been established, as well as analytical centers for immunological monitoring, whose tasks include identification, assessment of prognostic and predictive potential, and validation of biomarkers.

4. Another direction is related to the improvement of the technology of 3D tumor models, which allow modeling the microenvironment and selecting the most specific effects on the tumor, in accordance with the individual biomarkers of a given patient.

5. In the field of TNBC cell therapy, the data of numerous clinical trials are gradually accumulating. The results obtained so far make it possible to determine the dosage, the frequency of administration and the possibility of combination with conventional cytostatic anticancer drugs. To date, EGFR may be a suitable target for cellular immunotherapy in TNBC, and appropriate CAR-T cell products may be promising in the future in the clinical setting.

Conflicting interests

Not declared.

Funding

The research was supported financially by Ministry of Health of the Russian Federation. State assignment 37.15-2021; 121040200135-3.

References

1. Hwang S-Y, Park S, Kwon Y. Recent therapeutic trends and promising targets in triple negative breast cancer. Pharmacol Ther. 2019;199: 30-57. doi: 10.1016/j.pharmthera.2019.02.006
2. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021; caac.21660. doi: 10.3322/caac.21660
3. Kaprin A, Starinsky V, Shakhzadova A. State of oncological care for Russian population in 2019. P.A. Herzen Moscov Res Inst Oncol. 2020, 239 p. (In Russian).
4. Gucalp A, Traina TA. Triple-Negative Breast Cancer: Adjuvant Therapeutic Options. Chemother Res Pract. 2011;2011: 1-13.
   doi: 10.1155/2011/696208
5. Zhang MH, Man HT, Zhao XD, Dong N, Ma SL. Estrogen receptor-positive breast cancer molecular signatures and therapeutic potentials (Review). Biomed Reports. 2014;2: 41-52. doi: 10.3892/br.2013.187
6. Perou CM, Sørlie T, Eisen MB, van de Rijn M, Jeffrey SS, Rees CA, et al. Molecular portraits of human breast tumours. Nature. 2000;406: 747-752. doi: 10.1038/35021093
7. Penault-Llorca F, Viale G. Pathological and molecular diagnosis of triple-negative breast cancer: a clinical perspective. Ann Oncol. 2012;23: vi19-vi22. doi: 10.1093/annonc/mds190
8. Yeh I-T, Mies C. Application of Immunohistochemistry to Breast Lesions. Arch Pathol Lab Med. 2008;132: 349-358.
   doi: 10.5858/2008-132-349-AOITBL
9. Prat A, Parker JS, Karginova O, Fan C, Livasy C, Herschkowitz JI, et al. Phenotypic and molecular characterization of the claudin-low intrinsic subtype of breast cancer. Breast Cancer Res. 2010;12: R68. doi: 10.1186/bcr2635
10. Prat A, Perou CM. Deconstructing the molecular portraits of breast cancer. Mol Oncol. 2011;5: 5-23. doi: 10.1016/j.molonc.2010.11.003
11. Sharma P. Biology and management of patients with triple-negative breast cancer. Oncologist. 2016;21: 1050-1062. doi: 10.1634/theoncologist.2016-0067
12. Fleisher B, Clarke C, Ait-Oudhia S. Current advances in biomarkers for targeted therapy in triple-negative breast cancer. Breast Cancer. 2016;8: 183-197. doi: 10.2147/BCTT.S114659
13. https://clinicaltrials.gov/
14. Curtis C, Shah SP, Chin S-F, Turashvili G, Rueda OM, Dunning MJ, et al. The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups. Nature. 2012;486: 346-352. doi: 10.1038/nature10983
15. Lehmann BD, Pietenpol JA. Identification and use of biomarkers in treatment strategies for triple-negative breast cancer subtypes. J Pathol. 2014;232: 142-150. doi: 10.1002/path.4280
16. Burstein MD, Tsimelzon A, Poage GM, Covington KR, Contreras A, Fuqua SAW, et al. Comprehensive genomic analysis identifies novel subtypes and targets of triple-negative breast cancer. Clin Cancer Res. 2015;21: 1688-1698. doi: 10.1158/1078-0432.CCR-14-0432
17. Liu Y-R, Jiang Y-Z, Xu X-E, Yu K-D, Jin X, Hu X, et al. Comprehensive transcriptome analysis identifies novel molecular subtypes and subtype-specific RNAs of triple-negative breast cancer. Breast Cancer Res. 2016;18: 33. doi: 10.1186/s13058-016-0690-8
18. Masuda H, Baggerly KA, Wang Y, Zhang Y, Gonzalez-Angulo AM, Meric-Bernstam F, et al. Differential Response to Neoadjuvant Chemotherapy Among 7 Triple-Negative Breast Cancer Molecular Subtypes. Clin Cancer Res. 2013;19: 5533-5540. doi: 10.1158/1078-0432.CCR-13-0799
19. Talukdar Y, Rashkow JT, Lalwani G, Kanakia S, Sitharaman B. The effects of graphene nanostructures on mesenchymal stem cells. Biomaterials. 2014;35: 4863-4877. doi: 10.1016/j.biomaterials.2014.02.054
20. Speiser JJ, Erşahin Ç, Osipo C. The functional role of notch signaling in triple-negative breast cancer. Vitamins & Hormones. 2013; 93: 277-306. doi: 10.1016/B978-0-12-416673-8.00013-7
21. Miele L, Espinoza I, Pochampally, Watabe, Xing F. Notch signaling: targeting cancer stem cells and epithelial-to-mesenchymal transition. Onco Targets Ther. 2013; 1249. doi: 10.2147/OTT.S36162
22. Corda G, Sala G, Lattanzio R, Iezzi M, Sallese M, Fragassi G, et al. Functional and prognostic significance of the genomic amplification of frizzled 6 ( FZD6 ) in breast cancer. J Pathol. 2017;241: 350-361. doi: 10.1002/path.4841
23. Yin S, Xu L, Bonfil RD, Banerjee S, Sarkar FH, Sethi S, et al. Tumor-Initiating Cells and FZD8 Play a Major Role in Drug Resistance in Triple-Negative Breast Cancer. Mol Cancer Ther. 2013;12: 491-498. doi: 10.1158/1535-7163.MCT-12-1090
24. Li W, Yang H, Li X, Han L, Xu N, Shi A. Signaling pathway inhibitors target breast cancer stem cells in triple-negative breast cancer. Oncol Rep. 2018. doi: 10.3892/or.2018.6805
25. Bhateja P, Cherian M, Majumder S, Ramaswamy B. The hedgehog signaling pathway: a viable target in breast cancer? Cancers (Basel). 2019;11: 1126. doi: 10.3390/cancers11081126
26. Xu X, Zhang L, He X, Zhang P, Sun C, Xu X, et al. TGF-β plays a vital role in triple-negative breast cancer (TNBC) drug-resistance through regulating stemness, EMT and apoptosis. Biochem Biophys Res Commun. 2018;502: 160-165. doi: 10.1016/j.bbrc.2018.05.139
27. He L, Gu J, Lim LY, Yuan Z, Mo J. Nanomedicine-mediated therapies to target breast cancer stem cells. Front Pharmacol. 2016;7.
    doi: 10.3389/fphar.2016.00313
28. Guanizo AC, Fernando CD, Garama DJ, Gough DJ. STAT3: a multifaceted oncoprotein. Growth Factors. 2018;36: 1-14. doi: 10.1080/08977194.2018.1473393
29. Moreira MP, da Conceição Braga L, Cassali GD, Silva LM. STAT3 as a promising chemoresistance biomarker associated with the CD44 +/high /CD24 -/low /ALDH + BCSCs-like subset of the triple-negative breast cancer (TNBC) cell line. Exp Cell Res. 2018;363: 283-290. doi: 10.1016/j.yexcr.2018.01.018
30. Cristofanilli M, Hayes DF, Budd GT, Ellis MJ, Stopeck A, Reuben JM, et al. Circulating tumor cells: a novel prognostic factor for newly diagnosed metastatic breast cancer. J Clin Oncol. 2005;23: 1420-1430. doi: 10.1200/JCO.2005.08.140
31. Cristofanilli M, Pierga J-Y, Reuben J, Rademaker A, Davis AA, Peeters DJ, et al. The clinical use of circulating tumor cells (CTCs) enumeration for staging of metastatic breast cancer (MBC): International expert consensus paper. Crit Rev Oncol Hematol. 2019;134: 39-45. doi: 10.1016/j.critrevonc.2018.12.004
32. Munzone E, Botteri E, Sandri MT, Esposito A, Adamoli L, Zorzino L, et al. Prognostic value of circulating tumor cells according to immunohistochemically defined molecular subtypes in advanced breast cancer. Clin Breast Cancer. 2012;12: 340-346. doi: 10.1016/j.clbc.2012.07.001
33. Smerage JB, Barlow WE, Hortobagyi GN, Winer EP, Leyland-Jones B, Srkalovic G, et al. Circulating tumor cells and response to chemotherapy in metastatic breast cancer: SWOG S0500. J Clin Oncol. 2014;32: 3483-3489. doi: 10.1200/JCO.2014.56.2561
34. Qin J-J, Yan L, Zhang J, Zhang W-D. STAT3 as a potential therapeutic target in triple negative breast cancer: a systematic review.
    J Exp Clin Cancer Res. 2019;38: 195. doi: 10.1186/s13046-019-1206-z
35. Evans DG, Howell A, Ward D, Lalloo F, Jones JL, Eccles DM. Prevalence of BRCA1 and BRCA2 mutations in triple negative breast cancer. J Med Genet. 2011;48: 520-522. doi: 10.1136/jmedgenet-2011-100006
36. Kuroda H, Sakamoto G, Ohnisi K, Itoyama S. Clinical and pathological features of glycogen-rich clear cell carcinoma of the breast. Breast Cancer. 2005;12: 189-195. doi: 10.2325/jbcs.12.189
37. Domagala P, Jakubowska A, Jaworska-Bieniek K, Kaczmarek K, Durda K, Kurlapska A, et al. Prevalence of germline mutations in genes engaged in dna damage repair by homologous recombination in patients with triple-negative and hereditary non-triple-negative breast cancers. PLoS One. 2015;10: e0130393. doi: 10.1371/journal.pone.0130393
38. Sun K, Mikule K, Wang Z, Poon G, Vaidyanathan A, Smith G, et al. A comparative pharmacokinetic study of PARP inhibitors demonstrates favorable properties for niraparib efficacy in preclinical tumor models. Oncotarget. 2018;9: 37080-7096. doi: 10.18632/oncotarget.26354
39. Burnet M. Cancer. A Biological Approach: I. The Processes Of Control. II. The Significance of Somatic Mutation. BMJ. 1957;1: 779-786. doi: 10.1136/bmj.1.5022.779
40. He J, Lv P, Yang X, Chen Y, Liu C, Qiu X. Pretreatment lymphocyte to monocyte ratio as a predictor of prognosis in patients with early-stage triple-negative breast cancer. Tumor Biol. 2016;37: 9037-9043. doi: 10.1007/s13277-016-4793-8
41. Losada B, Guerra JA, Malón D, Jara C, Rodriguez L, Del Barco S. Pretreatment neutrophil/lymphocyte, platelet/lymphocyte, lymphocyte/monocyte, and neutrophil/monocyte ratios and outcome in elderly breast cancer patients. Clin Transl Oncol. 2019;21: 855-863. doi: 10.1007/s12094-018-1999-9
42. Batalha S, Ferreira S, Brito C. The Peripheral immune landscape of breast cancer: clinical findings and in vitro models for biomarker discovery. Cancers (Basel). 2021;13: 1305. doi: 10.3390/cancers13061305
43. Hung C-H, Chen F-M, Lin Y-C, Tsai M-L, Wang S-L, Chen Y-C, et al. Altered monocyte differentiation and macrophage polarization patterns in patients with breast cancer. BMC Cancer. 2018;18: 366. doi: 10.1186/s12885-018-4284-y
44. Zhang B, Cao M, He Y, Liu Y, Zhang G, Yang C, et al. Increased circulating M2-like monocytes in patients with breast cancer. Tumor Biol. 2017;39: 101042831771157. doi: 10.1177/1010428317711571
45. Lafrenie RM, Speigl L, Buckner CA, Pawelec G, Conlon MS, Shipp C. Frequency of immune cell subtypes in peripheral blood correlates with outcome for patients with metastatic breast cancer treated with high-dose chemotherapy. Clin Breast Cancer. 2019;19: 433-442. doi: 10.1016/j.clbc.2019.05.002
46. Holl EK, Frazier VN, Landa K, Beasley GM, Hwang ES, Nair SK. Examining peripheral and tumor cellular immunome in patients with cancer. Front Immunol. 2019;10. doi: 10.3389/fimmu.2019.01767
47. Wculek SK, Cueto FJ, Mujal AM, Melero I, Krummel MF, Sancho D. Dendritic cells in cancer immunology and immunotherapy. Nat Rev Immunol. 2020;20: 7-24. doi: 10.1038/s41577-019-0210-z
48. Lee H, Lee HJ, Song IH, Bang WS, Heo S-H, Gong G, et al. CD11c-positive dendritic cells in triple-negative breast cancer. In Vivo. 2018;32: 1561-1569. doi: 10.21873/invivo.11415
49. Kini Bailur J, Gueckel B, Pawelec G. Prognostic impact of high levels of circulating plasmacytoid dendritic cells in breast cancer.
    J Transl Med. 2016;14: 151. doi: 10.1186/s12967-016-0905-x
50. Verma C, Kaewkangsadan V, Eremin JM, Cowley GP, Ilyas M, El-Sheemy MA, et al. Natural killer (NK) cell profiles in blood and tumour in women with large and locally advanced breast cancer (LLABC) and their contribution to a pathological complete response (PCR) in the tumour following neoadjuvant chemotherapy (NAC): differential rest. J Transl Med. 2015;13: 180. doi: 10.1186/s12967-015-0535-8
51. Foulds GA, Vadakekolathu J, Abdel-Fatah TMA, Nagarajan D, Reeder S, Johnson C, et al. Immune-phenotyping and transcriptomic profiling of peripheral blood mononuclear cells from patients with breast cancer: identification of a 3 gene signature which predicts relapse of triple negative breast cancer. Front Immunol. 2018;9. doi: 10.3389/fimmu.2018.02028
52. Bates JP, Derakhshandeh R, Jones L, Webb TJ. Mechanisms of immune evasion in breast cancer. BMC Cancer. 2018;18: 556. doi: 10.1186/s12885-018-4441-3
53. Adams S, Gray RJ, Demaria S, Goldstein L, Perez EA, Shulman LN, et al. Prognostic value of tumor-infiltrating lymphocytes in triple-negative breast cancers from two Phase III randomized adjuvant breast cancer trials: ECOG 2197 and ECOG 1199. J Clin Oncol. 2014;32: 2959-2966. doi: 10.1200/JCO.2013.55.0491
54. He L, Wang Y, Wu Q, Song Y, Ma X, Zhang B, et al. Association between levels of tumor-infiltrating lymphocytes in different subtypes of primary breast tumors and prognostic outcomes: a meta-analysis. BMC Womens Health. 2020;20: 194.
    doi: 10.1186/s12905-020-01038-x
55. Mao Y, Qu Q, Chen X, Huang O, Wu J, Shen K. The prognostic value of tumor-infiltrating lymphocytes in breast cancer: a systematic review and meta-analysis. Tagliabue E, editor. PLoS One. 2016;11: e0152500. doi: 10.1371/journal.pone.0152500
56. Salimi M, Wang R, Yao X, Li X, Wang X, Hu Y, et al. Activated innate lymphoid cell populations accumulate in human tumour tissues. BMC Cancer. 2018;18: 341. doi: 10.1186/s12885-018-4262-4
57. Onesti CE, Josse C, Boulet D, Thiry J, Beaumecker B, Bours V, et al. Blood eosinophilic relative count is prognostic for breast cancer and associated with the presence of tumor at diagnosis and at time of relapse. Oncoimmunology. 2020;9. doi: 10.1080/2162402X.2020.1761176
58. Varricchi G, Galdiero MR, Loffredo S, Lucarini V, Marone G, Mattei F, et al. Eosinophils: The unsung heroes in cancer? Oncoimmunology. 2018;7: e1393134. doi: 10.1080/2162402X.2017.1393134
59. Aponte-López A, Fuentes-Pananá EM, Cortes-Muñoz D, Muñoz-Cruz S. Mast Cell, the Neglected Member of the Tumor Microenvironment: Role in Breast Cancer. J Immunol Res. 2018;2018: 1-11. doi: 10.1155/2018/2584243
60. Rajput AB, Turbin DA, Cheang MC, Voduc DK, Leung S, Gelmon KA, et al. Stromal mast cells in invasive breast cancer are a marker of favourable prognosis: a study of 4,444 cases. Breast Cancer Res Treat. 2008;107: 249-257. doi: 10.1007/s10549-007-9546-3
61. Yu X, Zhang Z, Wang Z, Wu P, Qiu F, Huang J. Prognostic and predictive value of tumor-infiltrating lymphocytes in breast cancer: a systematic review and meta-analysis. Clin Transl Oncol. 2016;18: 497-506. doi: 10.1007/s12094-015-1391-y
62. Mahmoud SMA, Paish EC, Powe DG, Macmillan RD, Grainge MJ, Lee AHS, et al. Tumor-infiltrating CD8+ lymphocytes predict clinical outcome in breast cancer. J Clin Oncol. 2011;29: 1949-1955. doi: 10.1200/JCO.2010.30.5037
63. Irshad S, Flores-Borja F, Lawler K, Monypenny J, Evans R, Male V, et al. RORγt+ Innate lymphoid cells promote lymph node metastasis of breast cancers. Cancer Res. 2017;77: 1083-1096. doi: 10.1158/0008-5472.CAN-16-0598
64. Iwamoto M, Shinohara H, Miyamoto A, Okuzawa M, Mabuchi H, Nohara T, et al. Prognostic value of tumor-infiltrating dendritic cells expressing CD83 in human breast carcinomas. Int J Cancer. 2003;104: 92-97. doi: 10.1002/ijc.10915
65. Brown JR, Wimberly H, Lannin DR, Nixon C, Rimm DL, Bossuyt V. Multiplexed Quantitative analysis of CD3, CD8, and CD20 predicts response to neoadjuvant chemotherapy in breast cancer. Clin Cancer Res. 2014;20: 5995-6005. doi: 10.1158/1078-0432.CCR-14-1622
66. Gu-Trantien C, Loi S, Garaud S, Equeter C, Libin M, de Wind A, et al. CD4+ follicular helper T cell infiltration predicts breast cancer survival. J Clin Invest. 2013;123: 2873-2892. doi: 10.1172/JCI67428
67. Oshi M, Newman S, Tokumaru Y, Yan L, Matsuyama R, Endo I, et al. Inflammation is associated with worse outcome in the whole cohort but with better outcome in triple-negative subtype of breast cancer patients. J Immunol Res. 2020;2020: 1-17. doi: 10.1155/2020/5618786
68. Martínez-Pérez C, Kay C, Meehan J, Gray M, Dixon JM, Turnbull AK. The IL6-like cytokine family: Role and biomarker potential in breast cancer. J Pers Med. 2021;11: 1073. doi: 10.3390/jpm11111073
69. Ma Y, Ren Y, Dai Z-J, Wu C-J, Ji Y-H, Xu J. IL-6, IL-8 and TNF-α levels correlate with disease stage in breast cancer patients. Adv Clin Exp Med. 2017;26: 421-426. doi: 10.17219/acem/62120
70. Zuccari DAP de C, Leonel C, Castro R, Gelaleti GB, Jardim BV, Moscheta MG, et al. An immunohistochemical study of interleukin-8 (IL-8) in breast cancer. Acta Histochem. 2012;114: 571-576. doi: 10.1016/j.acthis.2011.10.007
71. Singh JK, Simões BM, Howell SJ, Farnie G, Clarke RB. Recent advances reveal IL-8 signaling as a potential key to targeting breast cancer stem cells. Breast Cancer Res. 2013;15: 210. doi: 10.1186/bcr3436
72. Todorović-Raković N, Milovanović J. Interleukin-8 in breast cancer progression. J Interf Cytokine Res. 2013;33: 563-570.
    doi: 10.1089/jir.2013.0023
73. Chang C-M, Lam HP, Hsu H-J, Jiang S-J. Interleukin-10: A double-edged sword in breast cancer. Tzu Chi Med J. 2021;33: 203.
    doi: 10.4103/tcmj.tcmj_162_20
74. Gao W, Wen H, Liang L, Dong X, Du R, Zhou W, et al. IL20RA signaling enhances stemness and promotes the formation of an immunosuppressive microenvironment in breast cancer. Theranostics. 2021;11: 2564-2580. doi: 10.7150/thno.45280
75. Li C-J, Chu P-Y, Yiang G-T, Wu M-Y. The Molecular Mechanism of Epithelial-Mesenchymal Transition for Breast Carcinogenesis. Biomolecules. 2019;9: 476. doi: 10.3390/biom9090476
76. Yu Y, Wang Y, Ren X, Tsuyada A, Li A, Liu LJ, et al. Context-dependent bidirectional regulation of the MutS homolog 2 by transforming growth factor β contributes to chemoresistance in breast cancer cells. Mol Cancer Res. 2010;8: 1633-1642.
    doi: 10.1158/1541-7786.MCR-10-0362
77. Radosa JC, Stotz L, Müller C, Kaya AC, Solomayer E-F, Radosa MP. Clinical data on immunotherapy in breast cancer. Breast Care. 2020;15: 450-469. doi: 10.1159/000511788
78. Yardley DA, Weaver R, Melisko ME, Saleh MN, Arena FP, Forero A, et al. EMERGE: A randomized Phase II study of the antibody-drug conjugate glembatumumab vedotin in advanced glycoprotein NMB-expressing breast cancer. J Clin Oncol. 2015;33: 1609-1619.
    doi: 10.1200/JCO.2014.56.2959
79. Wolska-Washer A, Robak T. Safety and tolerability of antibody-drug conjugates in cancer. Drug Saf. 2019;42: 295-314.
    doi: 10.1007/s40264-018-0775-7
80. Goldenberg DM, Sharkey RM. Antibody-drug conjugates targeting TROP-2 and incorporating SN-38: A case study of anti-TROP-2 sacituzumab govitecan. MAbs. 2019;11: 987-995. doi: 10.1080/19420862.2019.1632115
81. Bardia A, Mayer IA, Vahdat LT, Tolaney SM, Isakoff SJ, Diamond JR, et al. Sacituzumab Govitecan-hziy in refractory metastatic triple-negative breast cancer. N Engl J Med. 2019;380: 741-751. doi: 10.1056/NEJMoa1814213
82. Nejadmoghaddam M-R, Minai-Tehrani A, Ghahremanzadeh R, Mahmoudi M, Dinarvand R, Zarnani A-H. Antibody-Drug conjugates: Possibilities and challenges. Avicenna J Med Biotechnol. 11: 3-23. Available: http://www.ncbi.nlm.nih.gov/pubmed/30800238
83. Gomez-Roca CA, Boni V, Moreno V, Morris JC, Delord J-P, Calvo E, et al. A phase I study of SAR566658, an anti CA6-antibody drug conjugate (ADC), in patients (Pts) with CA6-positive advanced solid tumors (STs)(NCT01156870). J Clin Oncol. 2016;34: 2511-2511. doi: 10.1200/JCO.2016.34.15_suppl.2511
84. Ahmadzadeh M, Johnson LA, Heemskerk B, Wunderlich JR, Dudley ME, White DE, et al. Tumor antigen-specific CD8 T cells infiltrating the tumor express high levels of PD-1 and are functionally impaired. Blood. 2009;114: 1537-1544. doi: 10.1182/blood-2008-12-195792
85. Salmaninejad A, Khoramshahi V, Azani A, Soltaninejad E, Aslani S, Zamani MR, et al. PD-1 and cancer: molecular mechanisms and polymorphisms. Immunogenetics. 2018;70: 73-86. doi: 10.1007/s00251-017-1015-5
86. Boussiotis VA. Molecular and biochemical aspects of the PD-1 checkpoint pathway. Longo DL, editor. N Engl J Med. 2016;375: 1767-1778. doi: 10.1056/NEJMra1514296
87. Van Berckelaer C, Rypens C, van Dam P, Pouillon L, Parizel M, Schats KA, et al. Infiltrating stromal immune cells in inflammatory breast cancer are associated with an improved outcome and increased PD-L1 expression. Breast Cancer Res. 2019;21: 28.
    doi: 10.1186/s13058-019-1108-1
88. Bertucci F, Gonçalves A. Immunotherapy in breast cancer: the emerging role of PD-1 and PD-L1. Curr Oncol Rep. 2017;19: 64.
    doi: 10.1007/s11912-017-0627-0
89. Stover DG, Parsons HA, Ha G, Freeman SS, Barry WT, Guo H, et al. Association of cell-free DNA tumor fraction and somatic copy number alterations with survival in metastatic triple-negative breast cancer. J Clin Oncol. 2018;36: 543-553. doi: 10.1200/JCO.2017.76.0033
90. Schmid P, Rugo HS, Adams S, Schneeweiss A, Barrios CH, Iwata H, et al. Atezolizumab plus nab-paclitaxel as first-line treatment for unresectable, locally advanced or metastatic triple-negative breast cancer (IMpassion130): updated efficacy results from a randomised, double-blind, placebo-controlled, phase 3 trial. Lancet Oncol. 2020;21: 44-59. doi: 10.1016/S1470-2045(19)30689-8
91. Cortes J, Cescon DW, Rugo HS, Nowecki Z, Im S-A, Yusof MM, et al. Pembrolizumab plus chemotherapy versus placebo plus chemotherapy for previously untreated locally recurrent inoperable or metastatic triple-negative breast cancer (KEYNOTE-355): a randomised, placebo-controlled, double-blind, phase 3 clinical trial. Lancet. 2020;396: 1817-1828. doi: 10.1016/S0140-6736(20)32531-9
92. Myers SE, Williams SF. Role of high-dose chemotherapy and autologous stem cell support in treatment of breast cancer. Hematol Oncol Clin North Am. 1993;7: 631-645. PMID: 8102137
93. Hamilton RF, Tsuruoka S, Wu N, Wolfarth M, Porter DW, Bunderson-Schelvan M, et al. Length, but not reactive edges, of cup-stack MWCNT is responsible for toxicity and acute lung inflammation. Toxicol Pathol. 2018;46: 62-74. doi: 10.1177/0192623317732303
94. Demirer T, Barkholt L, Blaise D, Pedrazzoli P, Aglietta M, Carella AM, et al. Transplantation of allogeneic hematopoietic stem cells: an emerging treatment modality for solid tumors. Nat Clin Pract Oncol. 2008;5: 256-67. doi: 10.1038/ncponc1104
95. Mondino A, Manzo T. To Remember or to Forget: The Role of good and bad memories in adoptive T cell therapy for tumors. Front Immunol. 2020;11: 1915. doi: 10.3389/fimmu.2020.01915
96. Sahin U, Derhovanessian E, Miller M, Kloke B-P, Simon P, Löwer M, et al. Personalized RNA mutanome vaccines mobilize poly-specific therapeutic immunity against cancer. Nature. 2017;547: 222-226. doi: 10.1038/nature23003
97. Davari K, Holland T, Prassmayer L, Longinotti G, Ganley KP, Pechilis LJ, et al. Development of a CD8 co-receptor independent T-cell receptor specific for tumor-associated antigen MAGE-A4 for next generation T-cell-based immunotherapy. J Immunother cancer. 2021;9. doi: 10.1136/jitc-2020-002035
98. Sommaggio R, Cappuzzello E, Dalla Pietà A, Tosi A, Palmerini P, Carpanese D, et al. Adoptive cell therapy of triple negative breast cancer with redirected cytokine-induced killer cells. Oncoimmunology. 2020;9. doi: 10.1080/2162402X.2020.1777046
99. Xia L, Zheng Z-Z, Liu J-Y, Chen Y-J, Ding J-C, Xia N-S, et al. EGFR-targeted CAR-T cells are potent and specific in suppressing triple-negative breast cancer both in vitro and in vivo. Clin Transl Immunol. 2020;9: e01135. doi: 10.1002/cti2.1135
100. Wallstabe L, Göttlich C, Nelke LC, Kühnemundt J, Schwarz T, Nerreter T, et al. ROR1-CAR T cells are effective against lung and breast cancer in advanced microphysiologic 3D tumor models. JCI insight. 2019;4. doi: 10.1172/jci.insight.126345
101. Stüber T, Monjezi R, Wallstabe L, Kühnemundt J, Nietzer SL, Dandekar G, et al. Inhibition of TGF-β-receptor signaling augments the antitumor function of ROR1-specific CAR T-cells against triple-negative breast cancer. J Immunother Cancer. 2020;8: e000676.
     doi: 10.1136/jitc-2020-000676
102. Xia L, Zheng Z, Liu J, Chen Y, Ding J, Hu G, et al. Targeting Triple-Negative Breast Cancer with Combination Therapy of EGFR CAR T Cells and CDK7 Inhibition. Cancer Immunol Res. 2021;9: 707-722. doi: 10.1158/2326-6066.CIR-20-0405
103. Zhang K, Fu H, Xing C, Luo Y, Cheng F, Fu Q, et al. "Don’t eat me/eat me" – combined apoptotic body analogues for efficient targeted therapy of triple-negative breast cancer. J Mater Chem B. 2021;9: 8472-8479. doi: 10.1039/d1tb01116b

" ["DETAIL_TEXT_TYPE"]=> string(4) "html" ["~DETAIL_TEXT_TYPE"]=> string(4) "html" ["PREVIEW_TEXT"]=> string(0) "" ["~PREVIEW_TEXT"]=> string(0) "" ["PREVIEW_TEXT_TYPE"]=> string(4) "text" ["~PREVIEW_TEXT_TYPE"]=> string(4) "text" ["PREVIEW_PICTURE"]=> NULL ["~PREVIEW_PICTURE"]=> NULL ["LANG_DIR"]=> string(4) "/ru/" ["~LANG_DIR"]=> string(4) "/ru/" ["SORT"]=> string(2) "20" ["~SORT"]=> string(2) "20" ["CODE"]=> string(100) "biologicheskie-markery-troynogo-negativnogo-raka-molochnoy-zhelezy-poisk-misheney-dlya-immunotargetn" ["~CODE"]=> string(100) "biologicheskie-markery-troynogo-negativnogo-raka-molochnoy-zhelezy-poisk-misheney-dlya-immunotargetn" ["EXTERNAL_ID"]=> string(4) "2058" ["~EXTERNAL_ID"]=> string(4) "2058" ["IBLOCK_TYPE_ID"]=> string(7) "journal" ["~IBLOCK_TYPE_ID"]=> string(7) "journal" ["IBLOCK_CODE"]=> string(7) "volumes" ["~IBLOCK_CODE"]=> string(7) "volumes" ["IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["~IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["LID"]=> string(2) "s2" ["~LID"]=> string(2) "s2" ["EDIT_LINK"]=> NULL ["DELETE_LINK"]=> NULL ["DISPLAY_ACTIVE_FROM"]=> string(0) "" ["IPROPERTY_VALUES"]=> array(18) { ["ELEMENT_META_TITLE"]=> string(222) "Биологические маркеры тройного негативного рака молочной железы: поиск мишеней для иммунотаргетной и клеточной терапии" ["ELEMENT_META_KEYWORDS"]=> string(0) "" ["ELEMENT_META_DESCRIPTION"]=> string(319) "Биологические маркеры тройного негативного рака молочной железы: поиск мишеней для иммунотаргетной и клеточной терапииBiomarkers and potential targets for immune and cellular therapy in triple negative breast cancer" ["ELEMENT_PREVIEW_PICTURE_FILE_ALT"]=> string(2380) "<p style="text-align: justify;">Трижды негативный рак молочной железы является одним из наиболее агрессивных. Он представляет собой гетерогенную группу заболеваний с различными молекулярными дефектами, требующими дифференцированного подхода к диагностике и лечению. В статье приведены данные о современных молекулярных классификациях трижды негативного рака молочной железы и дефектах сигнальных путей, а также продемонстрирована их связь с иммунологическими и неиммунологическими биомаркерами. Обобщены данные о прогностической и предсказательной роли молекулярных биомаркеров, существующих и разрабатываемых подходах к разработке таргетных препаратов, для которых они являются мишенями, а также перспективных методах клеточной терапии. Приведены данные собственных исследований, касающиеся оценки прогностической роли цитокинов и субпопуляций лимфоцитов в крови пациентов с трижды негативным раком молочной железы, обозначены перспективы дальнейших исследований.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Рак молочной железы, трижды негативный, молекулярные подтипы, мутационная нагрузка, стволовые опухолевые клетки, циркулирующие опухолевые клетки, клеточное микроокружение, субпопуляции лимфоцитов, интерлейкины, молекулярные мишени, клеточная терапия.</p>" ["ELEMENT_PREVIEW_PICTURE_FILE_TITLE"]=> string(222) "Биологические маркеры тройного негативного рака молочной железы: поиск мишеней для иммунотаргетной и клеточной терапии" ["ELEMENT_DETAIL_PICTURE_FILE_ALT"]=> string(222) "Биологические маркеры тройного негативного рака молочной железы: поиск мишеней для иммунотаргетной и клеточной терапии" ["ELEMENT_DETAIL_PICTURE_FILE_TITLE"]=> string(222) "Биологические маркеры тройного негативного рака молочной железы: поиск мишеней для иммунотаргетной и клеточной терапии" ["SECTION_META_TITLE"]=> string(222) "Биологические маркеры тройного негативного рака молочной железы: поиск мишеней для иммунотаргетной и клеточной терапии" ["SECTION_META_KEYWORDS"]=> string(222) "Биологические маркеры тройного негативного рака молочной железы: поиск мишеней для иммунотаргетной и клеточной терапии" ["SECTION_META_DESCRIPTION"]=> string(222) "Биологические маркеры тройного негативного рака молочной железы: поиск мишеней для иммунотаргетной и клеточной терапии" ["SECTION_PICTURE_FILE_ALT"]=> string(222) "Биологические маркеры тройного негативного рака молочной железы: поиск мишеней для иммунотаргетной и клеточной терапии" ["SECTION_PICTURE_FILE_TITLE"]=> string(222) "Биологические маркеры тройного негативного рака молочной железы: поиск мишеней для иммунотаргетной и клеточной терапии" ["SECTION_PICTURE_FILE_NAME"]=> string(100) "biologicheskie-markery-troynogo-negativnogo-raka-molochnoy-zhelezy-poisk-misheney-dlya-immunotargetn" ["SECTION_DETAIL_PICTURE_FILE_ALT"]=> string(222) "Биологические маркеры тройного негативного рака молочной железы: поиск мишеней для иммунотаргетной и клеточной терапии" ["SECTION_DETAIL_PICTURE_FILE_TITLE"]=> string(222) "Биологические маркеры тройного негативного рака молочной железы: поиск мишеней для иммунотаргетной и клеточной терапии" ["SECTION_DETAIL_PICTURE_FILE_NAME"]=> string(100) "biologicheskie-markery-troynogo-negativnogo-raka-molochnoy-zhelezy-poisk-misheney-dlya-immunotargetn" ["ELEMENT_PREVIEW_PICTURE_FILE_NAME"]=> string(100) "biologicheskie-markery-troynogo-negativnogo-raka-molochnoy-zhelezy-poisk-misheney-dlya-immunotargetn" ["ELEMENT_DETAIL_PICTURE_FILE_NAME"]=> string(100) "biologicheskie-markery-troynogo-negativnogo-raka-molochnoy-zhelezy-poisk-misheney-dlya-immunotargetn" } ["FIELDS"]=> array(1) { ["IBLOCK_SECTION_ID"]=> string(3) "211" } ["PROPERTIES"]=> array(18) { ["KEYWORDS"]=> array(36) { ["ID"]=> string(2) "19" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:46:01" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(27) "Ключевые слова" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "KEYWORDS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "19" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "4" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "Y" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "Y" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(27) "Ключевые слова" ["~DEFAULT_VALUE"]=> string(0) "" } ["SUBMITTED"]=> array(36) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28602" ["VALUE"]=> string(22) "04/05/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "04/05/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL } ["ACCEPTED"]=> array(36) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28603" ["VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL } ["PUBLISHED"]=> array(36) { ["ID"]=> string(2) "22" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Дата публикации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "PUBLISHED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "22" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Дата публикации" ["~DEFAULT_VALUE"]=> NULL } ["CONTACT"]=> array(36) { ["ID"]=> string(2) "23" ["TIMESTAMP_X"]=> string(19) "2015-09-03 14:43:05" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(14) "Контакт" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "CONTACT" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "23" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(14) "Контакт" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHORS"]=> array(36) { ["ID"]=> string(2) "24" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:45:07" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "AUTHORS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "24" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_RU"]=> array(36) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28604" ["VALUE"]=> array(2) { ["TEXT"]=> string(740) "<p>Олег Е. Молчанов¹, Дмитрий А. Майстренко¹, Дмитрий А. Гранов¹, Любовь В. Васина², Алена А. Попова¹, Ирина В. Василевская¹, Oльга В. Миколайчук^1,2,3, Ольга С. Шемчук^2,3, Елена А. Попова^1,2, Александра В. Протас^1,2, Владимир В. Шаройко^1,2,3, Константин Н. Семенов^1,2,3</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(584) "

Олег Е. Молчанов¹, Дмитрий А. Майстренко¹, Дмитрий А. Гранов¹, Любовь В. Васина², Алена А. Попова¹, Ирина В. Василевская¹, Oльга В. Миколайчук^1,2,3, Ольга С. Шемчук^2,3, Елена А. Попова^1,2, Александра В. Протас^1,2, Владимир В. Шаройко^1,2,3, Константин Н. Семенов^1,2,3

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_RU"]=> array(36) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28605" ["VALUE"]=> array(2) { ["TEXT"]=> string(724) "<p>¹ ФГБУ «Российский научный центр радиологии и хирургических технологий им. ак. А.М. Гранова» МЗ РФ, Санкт-Петербург, Россия<br> ² Первый Санкт-Петербургский государственный медицинский университет им. акад. И.П. Павлова МЗ РФ, Санкт-Петербург, Россия<br> ³ Санкт-Петербургский государственный университет Институт химии, Санкт-Петербург, Россия</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(664) "

¹ ФГБУ «Российский научный центр радиологии и хирургических технологий им. ак. А.М. Гранова» МЗ РФ, Санкт-Петербург, Россия
² Первый Санкт-Петербургский государственный медицинский университет им. акад. И.П. Павлова МЗ РФ, Санкт-Петербург, Россия
³ Санкт-Петербургский государственный университет Институт химии, Санкт-Петербург, Россия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_RU"]=> array(36) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28609" ["VALUE"]=> array(2) { ["TEXT"]=> string(2380) "<p style="text-align: justify;">Трижды негативный рак молочной железы является одним из наиболее агрессивных. Он представляет собой гетерогенную группу заболеваний с различными молекулярными дефектами, требующими дифференцированного подхода к диагностике и лечению. В статье приведены данные о современных молекулярных классификациях трижды негативного рака молочной железы и дефектах сигнальных путей, а также продемонстрирована их связь с иммунологическими и неиммунологическими биомаркерами. Обобщены данные о прогностической и предсказательной роли молекулярных биомаркеров, существующих и разрабатываемых подходах к разработке таргетных препаратов, для которых они являются мишенями, а также перспективных методах клеточной терапии. Приведены данные собственных исследований, касающиеся оценки прогностической роли цитокинов и субпопуляций лимфоцитов в крови пациентов с трижды негативным раком молочной железы, обозначены перспективы дальнейших исследований.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Рак молочной железы, трижды негативный, молекулярные подтипы, мутационная нагрузка, стволовые опухолевые клетки, циркулирующие опухолевые клетки, клеточное микроокружение, субпопуляции лимфоцитов, интерлейкины, молекулярные мишени, клеточная терапия.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(2324) "

Трижды негативный рак молочной железы является одним из наиболее агрессивных. Он представляет собой гетерогенную группу заболеваний с различными молекулярными дефектами, требующими дифференцированного подхода к диагностике и лечению. В статье приведены данные о современных молекулярных классификациях трижды негативного рака молочной железы и дефектах сигнальных путей, а также продемонстрирована их связь с иммунологическими и неиммунологическими биомаркерами. Обобщены данные о прогностической и предсказательной роли молекулярных биомаркеров, существующих и разрабатываемых подходах к разработке таргетных препаратов, для которых они являются мишенями, а также перспективных методах клеточной терапии. Приведены данные собственных исследований, касающиеся оценки прогностической роли цитокинов и субпопуляций лимфоцитов в крови пациентов с трижды негативным раком молочной железы, обозначены перспективы дальнейших исследований.

Ключевые слова

Рак молочной железы, трижды негативный, молекулярные подтипы, мутационная нагрузка, стволовые опухолевые клетки, циркулирующие опухолевые клетки, клеточное микроокружение, субпопуляции лимфоцитов, интерлейкины, молекулярные мишени, клеточная терапия.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["DOI"]=> array(36) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28606" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-16-30" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-16-30" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_EN"]=> array(36) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28610" ["VALUE"]=> array(2) { ["TEXT"]=> string(564) "<p>Oleg E. Molchanov¹, Dmitrii A. Maistrenko¹, Dmitrii A. Granov¹, Lubov V. Vasina², Alena A. Popova¹, Irina V. Vasilevskaya¹, Olga V. Mikolaichuk^1,2,3, Olga S. Shemchuk^2,3, Elena A. Popova^1,2, Alexandra V. Protas^1,2, Vladimir V. Sharoyko^1,2,3, Konstantin N. Semenov^1,2,3</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(408) "

Oleg E. Molchanov¹, Dmitrii A. Maistrenko¹, Dmitrii A. Granov¹, Lubov V. Vasina², Alena A. Popova¹, Irina V. Vasilevskaya¹, Olga V. Mikolaichuk^1,2,3, Olga S. Shemchuk^2,3, Elena A. Popova^1,2, Alexandra V. Protas^1,2, Vladimir V. Sharoyko^1,2,3, Konstantin N. Semenov^1,2,3

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_EN"]=> array(36) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28611" ["VALUE"]=> array(2) { ["TEXT"]=> string(893) "<p>¹ A.M. Granov Russian Research Centre for Radiology and Surgical Technologies, St. Petersburg, Russia<br> ² Pavlov University, St. Petersburg, Russia<br> ³ Institute of Chemistry, St. Petersburg State University, St. Petersburg, Russia</p><br> <p><b>Correspondence:</b><br> Prof. Dr. Konstantin N. Semenov, Head, Department of General and Bioorganic Chemistry Pavlov University, 6-8 L. Tolstoy St., 197022, St. Petersburg, Russia<br> Phone: +7 (952) 215-19-05<br> E-mail: knsemenov@gmail.com </p><br> <p><b>Citation:</b> Molchanov OE, Maistrenko DA, Granov DA, et al. Biomarkers and potential targets for immune and cellular therapy in triple negative breast cancer. Cell Ther Transplant 2022; 11(2): 16-30.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(755) "

¹ A.M. Granov Russian Research Centre for Radiology and Surgical Technologies, St. Petersburg, Russia
² Pavlov University, St. Petersburg, Russia
³ Institute of Chemistry, St. Petersburg State University, St. Petersburg, Russia

Correspondence:
Prof. Dr. Konstantin N. Semenov, Head, Department of General and Bioorganic Chemistry Pavlov University, 6-8 L. Tolstoy St., 197022, St. Petersburg, Russia
Phone: +7 (952) 215-19-05
E-mail: knsemenov@gmail.com

Citation: Molchanov OE, Maistrenko DA, Granov DA, et al. Biomarkers and potential targets for immune and cellular therapy in triple negative breast cancer. Cell Ther Transplant 2022; 11(2): 16-30.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_EN"]=> array(36) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28612" ["VALUE"]=> array(2) { ["TEXT"]=> string(1237) "<p style="text-align: justify;">Triple negative breast cancer (TNBC) is the most aggressive variant of breast malignancies, being a heterogeneous group with various molecular abnormalities that require differentiated approach to diagnosis and treatment. The article contains current data on modern molecular classifications of triple negative breast cancer and appropriate defects in signaling pathways as well as their assignment to distinct immunological and metabolic biomarkers. The data on the prognostic and predictive role of the tumor molecular biomarkers, as well as on clinically used and cellular therapy approaches and developing targeted drugs are presented, and the prospects for the future research are outlined. We also present the data of our own research concerning evaluation of the prognostic role of cytokines and lymphocyte subpopulations in peripheral blood of the TNBC patients.</p> <h2>Keywords</h2> <p style="text-align: justify;">Breast cancer, triple negative, molecular subtypes, mutational burden, tumor stem cells, circulating tumor cells, cellular microenvironment, lymphocyte subpopulations, interleukins, molecular targets, cellular therapy.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1181) "

Triple negative breast cancer (TNBC) is the most aggressive variant of breast malignancies, being a heterogeneous group with various molecular abnormalities that require differentiated approach to diagnosis and treatment. The article contains current data on modern molecular classifications of triple negative breast cancer and appropriate defects in signaling pathways as well as their assignment to distinct immunological and metabolic biomarkers. The data on the prognostic and predictive role of the tumor molecular biomarkers, as well as on clinically used and cellular therapy approaches and developing targeted drugs are presented, and the prospects for the future research are outlined. We also present the data of our own research concerning evaluation of the prognostic role of cytokines and lymphocyte subpopulations in peripheral blood of the TNBC patients.

Keywords

Breast cancer, triple negative, molecular subtypes, mutational burden, tumor stem cells, circulating tumor cells, cellular microenvironment, lymphocyte subpopulations, interleukins, molecular targets, cellular therapy.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["NAME_EN"]=> array(36) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28607" ["VALUE"]=> string(97) "Biomarkers and potential targets for immune and cellular therapy in triple negative breast cancer" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(97) "Biomarkers and potential targets for immune and cellular therapy in triple negative breast cancer" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" } ["FULL_TEXT_RU"]=> array(36) { ["ID"]=> string(2) "42" ["TIMESTAMP_X"]=> string(19) "2015-09-07 20:29:18" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(23) "Полный текст" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(12) "FULL_TEXT_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "42" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(23) "Полный текст" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["PDF_RU"]=> array(36) { ["ID"]=> string(2) "43" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF RUS" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_RU" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "43" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28608" ["VALUE"]=> string(4) "2825" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2825" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF RUS" ["~DEFAULT_VALUE"]=> string(0) "" } ["PDF_EN"]=> array(36) { ["ID"]=> string(2) "44" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF ENG" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "44" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28613" ["VALUE"]=> string(4) "2828" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2828" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF ENG" ["~DEFAULT_VALUE"]=> string(0) "" } ["NAME_LONG"]=> array(36) { ["ID"]=> string(2) "45" ["TIMESTAMP_X"]=> string(19) "2023-04-13 00:55:00" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(72) "Название (для очень длинных заголовков)" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "NAME_LONG" ["DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "45" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(80) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(72) "Название (для очень длинных заголовков)" ["~DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } } } ["DISPLAY_PROPERTIES"]=> array(10) { ["AUTHOR_EN"]=> array(37) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28610" ["VALUE"]=> array(2) { ["TEXT"]=> string(564) "<p>Oleg E. Molchanov¹, Dmitrii A. Maistrenko¹, Dmitrii A. Granov¹, Lubov V. Vasina², Alena A. Popova¹, Irina V. Vasilevskaya¹, Olga V. Mikolaichuk^1,2,3, Olga S. Shemchuk^2,3, Elena A. Popova^1,2, Alexandra V. Protas^1,2, Vladimir V. Sharoyko^1,2,3, Konstantin N. Semenov^1,2,3</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(408) "

Oleg E. Molchanov¹, Dmitrii A. Maistrenko¹, Dmitrii A. Granov¹, Lubov V. Vasina², Alena A. Popova¹, Irina V. Vasilevskaya¹, Olga V. Mikolaichuk^1,2,3, Olga S. Shemchuk^2,3, Elena A. Popova^1,2, Alexandra V. Protas^1,2, Vladimir V. Sharoyko^1,2,3, Konstantin N. Semenov^1,2,3

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(408) "

Oleg E. Molchanov¹, Dmitrii A. Maistrenko¹, Dmitrii A. Granov¹, Lubov V. Vasina², Alena A. Popova¹, Irina V. Vasilevskaya¹, Olga V. Mikolaichuk^1,2,3, Olga S. Shemchuk^2,3, Elena A. Popova^1,2, Alexandra V. Protas^1,2, Vladimir V. Sharoyko^1,2,3, Konstantin N. Semenov^1,2,3

" } ["SUMMARY_EN"]=> array(37) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28612" ["VALUE"]=> array(2) { ["TEXT"]=> string(1237) "<p style="text-align: justify;">Triple negative breast cancer (TNBC) is the most aggressive variant of breast malignancies, being a heterogeneous group with various molecular abnormalities that require differentiated approach to diagnosis and treatment. The article contains current data on modern molecular classifications of triple negative breast cancer and appropriate defects in signaling pathways as well as their assignment to distinct immunological and metabolic biomarkers. The data on the prognostic and predictive role of the tumor molecular biomarkers, as well as on clinically used and cellular therapy approaches and developing targeted drugs are presented, and the prospects for the future research are outlined. We also present the data of our own research concerning evaluation of the prognostic role of cytokines and lymphocyte subpopulations in peripheral blood of the TNBC patients.</p> <h2>Keywords</h2> <p style="text-align: justify;">Breast cancer, triple negative, molecular subtypes, mutational burden, tumor stem cells, circulating tumor cells, cellular microenvironment, lymphocyte subpopulations, interleukins, molecular targets, cellular therapy.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1181) "

Triple negative breast cancer (TNBC) is the most aggressive variant of breast malignancies, being a heterogeneous group with various molecular abnormalities that require differentiated approach to diagnosis and treatment. The article contains current data on modern molecular classifications of triple negative breast cancer and appropriate defects in signaling pathways as well as their assignment to distinct immunological and metabolic biomarkers. The data on the prognostic and predictive role of the tumor molecular biomarkers, as well as on clinically used and cellular therapy approaches and developing targeted drugs are presented, and the prospects for the future research are outlined. We also present the data of our own research concerning evaluation of the prognostic role of cytokines and lymphocyte subpopulations in peripheral blood of the TNBC patients.

Keywords

Breast cancer, triple negative, molecular subtypes, mutational burden, tumor stem cells, circulating tumor cells, cellular microenvironment, lymphocyte subpopulations, interleukins, molecular targets, cellular therapy.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(1181) "

Triple negative breast cancer (TNBC) is the most aggressive variant of breast malignancies, being a heterogeneous group with various molecular abnormalities that require differentiated approach to diagnosis and treatment. The article contains current data on modern molecular classifications of triple negative breast cancer and appropriate defects in signaling pathways as well as their assignment to distinct immunological and metabolic biomarkers. The data on the prognostic and predictive role of the tumor molecular biomarkers, as well as on clinically used and cellular therapy approaches and developing targeted drugs are presented, and the prospects for the future research are outlined. We also present the data of our own research concerning evaluation of the prognostic role of cytokines and lymphocyte subpopulations in peripheral blood of the TNBC patients.

Keywords

Breast cancer, triple negative, molecular subtypes, mutational burden, tumor stem cells, circulating tumor cells, cellular microenvironment, lymphocyte subpopulations, interleukins, molecular targets, cellular therapy.

" } ["DOI"]=> array(37) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28606" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-16-30" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-16-30" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-16-30" } ["NAME_EN"]=> array(37) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28607" ["VALUE"]=> string(97) "Biomarkers and potential targets for immune and cellular therapy in triple negative breast cancer" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(97) "Biomarkers and potential targets for immune and cellular therapy in triple negative breast cancer" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(97) "Biomarkers and potential targets for immune and cellular therapy in triple negative breast cancer" } ["ORGANIZATION_EN"]=> array(37) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28611" ["VALUE"]=> array(2) { ["TEXT"]=> string(893) "<p>¹ A.M. Granov Russian Research Centre for Radiology and Surgical Technologies, St. Petersburg, Russia<br> ² Pavlov University, St. Petersburg, Russia<br> ³ Institute of Chemistry, St. Petersburg State University, St. Petersburg, Russia</p><br> <p><b>Correspondence:</b><br> Prof. Dr. Konstantin N. Semenov, Head, Department of General and Bioorganic Chemistry Pavlov University, 6-8 L. Tolstoy St., 197022, St. Petersburg, Russia<br> Phone: +7 (952) 215-19-05<br> E-mail: knsemenov@gmail.com </p><br> <p><b>Citation:</b> Molchanov OE, Maistrenko DA, Granov DA, et al. Biomarkers and potential targets for immune and cellular therapy in triple negative breast cancer. Cell Ther Transplant 2022; 11(2): 16-30.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(755) "

¹ A.M. Granov Russian Research Centre for Radiology and Surgical Technologies, St. Petersburg, Russia
² Pavlov University, St. Petersburg, Russia
³ Institute of Chemistry, St. Petersburg State University, St. Petersburg, Russia

Correspondence:
Prof. Dr. Konstantin N. Semenov, Head, Department of General and Bioorganic Chemistry Pavlov University, 6-8 L. Tolstoy St., 197022, St. Petersburg, Russia
Phone: +7 (952) 215-19-05
E-mail: knsemenov@gmail.com

Citation: Molchanov OE, Maistrenko DA, Granov DA, et al. Biomarkers and potential targets for immune and cellular therapy in triple negative breast cancer. Cell Ther Transplant 2022; 11(2): 16-30.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(755) "

¹ A.M. Granov Russian Research Centre for Radiology and Surgical Technologies, St. Petersburg, Russia
² Pavlov University, St. Petersburg, Russia
³ Institute of Chemistry, St. Petersburg State University, St. Petersburg, Russia

Correspondence:
Prof. Dr. Konstantin N. Semenov, Head, Department of General and Bioorganic Chemistry Pavlov University, 6-8 L. Tolstoy St., 197022, St. Petersburg, Russia
Phone: +7 (952) 215-19-05
E-mail: knsemenov@gmail.com

Citation: Molchanov OE, Maistrenko DA, Granov DA, et al. Biomarkers and potential targets for immune and cellular therapy in triple negative breast cancer. Cell Ther Transplant 2022; 11(2): 16-30.

" } ["AUTHOR_RU"]=> array(37) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28604" ["VALUE"]=> array(2) { ["TEXT"]=> string(740) "<p>Олег Е. Молчанов¹, Дмитрий А. Майстренко¹, Дмитрий А. Гранов¹, Любовь В. Васина², Алена А. Попова¹, Ирина В. Василевская¹, Oльга В. Миколайчук^1,2,3, Ольга С. Шемчук^2,3, Елена А. Попова^1,2, Александра В. Протас^1,2, Владимир В. Шаройко^1,2,3, Константин Н. Семенов^1,2,3</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(584) "

Олег Е. Молчанов¹, Дмитрий А. Майстренко¹, Дмитрий А. Гранов¹, Любовь В. Васина², Алена А. Попова¹, Ирина В. Василевская¹, Oльга В. Миколайчук^1,2,3, Ольга С. Шемчук^2,3, Елена А. Попова^1,2, Александра В. Протас^1,2, Владимир В. Шаройко^1,2,3, Константин Н. Семенов^1,2,3

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(584) "

Олег Е. Молчанов¹, Дмитрий А. Майстренко¹, Дмитрий А. Гранов¹, Любовь В. Васина², Алена А. Попова¹, Ирина В. Василевская¹, Oльга В. Миколайчук^1,2,3, Ольга С. Шемчук^2,3, Елена А. Попова^1,2, Александра В. Протас^1,2, Владимир В. Шаройко^1,2,3, Константин Н. Семенов^1,2,3

" } ["SUBMITTED"]=> array(37) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28602" ["VALUE"]=> string(22) "04/05/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "04/05/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "04/05/2022 12:00:00 am" } ["ACCEPTED"]=> array(37) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28603" ["VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "06/24/2022 12:00:00 am" } ["SUMMARY_RU"]=> array(37) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28609" ["VALUE"]=> array(2) { ["TEXT"]=> string(2380) "<p style="text-align: justify;">Трижды негативный рак молочной железы является одним из наиболее агрессивных. Он представляет собой гетерогенную группу заболеваний с различными молекулярными дефектами, требующими дифференцированного подхода к диагностике и лечению. В статье приведены данные о современных молекулярных классификациях трижды негативного рака молочной железы и дефектах сигнальных путей, а также продемонстрирована их связь с иммунологическими и неиммунологическими биомаркерами. Обобщены данные о прогностической и предсказательной роли молекулярных биомаркеров, существующих и разрабатываемых подходах к разработке таргетных препаратов, для которых они являются мишенями, а также перспективных методах клеточной терапии. Приведены данные собственных исследований, касающиеся оценки прогностической роли цитокинов и субпопуляций лимфоцитов в крови пациентов с трижды негативным раком молочной железы, обозначены перспективы дальнейших исследований.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Рак молочной железы, трижды негативный, молекулярные подтипы, мутационная нагрузка, стволовые опухолевые клетки, циркулирующие опухолевые клетки, клеточное микроокружение, субпопуляции лимфоцитов, интерлейкины, молекулярные мишени, клеточная терапия.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(2324) "

Трижды негативный рак молочной железы является одним из наиболее агрессивных. Он представляет собой гетерогенную группу заболеваний с различными молекулярными дефектами, требующими дифференцированного подхода к диагностике и лечению. В статье приведены данные о современных молекулярных классификациях трижды негативного рака молочной железы и дефектах сигнальных путей, а также продемонстрирована их связь с иммунологическими и неиммунологическими биомаркерами. Обобщены данные о прогностической и предсказательной роли молекулярных биомаркеров, существующих и разрабатываемых подходах к разработке таргетных препаратов, для которых они являются мишенями, а также перспективных методах клеточной терапии. Приведены данные собственных исследований, касающиеся оценки прогностической роли цитокинов и субпопуляций лимфоцитов в крови пациентов с трижды негативным раком молочной железы, обозначены перспективы дальнейших исследований.

Ключевые слова

Рак молочной железы, трижды негативный, молекулярные подтипы, мутационная нагрузка, стволовые опухолевые клетки, циркулирующие опухолевые клетки, клеточное микроокружение, субпопуляции лимфоцитов, интерлейкины, молекулярные мишени, клеточная терапия.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(2324) "

Трижды негативный рак молочной железы является одним из наиболее агрессивных. Он представляет собой гетерогенную группу заболеваний с различными молекулярными дефектами, требующими дифференцированного подхода к диагностике и лечению. В статье приведены данные о современных молекулярных классификациях трижды негативного рака молочной железы и дефектах сигнальных путей, а также продемонстрирована их связь с иммунологическими и неиммунологическими биомаркерами. Обобщены данные о прогностической и предсказательной роли молекулярных биомаркеров, существующих и разрабатываемых подходах к разработке таргетных препаратов, для которых они являются мишенями, а также перспективных методах клеточной терапии. Приведены данные собственных исследований, касающиеся оценки прогностической роли цитокинов и субпопуляций лимфоцитов в крови пациентов с трижды негативным раком молочной железы, обозначены перспективы дальнейших исследований.

Ключевые слова

Рак молочной железы, трижды негативный, молекулярные подтипы, мутационная нагрузка, стволовые опухолевые клетки, циркулирующие опухолевые клетки, клеточное микроокружение, субпопуляции лимфоцитов, интерлейкины, молекулярные мишени, клеточная терапия.

" } ["ORGANIZATION_RU"]=> array(37) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28605" ["VALUE"]=> array(2) { ["TEXT"]=> string(724) "<p>¹ ФГБУ «Российский научный центр радиологии и хирургических технологий им. ак. А.М. Гранова» МЗ РФ, Санкт-Петербург, Россия<br> ² Первый Санкт-Петербургский государственный медицинский университет им. акад. И.П. Павлова МЗ РФ, Санкт-Петербург, Россия<br> ³ Санкт-Петербургский государственный университет Институт химии, Санкт-Петербург, Россия</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(664) "

¹ ФГБУ «Российский научный центр радиологии и хирургических технологий им. ак. А.М. Гранова» МЗ РФ, Санкт-Петербург, Россия
² Первый Санкт-Петербургский государственный медицинский университет им. акад. И.П. Павлова МЗ РФ, Санкт-Петербург, Россия
³ Санкт-Петербургский государственный университет Институт химии, Санкт-Петербург, Россия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(664) "

¹ ФГБУ «Российский научный центр радиологии и хирургических технологий им. ак. А.М. Гранова» МЗ РФ, Санкт-Петербург, Россия
² Первый Санкт-Петербургский государственный медицинский университет им. акад. И.П. Павлова МЗ РФ, Санкт-Петербург, Россия
³ Санкт-Петербургский государственный университет Институт химии, Санкт-Петербург, Россия

" } } } [1]=> array(49) { ["IBLOCK_SECTION_ID"]=> string(3) "211" ["~IBLOCK_SECTION_ID"]=> string(3) "211" ["ID"]=> string(4) "2057" ["~ID"]=> string(4) "2057" ["IBLOCK_ID"]=> string(1) "2" ["~IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(302) "Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток при рассеянном склерозе: современный взгляд на проблему" ["~NAME"]=> string(302) "Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток при рассеянном склерозе: современный взгляд на проблему" ["ACTIVE_FROM"]=> NULL ["~ACTIVE_FROM"]=> NULL ["TIMESTAMP_X"]=> string(22) "08/08/2022 12:56:21 pm" ["~TIMESTAMP_X"]=> string(22) "08/08/2022 12:56:21 pm" ["DETAIL_PAGE_URL"]=> string(143) "/en/archive/tom-11-nomer-2/obzornye-stati/vysokodoznaya-immunosupressivnaya-terapiya-s-autologichnoy-transplantatsiey-gemopoeticheskikh-stvolo/" ["~DETAIL_PAGE_URL"]=> string(143) "/en/archive/tom-11-nomer-2/obzornye-stati/vysokodoznaya-immunosupressivnaya-terapiya-s-autologichnoy-transplantatsiey-gemopoeticheskikh-stvolo/" ["LIST_PAGE_URL"]=> string(12) "/en/archive/" ["~LIST_PAGE_URL"]=> string(12) "/en/archive/" ["DETAIL_TEXT"]=> string(51999) "

Introduction

Over recent decades, an increase in the incidence of multiple sclerosis (MS) was recorded worldwide [1-3]. Unfortunately, current medicamental treatment of MS is very expensive and is not efficient enough: it allows for relapse-free course only in a half of the cases. In this regard, European countries are already developing programs to include high-dose immunosuppressive therapy with autologous hematopoietic stem cell transplantation (HDIT-AHSCT) into the standards of active MS treatment [4, 5]. In the Russian Federation, HDIT-AHSCT has been used for severe autoimmune diseases since the mid-1990s [6, 7] like as in the European transplant clinics [8; 9]. Hence, the purpose of this review is to analyze the scientific publications on the selection of optimal conditions and criteria for HDIT-AHSCT for multiple sclerosis.

Methods of data searching

The search for scientific publications in the databases "Pub-med", "Scopus" was carried out by the keywords "HDIT-AHSCT", "stem cells" and "multiple sclerosis".

Analysis and systematization of the data from scientific literature was based on the following issues: 1) algorithms and stages of the HDIT-AHSCT methodology; 2) immunopathgenic rationale for the HDIT-AHSCT in MS patients; 3) results of HDIT-AHSCT clinical trials (CT) in MS; 4) conditioning regimens in HSCT; 5) selection of MS patients according to the criteria for HDIT-AHSCT. Our analysis included publications with high levels of evidence: publication of the results of randomized and controlled experimental and clinical laboratory studies. The international consensus recommendations of expert groups were also considered.

The main stages of HDIT-AHSCT:

1. Mobilization of hematopoietic stem cells – the stimulation of the CD34+ hematopoietic stem cells (HSC) output from the bone marrow to peripheral blood aiming for subsequent apheresis and mononuclear cell collection. The granulocyte colony-stimulating factor (G-CSF) is used for CD34+ cell mobilization, either as a single drug, or in combination with cyclophosphamide (Fig. 1). The available studies have not been identified statistically significant differences between such approaches in terms of relapse-free clinical course [10]. There are also no significant differences when comparing the groups with or without CD34+ cells immunoselection, the latter technology has led to lower treatment costs [11]. Patient’s age, individual features of bone marrow functioning, previous treatment modaliities are the factors that may affect efficiency of hematopoietic stem cell mobilization.

Figure 1. Steps of the high-dose intensive therapy (HDIT)-autologous stem cell transplantation (AHSCT)

Notes: G-CSF, Granulocyte Colony Stimulating Factor; HSC, Hematopoietic Stem Cells; HDIT, High-Dose Immunosuppressive Therapy; AHSCT, Autologous Hematopoietic Stem Cell Transplantation; Cy, Cyclophosphamide.

2. Apheresis means removal of CD34+ cells from peripheral blood for subsequent cryopreservation. The HSC apheresis may take 1-2 days for sufficient cell collection. The optimal number of CD34+ cells in the transplant should be 2-5×10⁶/kg of recipient weight.

3. Cryopreservation of the transplant, i.e., storage of the transplant in liquid nitrogen with a cryoprotector (dimethylsulfoxide) is required for the time period of treatment and pre-transplant conditioning therapy.

4. Conditioning regimen (CR) includes high-dose immunosuppressive therapy (HDIT) in order to deplete autoreactive T- and B- lymphocytes. The AHSCT conditioning regimens are heterogeneous for their intensity, being 4 to 7 days long. Atkins H. et al. showed the effectiveness of high-intensity, i.e., myeloablative regimens which include cyclophosphamide and busulfan, even in the patients with progressive forms of MS [12]. However, the use of high-intensity conditioning has an adverse toxicity profile and may lead to increased therapy-associated mortality. Usage of low- and medium-intensity regimens often allows to avoiding significant toxicity and demonstrates high efficacy in patients with remitting MS. The issue of choosing of conditioning regimen still remains open in cases of progressive MS.

5. The AHSCT procedure requires thawing and transfusion of the transplant to the patient (day 0). The duration of the procedure is less than half an hour. The primary goal of an autograft transfusion is to trigger fast recovery of the naive immunocompromised cell pool and to make cytopenic period shorter.

6. Immunotherapy includes usage of antithymocyte globulin (ATG) for additional exhaustion of T-lymphocytes in the transplant as well as lymphocytes in blood flow that survived after chemotherapy. In addition, ATG has an immunomodulating effect, due to increased expansion of T-regulatory cells, which, in turn, positively influences the processes of immunological tolerance [13].

7. The period of cytopenia is characterized by low leukocyte level in circulation. It is a regular complication of HDIT, but it is not the target when treating autoimmune disorders. In the framework of standard protocols, the massive accompanying anti-infectious therapy is carried out at this stage and, if necessary, transfusions of blood products are provided.

8. The period of hemopoietic recovery is achieved upon reconstitution of blood leukocytes to subnormal levels ("exit" from cytopenia). At this stage, G-CSF may be used to reduce the period of cytopenia by an average of 5-7 days. The patient can be discharged from the hospital after sustained hemopoiesis recovery to >1×10⁹/l leukocyte levels; neutrophils to >0.5×10⁹/l; platelets to >20×10⁹/l, does not require transfusions of blood components, in absence of toxic organ, infectious and hemorrhagic complications.

9. Consolidation is a feasible therapeutic option to maintain the HDIT effect (for example, in fast-progressing/aggressive MS). The consolidation treatment (remission support) may include complementary immunosuppressive therapy and is administered exclusively within the framework of internal protocols of specialized centers. To date, there is no consensus protocol for post-transplant management of patients with MS.

The HDIT-AHSCT stages are shown in Figure 1.

Immunopathogenic rationale of HDIT-AHSCT in MS

Multiple sclerosis is a promising disease for the potential HDIT-AHSCT application since it represents a classical autoimmune disease associated with impaired immunological tolerance followed by a sequence of immunopathogenic events directed against the nervous system, including altered antigen recognition and presentation, activation, proliferation and cell differentiation in the course of adaptive immune response. The notion that HSC in autoimmune diseases are intact, and the pathological process involves immunocompetent cells at the early stages of differentiation, was suggested and confirmed by the efficacy of autologous and syngeneic bone marrow transplantation in experimental models for rheumatoid arthritis and experimental autoimmune encephalomyelitis using immunoablation with high-dose cyclophosphamide and total body irradiation (TBI) [14-16].

Potential efficacy of HDIT preceding the AHSCT is based on a double effect upon immune system: a) elimination of pathogenetically significant autoreactive T- and B-lymphocytes using high-dose immunosuppressive therapy followed by de novo repopulation of "naive" lymphocytes from the transfused autologous cells, and b) due to generation of immunological tolerance to the disease-specific autoantigens [17-19]. The proof of concept for HDIT-AHSCT is based on 2 pre-requisites: (1) achievement of immune reconstitution after profound lymphodepletion and restoration of adequate balance between autoreactive cells, and (2) presumed effects of emerging immune cells responsible for immunosuppression and immunoregulation. The expected effect also includes achievement of long-term immunological autotolerance. The absence of radiological activity and clinical relapses after HDIT-AHSCT in patients with aggressive MS forms correlates with a decrease in circulating cell subpopulations of proinflammatory Th17 and dpTh1/Th17 [17].

Due to the intactness of stem cells, the autoimmune diseases (AID) do not require myeloablative conditioning. This concept allowed to eliminate highly intensive myeloablative conditioning, while maintaining the immunoablative action, thus providing total elimination of autoreactive clones of T- and B-cells [20, 21].

However, the use of a nonmyeloablative conditioning for experimental autoimmune encephalomyelitis without hematopoietic stem cell support (only HDIT without AHSCT) did not result in long-term remission, suggesting possible immunomodulating effects of AHSCT [22]. Some studies have shown that the supposed diversification of immune cell repertoire (immunological reconstitution) may occur after AHSCT. One may also expect selective expansion of minor autoreactive T-lymphocyte clones that survived the conditioning treatment immediately after reinfusion of autologous stem cells. Moreover, the transplant itself also contains an admixture of T lymphocytes, which may be a cell substrate for subsequent immune reconstitution. Immunotherapy with ATG on the first days after AHSCT (D+1, D+2, D+3) leads to additional lymphodepletion and exhaustion of T-lymphocyte subpopulations from MAIT (mucosal associated invariant), characterized by CD8+ phenotype, proinflammatory IL-17 and interferon-γ [23].

The second phase of T-cell reconstitution begins in the thymus, where immunological "learning", differentiation and maturation of T-lymphocytes occur. Thereafter, "naive" T cells circulate in the blood and peripheral lymphoid organs and, hence, participate in "reboot" of the immune system. Patients without signs of activity show early expansion of CD8+PD-1+ T-lymphocytes, and inversion of CD4/CD8 ratio. Over the first months after the procedure, the repertoire of CD8+ and (to a lesser extent) CD4+ T-cells undergoes sufficient expansion. It is also known that autologous CD34+ cells may be involved in differentiation of GFAP-producing reactive astrocytes. After 1-2 years, expansion of naive CD4+ and CD8+ thymic cells is observed, which exhibit wider clonal diversity. The regulatory pool of CD4+CD25+CD127 FoxP3+ T-lymphocytes (promoters of immunological tole-rance) is also increasing with time [24].

The B-cell repertoire is also changing as seen by the profile of recovering B-lymphocytes after HDIT-AHSCT which differs from B lymphocytes prior to therapy. The peculiarity of post-transplant B-cell reconstitution is a predominance of "naive" phenotype (CD27-), whereas an imbalance towards proinflammatory profile was evident before AHSCT. For this reason, the reduced secretion of proinflammatory cytokines (FNO, IL-6, GM-CSF) was detected, and an increase of IL-10 was achieved [25]. These changes contribute to the recovery of immunological autotolerance, which may be long-lasting [26]. The changes of adaptive immune response persist for a long time after HSCT and the initial lymphocyte repopulation phase. This hypothesis confirms the concept of immune "reboot" [27].

Clinical Studies of HDIT-AHSCT in multiple sclerosis

According to the data of Autoimmune Diseases Working Party (ADWP), about 4000 SCT for autoimmune diseases (AID) have been performed and officially registered by the European Society for Blood and Marrow Transplantation (EBMT). [28, 29]. More than half of the HDIT-AHSCT were administered in cases of multiple sclerosis. The largest register of the Mexican group, where more than 1000 SCT for MS have been performed, is also known [30].

Despite the experience gained so far, the number of completed clinical trials is limited, and the data obtained are difficult to compare for the patient groups, procedure protocols (CR) and test endpoints (Table 1), and to perform proper statistical evaluation, due to their heterogeneity.

Table 1. Trials for clinical efficiency and safety of HDIT-AHSCT for multiple sclerosis [31]

Notes: Bu – Busulfan; ВЕАМ – Bis-chloroethylnitrosourea (BCNU), Etoposide, cytosine Arabinoside, (Ara-C; cytosine-arabinozide), Melphalan; Cy – Cyclophosphamide, ATG – Antithymocyte immunoglobulin; DMT – Disease-modifying therapy; NCT – National Clinical Trials; AHSCT – autologous hematopoietic stem cell transplantation; CR – conditioning regimen.

According to the HALT-MS study, the patients with active relapsing-remitting MS (RRMS) had sustained clinical remission in 77% of cases during the 5-year follow-up [32]. According to the ASTIMS study, the number of T2-lesions (MRI) was decreased in 79% of patients during 4-year follow up after HDIT-AHSCT [33]. High-intensity CR (Bu-Cy-ATG) showed full clinical and radiological remission in 84% of patients with long-term observation for an average of 6.7 years (3.9 to 12.7) [12].

Data on the efficiency of HDIT-AHSCT according to the NEDA (No Evidence of Disease Activity) criteria in different studies are compared to results of immunotherapy in MS patients (Fig. 2). Absence of clinical exacerbation, progression of disability and physical activity according to MRI data (the summary NEDA estimate) during the three-year observation was observed in 70-94% of patients after HDIT-AHSCT compared to 22-48% following standard immunosuppressive therapy [12; 32; 34-36] with alemtuzumab (anti-CD52), ocrelizumab (anti-CD20) and daclizumab (anti-CD25) (different monoclonal antibody drugs from the group of "highly effective MS therapy") [37-39]. In this regard, interesting data were obtained at the most active transplant centers in Italy over the period of 1996 to 2016, where, after HDIT-AHSCT protocol (BEAM-ATG) applied in 122 patients (59% relapsing-remitting MS (RRRS)), 3-year relapse-free outcomes were registered in 91% of patients with RRMS and in 62% of cases with progressive-type MS (p<0.001). One should note that clinical exacerbations are rarely observed in secondary-progressive MS (SPMS), extremely rare in primary-progressive MS (PPMS). According to the single-center study performed by Mancardi et al., the NEDA criteria were achieved in 72% of RRMS patients and in 55% of SPMS patients within 5 years after HDIT-AHSCT (p=0.07) [26].

Figure 2. Effectiveness of different therapies in MS, according to the NEDA criteria. Presented a comparative analysis of the results of clinical trials (12-24 months from the beginning of therapy) and HDIT-AHSCT (30-80.4 months from therapy) [12; 34-36; 40-46]

Notes: p1 – Phase 1 trial, NEDA - No Evidence of Disease Activity; IFNβ-1a –interferon beta-1a.

The above data point to the effectiveness of HDIT-AHSCT, in advanced-stage MS patients. However, direct comparison of these results is not possible due to the differences in patient selection criteria, follow-up terms, and performance evaluation.

According to meta-analysis by Reston J.T. et al., the success rates of relapse-free period in MS after medium-intensity conditioning (BEAM/carmustine) may be higher than with high-intensity therapy including total body irradiation: 79.4% (69.9-86.5%) and 44.6% (26.5-64.3%) at the observation terms of 6-72 and 6-60 months, respectively [47].

In the MIST study, 110 patients were treated with HDIT-AHSCT (n=55) and with DMT (n=55). After a year of treatment, the disease progression with increasing neurological deficit (EDSS scale) was recorded in only 3 patients after HDIT-AHSCT versus 34 patients who received DMT. The total HDIT-AHSCT group showed an improvement by 1.02 points on the EDSS scale (decreased symptoms), and clinical worsening by 0.67 points in the DMT group (cross-group comparison, 1.7; 95% CI, 2.03 to 1.29; p<0.001). Despite the impressive results, it should be noted that the study had certain limitations, e.g., absence of patients in the group of DMT receiving high-efficiency treatment with ocrelizumab and alemtuzumab [48].

A long-term study of HDIT-AHSCT efficiency in MS from 1990 to 2000 was based on the inclusion of patients with a predominantly high disability levels (EDSS >6.5 points), and 20% of them were with PPMS. Relapse-free course was achieved in 60-80% of patients within 3 years of follow-up [43]. With a 10-year observation after treatment, 65% of SPMS patients had no MS symptoms, and 40% of PPMS patients showed a positive effect in terms of improved quality of life and cognitive functions [49, 50]. The limitations of this study relate to the issues of the outcome assessment, since, as noted above, the frequency of exacerbation for progressive forms of MS are difficult to evaluate in optimal manner.

According to the data of R.M. Gorbacheva Research Institute (Pavlov University, St. Petersburg), over the follow-up period of 19 to 7 years after HDIT-AHSCT only minimal progression of neurological deficit, i.e., 0.5±1.1 EDSS points was documented after treatment (the characteristics of the study group are presented in the Table 2).

The MSSS progression score at the time of HDIT-AHSCT was 76.5±21.36, compared to 62.43±25.05 after 13±2.5 years (p=0.015), which may indicate a delay of progression after treatment [51]. The obtained results (Fig. 3) show that HDIT-AHSCT allowed to influence the aggressive clinical course and to shift the average rank value of MSSS from the group "Fast Progressing Current 3B" to the group "Progressing Current 3A". In general, our results are in accordance with previously reported EBMT data [43, 52, 53].

Unresolved issues in conditioning regimens

As mentioned above, the conditioning regimes (CR/HDIT) differ in immunosuppressive effects: high-, medium- and low-intensity regimens. The most commonly used CRs are presented in Table 3.

Established variants of high-dose conditioning regimens depending on the level of immunosuppression [5, 8-10, 12, 20, 28, 32-36, 41, 43, 58].

As shown in Table 3, the high-intensity conditioning regimens were used predominantly in North America. The European transplant centers applied mostly reduced intensity protocols. Before 2010, high- and medium-intensity regimens were mainly used, followed by later shift towards the use of cyclophosphamide-containing regimens, thus enabling implementation of this approach even in younger MS patients with under 18 years [55].

Duration of the relapse-free course in MS as well as the severity of early and late HSCT complications is shown to depend on the intensity of conditioning regimen. In the report of the EBMT Registry (2005), a stable clinical response was observed in 78% of patients who received high-intensity treatment, compared to 68% for medium- and 30% for low-intensity conditioning (p=0.0001) [56]. However, according to Reston et al. (2011), the patients with SPMS had a longer relapse-free course after medium-intensity conditioning than after high-intensity therapy (Bu-Cy, TBI-Cy, etc.) [47]. According to Arruda et al. the efficiency of conditioning regimen in MS depends more on lymphodepletion than on myeloablation, i.e., prolonged lymphopenia correlates with a longer period of relapse-free course [57].

Current principles of HDIT-AHSCT in MS

The basic principles of HDIT-AHSCT for MS are based on the recommendations of the European and American Societies for Blood and Bone Marrow Transplantation (resp., EBMT and ASBMT) [28, 58-61] being summarized as follows:

Level S/I (treatment standard/efficacy proven in at least one randomized CT):
1. HDIT-AHSCT should be offered to the patients with MS:
- with high clinical and MR-activity (at least two clinical exacerbations or one clinical exacerbation with signs of MR-activity in the form of accumulating contrast substance (Gd+) in post-concussive T1 or 1 new T2 lesions in the last 12 months);
- if one or more DMT are ineffective.
2. The factors of potential effectiveness are:
- the independence in moving (EDSS no more than 5.5);
- age under 45 years;
- the duration of the MS no more than 10 years.

Level CO/II (clinical option, no "corroborating" results of randomized CT/efficiency based on non-randomized CT data, cohort analytical studies):

1. Patients with aggressive MS (criteria: at least 2 clinical exacerbations or one clinical relapse with a centre accumulating contrast agent or a new T2 foci in the last 12 months) with disability in the last 12 months – are the candidates. In view of the potentially irreversible disability, such patients could be considered for HDIT-AHSCT before completing the full course of DMT;

2. Patients with SPMS should be considered for HDIT-AHSCT mainly with inflammatory activity (clinical relapses and Gd+/new lesions on T2 MRI) with documented progression in the previous 12 months;

3. Patients with PPMS should be considered for HDIT-AHSCT only with inflammatory activity (Gd+ and new lesions on T2 MRI) with documented apparent progression of disability in the previous 12 months;

4. Patients with MS under 18 years of age can be considered for HDIT-AHSCT only in case of aggressive MS with selection of less toxic protocols of CR;

5. The criteria for selecting patients are based on the aggressiveness of the disease, analysis of the patient’s anamnesis and comorbidity, analysis of the risk-benefit ratio of the method, and from the personal and social aspects of the patient.

Conclusion

Critical evaluation of the world experience with HDIT- AHSCT in MS allows to consider this therapeutic option as highly effective treatment of multiple sclerosis if applied at early stages of the disease progression, at predominance of active autoimmune inflammation, but not at the stage of neurodegeneration prevalence. In the cases of progressive course of the disease, at a stage where neurodegenerative processes prevail, the method may have a certain delayed stabilizing effect. The selection criteria for HDIT-AHSCT in MS patients should include demographic factors, physical/social activity, type of disease and prognostic factors of adverse MS course as well as safety criteria based on present comorbidities and realistic expectations of the patient. Over last 10-15 years, taking into account the experience of multiple transplant centers, due to lower toxicity of conditioning regimes, we were able to reduce the severity of complications, however, keeping high clinical efficiency of AHSCT. Pathophysiology of multiple sclerosis, as well as in other neurological diseases, does not allow to compensate the irreversible pathomorphological changes that occurred in central nervous system before the therapy, but HDIT-AHSCT allows suppression of the current autoimmune process and, therefore, to avoid further damage and death of nervous tissues, accompanied by progression of irreversible neurological deficiency. When the desired long-term relapse-free course is achieved, an obvious advantage of this approach may be a withdrawal of disease-modifying therapy, which complies with optimal principle of disease control using the "one-off disease control" therapy.

Conflict of interest

The authors state that there is no conflict of interest. The authors bear full responsibility for providing the final version of the manuscript to the press. All authors took part in the development of the concept of the article and the writing of the manuscript. The final version of the manuscript was approved by all authors.

Acknowledgements

We acknowledge the Autoimmune Diseases Working Party (ADWP) of the European Society for Blood and Marrow Transplantation (EBMT) for its support in providing updated registry data and all EBMT member centers and their clinicians, data managers and patients for their valuable contributions to the EBMT registry. The authors confirm that they followed the Declaration of Human Rights with persons involved into the study.

References

1. Sumelahti ML, Tienari PJ, Wikström J, Palo J, Hakama M. Regional and temporal variation in the incidence of multiple sclerosis in Finland 1979-1993. Neuroepidemiology. 2000 Mar-Apr;19(2):67-75. doi: 10.1159/000026241
2. Alonso A, Jick SS, Olek MJ, Hernan MA. Incidence of multiple sclerosis in the United Kingdom: findings from a population-based cohort. J Neurol. 2007; 254:1736-1741. doi: 10.1007/s00415-007-0602-z
3. Fromont A, Binquet C, Sauleau E, Fournel I, Despalins R, Rollot F, et al. National estimate of multiple sclerosis incidence in France (2001-2007). Mult Scler. 2012;18(8):1108-1115. doi: 10.1177/1352458511433305
4. Laureys G, Willekens B, Vanopdenbosch L, Deryck O, Selleslag D, D'Haeseleer M, et al. A Belgian Consensus Protocol for autologous hematopoietic stem cell transplantation in multiple sclerosis. Acta Neurol Belg. 2018;118(2):161-168. doi: 10.1007/s13760-018-0905-0
5. Burman J, Tolf A, Hоgglund H, Askmark H. Autologous haematopoietic stem cell transplantation for neurological diseases. J Neurol Neurosurg Psychiatry. 2018;89(2):147-155. doi: 10.1136/jnnp-2017-316271
6. Sizikova SA, Lisukov IA, Kulagin AD, Kriuchkova IV, Gilevich AV, Chernykh EP et al. Vysokodoznaia immunosuppressivnaia terapiia s autologichnoĭ transplantatsieĭ stvolovykh krovetvornykh kletok pri autoimmunykh zabolevaniiakh. Terapevticheskii Arkhiv. 2002;74(7):22-26. (In Russian). PMID: 12181829
7. Shevchenko YL, Novik AA, Kuznetsov AN, Afanasyev BV, Lisukov IA, Kozlov VA, et al. Autologous transplantation of hematopoietic stem cells in multiple sclerosis: results of a study of the Russian cooperative cell therapy group. Neurological Journal. 2008. Vol. 13. No. 2. pp. 11-18. (In Russian).
8. Fassas A, Anagnostopoulos A, Kazis A, Kapinas K, Sakellari I, Kimiskidis V, et al. Peripheral blood stem cell transplantation in the treatment of progressive multiple sclerosis: first results of a pilot study. Bone Marrow Transplant. 1997; 20(8):631-638.
   doi: 10.1038/sj.bmt.1700944
9. Gavriilaki M, Sakellari I, Gavriilaki E, Kimiskidis VK, Anagnostopoulos A. Autologous hema-topoietic cell transplantation in multiple sclerosis: changing paradigms in the era of novel agents. Stem Cells Int. 2019; 2019:5840286. doi: 10.1155/2019/5840286
10. Currò D, Mancardi G. Autologous hematopoietic stem cell transplantation in multiple sclerosis: 20 years of experience. Neurol Sci. 2016;37(6):857-865. doi: 10.1007/s10072-016-2564-3
11. Moore J, Brooks P, Milliken S, Biggs J, Ma D, Handel M, et al. A pilot randomized trial comparing CD34-selected versus unmanipulated hemopoietic stem cell transplantation for severe, refractory rheumatoid arthritis. Arthritis Rheum. 2002;46(9):2301-2309. doi: 10.1002/art.10495
12. Atkins HL, Bowman M, Allan D, Anstee G, Arnold DL, Bar-Or A, et al. Immunoablation and autologous haemopoietic stem-cell transplantation for aggressive multiple sclerosis: a multicentre single-group phase 2 trial. Lancet. 2016; 388(10044):576-585.
    doi: 10.1016/S0140-6736(16)30169-6
13. Feng X, Kajigaya S, Solomou EE, Keyvanfar K, Xu X, Raghavachari N, et al. Rabbit ATG but not horse ATG promotes expansion of functional CD4+CD25highFOXP3+ regulatory T cells in vitro. Blood. 2008;111(7): 3675-3683. doi: 10.1182/blood-2008-01-130146
14. Karussis DM, Slavin S, Lehmann D, Mizrachi-Koll R, Abramsky O, Ben-Nun A. Prevention of experimental autoimmune encephalomyelitis and induction of tolerance with acute immunosuppression followed by syngeneic bone marrow transplantation.
    J Immunol. 1992; 148(6):1693-1698. PMID: 1541813
15. Karussis DM, Vourka-Karussis U, Lehmann D, Ovadia H, Mizrachi-Koll R, Ben-Nun A, et al. Prevention and reversal of adoptively transferred, chronic relapsing experimental autoimmune encephalomyelitis with a single high dose cytoreductive treatment followed by syngeneic bone marrow transplantation. J Clin Invest. 1993; 92(2):765-772. doi: 10.1172/JCI116648
16. Van Gelder M, Kinwel-Bohré EP, van Bekkum DW. Treatment of experimental allergic encephalomyelitis in rats with total body irradiation and syngeneic BMT. Bone Marrow Transplant 1993;11: 233-241.
17. Darlington PJ, Touil T, Doucet JS, Gaucher D, Zeidan J, Gauchat D, et al. Canadian MS/BMT Study Group. Diminished Th17 (not Th1) responses underlie multiple sclerosis disease abrogation after hematopoietic stem cell transplantation. Ann Neurol. 2013; 73(3):341-354. doi: 10.1002/ana.23784
18. Karnell FG, Lin D, Motley S, Duhen T, Lim N, Campbell DJ, et al. Reconstitution of immune cell populations in multiple sclerosis patients after autologous stem cell transplantation. Clin Exp Immunol. 2017; 189(3):268-278. doi: 10.1111/cei.12985
19. Massey JC, Sutton IJ, Ma DDF, Moore JJ. Regenerating immunotolerance in multiple sclerosis with autologous hematopoietic stem cell transplant. Front Immunol. 2018; 9:410. doi: 10.3389/fimmu.2018.00410
20. Polushin AYu, Zalyalov YuR, Totolyan NA, Kulagin AD, Skoromets AA. High-dose immunosuppressive therapy with autologous hematopoietic stem cell transplantation in multiple sclerosis: a modern view of the method (review of literature). Scientific Notes of Pavlov University. 2021;28(4):9-21. (In Russ.). doi: 10.24884/1607-4181-2021-28-4-9-21
21. Oh S, Cudrici C, Ito T, Rus H. B-cells and humoral immunity in multiple sclerosis. Implications for therapy. Immunol Res. 2008;40(3):224-234. doi: 10.1007/s12026-007-8009-6
22. Meng L, Ouyang J, Zhang H, Wen Y, Chen J, Zhou J. Treatment of an autoimmune encephalomyelitis mouse model with nonmyeloablative conditioning and syngeneic bone marrow transplantation. Restor Neurol Neurosci. 2011; 29:177-185.
    doi: 10.3233/RNN-2011-0590
23. Abrahamsson SV, Angelini DF, Dubinsky AN, Morel E, Oh U, Jones JL, et al. Non-myeloablative autologous haematopoietic stem cell transplantation expands regulatory cells and depletes IL-17 producing mucosal-associated invariant T cells in multiple sclerosis. Brain. 2013; 136(Pt 9):2888-2903. doi: 10.1093/brain/awt182
24. Arruda LC, Lorenzi JC, Sousa AP, Zanette DL, Palma PV, Panepucci RA, et al. Autologous hematopoietic SCT normalizes miR-16, -155 and -142-3p expression in multiple sclerosis patients. Bone Marrow Transplant. 2015; 50(3):380-389. doi: 10.1038/bmt.2014.277
25. Cencioni MT, Genchi A, Brittain G, de Silva TI, Sharrack B, Snowden JA, et al. Immune re-constitution following autologous hematopoietic stem cell transplantation for multiple sclerosis: a re-view on behalf of the EBMT Autoimmune Diseases Working Party. Front. Immunol. 12:813957. doi: 10.3389/fimmu.2021.813957
26. Mancardi G, Sormani MP, Muraro PA, Boffa G, Saccardi R. Intense immunosuppression followed by autologous haematopoietic stem cell transplantation as a therapeutic strategy in aggressive forms of multiple sclerosis. Mult Scler. 2018 Mar;24(3):245-255.
    doi: 10.1177/1352458517742532. Epub 2017 Nov 10. PMID: 29125439
27. Snowden J, Sharrack B, Akil M, Kiely D, Lobo A, Kazmi M, et al. Autologous haematopoietic stem cell transplantation (aHSCT) for severe resistant autoimmune and inflammatory diseases – a guide for the generalist. Clin Med (Lond). 2018 Aug; 18(4): 329-334.
    doi: 10.7861/clinmedicine.18-4-329
28. Sharrack B, Saccardi R, Alexander T, Badoglio M, Burman J, Farge D, et al. European Society for Blood and Marrow Transplantation (EBMT) Autoimmune Diseases Working Party (ADWP) and the Joint Accreditation Committee of the International Society for Cellular Therapy (ISCT) and EBMT (JACIE). Autologous haematopoietic stem cell transplantation and other cellular therapy in multiple sclerosis and immune-mediated neurological diseases: updated guidelines and recommendations from the EBMT Autoimmune Diseases Working Party (ADWP) and the Joint Accreditation Committee of EBMT and ISCT (JACIE). Bone Marrow Transplant. 2020 Feb;55(2):283-306. doi: 10.1038/s41409-019-0684-0. Epub 2019 Sep 26. PMID: 31558790; PMCID: PMC6995781
29. Alexander T, Greco R. Hematopoietic stem cell transplantation and cellular therapies for autoimmune diseases: overview and future considerations from the Autoimmune Diseases Working Party (ADWP) of the European Society for Blood and Marrow Transplantation (EBMT). Bone Marrow Transplant. 2022 May 16:1-8. doi: 10.1038/s41409-022-01702-w. PMID: 35578014; PMCID: PMC9109750
30. Murrieta-Álvarez I, Cantero-Fortiz Y, León-Peña AA, Olivares-Gazca JC, Priesca-Marín JM, Ruiz-Delgado GJ, et al. The 1,000th Transplant for Multiple Sclerosis and Other Autoimmune Disor-ders at the HSCT-México Program: A Myriad of Experiences and Knowledge. Front. Neurol. 12:647425. doi: 10.3389/fneur.2021.647425
31. https://clinicaltrials.gov/ct2/show/
32. Nash RA, Hutton GJ, Racke MK, Popat U, Devine SM, Griffith LM, et al. High-dose immunosuppressive therapy and autologous hematopoietic cell transplantation for relapsing-remitting multiple sclerosis (HALT-MS): a 3-year interim report. JAMA Neurol. 2015; 72(2):159-169. doi: 10.1001/jamaneurol.2014.3780
33. Mancardi GL, Sormani MP, Gualandi F, Saiz A, Carreras E, Merelli E, et al. ASTIMS Haemato-Neurological Collaborative Group, On behalf of the Autoimmune Disease Working Party (ADWP) of the European Group for Blood and Marrow Transplantation (EBMT); ASTIMS Haemato-Neurological Collaborative Group On behalf of the Autoimmune Disease Working Party ADWP of the European Group for Blood and Marrow Transplantation EBMT. Autologous hematopoietic stem cell transplantation in multiple sclerosis: a phase II trial. Neurology. 2015; 84(10):981-988. doi: 10.1212/WNL.0000000000001329
34. Muraro PA, Pasquini M, Atkins HL, Bowen JD, Farge D, Fassas A, et al. Multiple Sclerosis–Autologous Hematopoietic Stem Cell Transplantation (MS-AHSCT) Long-term Outcomes Study Group. Long-term outcomes after autologous hematopoietic stem cell transplantation for multiple sclerosis. JAMA Neurol. 2017;74(4):459-469. doi: 10.1001/jamaneurol.2016.5867
35. Burman J, Iacobaeus E, Svenningsson A, Lycke J, Gunnarsson M, Nilsson P, et al. Autologous haematopoietic stem cell transplantation for aggressive multiple sclerosis: the Swedish experience. J Neurol Neurosurg Psychiatry. 2014 Oct;85(10):1116-21.
    doi: 10.1136/jnnp-2013-307207. Epub 2014 Feb 19. PMID: 24554104
36. Nash RA, Hutton GJ, Racke MK, Popat U, Devine SM, Steinmiller KC, et al. High-dose immunosuppressive therapy and autologous HCT for relapsing-remitting MS. Neurology. 2017 Feb 28;88(9):842-852. doi: 10.1212/WNL.0000000000003660. Epub 2017 Feb 1. PMID: 28148635; PMCID: PMC5331868
37. Jones JL, Coles AJ. Mode of action and clinical studies with alemtuzumab. Exp Neurol. 2014 Dec;262 Pt A:37-43. doi: 10.1016/j.expneurol.2014.04.018
38. Gelfand JM, Cree BAC, Hauser SL. Ocrelizumab and Other CD20+ B-Cell-Depleting Therapies in Multiple Sclerosis. Neurotherapeutics. 2017 Oct;14(4):835-841. doi: 10.1007/s13311-017-0557-4
39. Sormani MP, Muraro PA, Saccardi R, Mancardi G. NEDA status in highly active MS can be more easily obtained with autologous hematopoietic stem cell transplantation than other drugs. Mult Scler. 2017 Feb;23(2):201-204. doi: 10.1177/1352458516645670. Epub 2016 Jul 11. PMID: 27207454
40. Polman CH, O'Connor PW, Havrdova E, Hutchinson M, Kappos L, Miller DH, et al. AFFIRM Investigators. A randomized, placebo-controlled trial of natalizumab for relapsing multiple sclerosis. N Engl J Med. 2006 Mar 2;354(9):899-910. doi: 10.1056/NEJMoa044397
41. Burt RK, Loh Y, Cohen B, Stefoski D, Balabanov R, Katsamakis G, et al. Autologous non-myeloablative haemopoietic stem cell transplantation in relapsing-remitting multiple sclerosis: a phase I/II study. Lancet Neurol. 2009 Mar;8(3):244-53. doi: 10.1016/S1474-4422(09)70017-1. Epub 2009 Jan 29. Erratum in: Lancet Neurol. 2009 Apr; 8(4):309. Stefosky, Dusan [corrected to Stefoski, Dusan]. PMID: 19186105
42. Giovannoni G, Comi G, Cook S, Rammohan K, Rieckmann P, Soelberg Sørensen P, et al. CLARITY Study Group. A placebo-controlled trial of oral cladribine for relapsing multiple sclerosis. N Engl J Med. 2010; 362(5):416-426. doi: 10.1056/NEJMoa0902533
43. Hamerschlak N, Rodrigues M, Moraes DA, Oliveira MC, Stracieri AB, Pieroni F, et al. Brazilian experience with two conditioning regimens in patients with multiple sclerosis: BEAM/horse ATG and CY/rabbit ATG. Bone Marrow Transplant. 2010 Feb;45(2):239-48. doi: 10.1038/bmt.2009.127. Epub 2009 Jul 6. PMID: 19584827
44. Conway DS, Miller DM, O'Brien RG, Cohen JA. Long term benefit of multiple sclerosis treatment: an investigation using a novel data collection technique. Mult Scler. 2012;18(11):1617-1624. doi: 10.1177/1352458512449681
45. Gold R, Kappos L, Arnold DL, Bar-Or A, Giovannoni G, Selmaj K, et al. DEFINE Study Investigators. Placebo-controlled phase 3 study of oral BG-12 for relapsing multiple sclerosis. N Engl J Med. 2012;367(12):1098-1107. doi: 10.1056/NEJMoa1114287
46. Kappos L, O'Connor P, Radue EW, Polman C, Hohlfeld R, Selmaj K, et al. Long-term effects of fingolimod in multiple sclerosis: the randomized FREEDOMS extension trial. Neurology. 2015; 84(15):1582-1591. doi: 10.1212/WNL.0000000000001462
47. Reston JT, Uhl S, Treadwell JR, Nash RA, Schoelles K. Autologous hematopoietic cell transplantation for multiple sclerosis: a systematic review. Mult. Scler. 2011; 17: 204-213.
48. Burt RK, Balabanov R, Burman J, Sharrack B, Snowden JA, Oliveira MC, et al. Effect of Nonmyeloablative Hematopoietic Stem Cell Transplantation vs Continued Disease-Modifying Therapy on Disease Progression in Patients With Relapsing-Remitting Multiple Sclerosis: A Randomized Clinical Trial. JAMA. 2019 Jan 15;321(2):165-174. doi: 10.1001/jama.2018.18743. PMID: 30644983; PMCID: PMC6439765
49. Fassas A. On the evolution of high-dose immunosuppressive therapy with autologous stem cell transplantation in multiple sclerosis. Cell Ther Transplant. 2010;2:e.000060.01. doi: 10.3205/ctt-2010-en-000060.01
50. Saccardi R, Mancardi GL, Solari A, Bosi A, Bruzzi P, Di Bartolomeo P, et al. Autologous HSCT for severe progressive multiple sclerosis in a multicenter trial: impact on disease activity and quality of life. Blood. 2005 Mar 15;105(6):2601-2607. doi: 10.1182/blood-2004-08-3205. Epub 2004 Nov 16. PMID: 15546956
51. Polushin AY, Zalyalov YR, Vinokurova AN, Skiba IB, Estrina MA, Kulagin AD, et al. Effectiveness of high-dose immunosuppressive therapy with subsequent autologous hematopoietic stem cell transplantation in progressive types of multiple sclerosis: the experience of the R.M. Gorbacheva Research Institute of Hematology and Transfusiology. Russian journal of Hematology and Transfusiology (Gematologiya i Transfusiologiya). 2020; 65(1):202. (In Russian).
52. Fassas A, Kimiskidis VK, Sakellari I, Kapinas K, Anagnostopoulos A, Tsimourtou V, et al. Long-term results of stem cell transplantation for MS: a single-center experience. Neurology. 2011;76(12):1066-1070. doi: 10.1212/WNL.0b013e318211c537
53. Cull G, Hall D, Fabis-Pedrini MJ, Carroll WM, Fors-ter L, Robins F, et al. Lymphocyte reconstitution following autologous stem cell transplantation for progressive MS. Mult Scler J Exp Transl Clin. 2017; 3(1):2055217317700167. doi: 10.1177/2055217317700167
54. Roxburgh RH, Seaman SR, Masterman T, Hensiek AE, Sawcer SJ, Vukusic S, et al. Multiple Sclerosis Severity Score: using disability and disease duration to rate disease severity. Neurology. 2005;64(7):1144-1151. doi: 10.1212/01.WNL.0000156155.19270.F8
55. Kirgizov KI, Skorobogatova EV, Bembeeva RT, Volkova EY, Bologov AA, Pilia SV, Maschan AA, Rumyantsev AG. Autologous hematopoietic stem cell transplantation in children with severe refractory forms of multiple sclerosis. Current Pediatrics. 2013;12(1):149-152. (In Russian). doi: 10.15690/vsp.v12i1.572
56. Gratwohl A, Passweg J, Bocelli-Tyndall C, Fassas A, van Laar JM, Farge D, et al. Autoimmune Diseases Working Party of the European Group for Blood and Marrow Transplantation (EBMT). Autologous hematopoietic stem cell transplantation for autoimmune diseases. Bone Marrow Transplant. 2005; 35(9):869-879. doi: 10.1038/sj.bmt.1704892
57. Arruda LCM, de Azevedo JTC, de Oliveira GLV, Scortegagna GT, Rodrigues ES, Palma PVB, et al. Immunological correlates of favorable long-term clinical outcome in multiple sclerosis patients after autologous hematopoietic stem cell transplantation. Clin Immunol. 2016;169:47-57. doi: 10.1016/j.clim.2016.06.005
58. Comi G, Kappos L, Clanet M, Ebers G, Fassas A, Fazekas F, et al. Guidelines for autologous blood and marrow stem cell transplantation in multiple sclerosis: a consensus report written on behalf of the European Group for Blood and Marrow Transplantation and the European Charcot Foundation. BMT-MS Study Group. J Neurol. 2000;247(5):376-382.
    doi: 10.1007/s004150050605
59. Afanasyeva KS, Barabanshchikova MV, Bondarenko SN, Bykova TA, Vlasova YY, Gevorgian AG, Golubovskaya IK, et al. Indications for hematopoietic stem cell transplantation. 2nd Edition. Based on EBMT Recommendations of 2019. 2019; 8(4). Cell Ther Transplant 8(4):101-145. doi: 10.18620/ctt-1866-8836-2019-8-4-101-145
60. Duarte RF, Labopin M, Bader P, Basak GW, Bonini C, Chabannon C, et al. European Society for Blood and Marrow Transplantation (EBMT). Indications for haematopoietic stem cell transplantation for haematological diseases, solid tumours and immune disorders: current practice in Europe, 2019. Bone Marrow Transplant. 2019; 54(10):1525-1552. doi: 10.1038/s41409-019-0516-2
61. Cohen JA, Baldassari LE, Atkins HL, Bowen JD, Bredeson C, Carpenter PA, et al. Autologous hematopoietic cell transplantation for treatment-refractory relapsing multiple sclerosis: position statement from the American Society for Blood and Marrow Transplantation. Biol Blood Marrow Transplant. 2019;25:845-854. doi: 10.1016/j.bbmt.2019.02.014

" ["~DETAIL_TEXT"]=> string(51999) "

Introduction

Over recent decades, an increase in the incidence of multiple sclerosis (MS) was recorded worldwide [1-3]. Unfortunately, current medicamental treatment of MS is very expensive and is not efficient enough: it allows for relapse-free course only in a half of the cases. In this regard, European countries are already developing programs to include high-dose immunosuppressive therapy with autologous hematopoietic stem cell transplantation (HDIT-AHSCT) into the standards of active MS treatment [4, 5]. In the Russian Federation, HDIT-AHSCT has been used for severe autoimmune diseases since the mid-1990s [6, 7] like as in the European transplant clinics [8; 9]. Hence, the purpose of this review is to analyze the scientific publications on the selection of optimal conditions and criteria for HDIT-AHSCT for multiple sclerosis.

Methods of data searching

The search for scientific publications in the databases "Pub-med", "Scopus" was carried out by the keywords "HDIT-AHSCT", "stem cells" and "multiple sclerosis".

Analysis and systematization of the data from scientific literature was based on the following issues: 1) algorithms and stages of the HDIT-AHSCT methodology; 2) immunopathgenic rationale for the HDIT-AHSCT in MS patients; 3) results of HDIT-AHSCT clinical trials (CT) in MS; 4) conditioning regimens in HSCT; 5) selection of MS patients according to the criteria for HDIT-AHSCT. Our analysis included publications with high levels of evidence: publication of the results of randomized and controlled experimental and clinical laboratory studies. The international consensus recommendations of expert groups were also considered.

The main stages of HDIT-AHSCT:

1. Mobilization of hematopoietic stem cells – the stimulation of the CD34+ hematopoietic stem cells (HSC) output from the bone marrow to peripheral blood aiming for subsequent apheresis and mononuclear cell collection. The granulocyte colony-stimulating factor (G-CSF) is used for CD34+ cell mobilization, either as a single drug, or in combination with cyclophosphamide (Fig. 1). The available studies have not been identified statistically significant differences between such approaches in terms of relapse-free clinical course [10]. There are also no significant differences when comparing the groups with or without CD34+ cells immunoselection, the latter technology has led to lower treatment costs [11]. Patient’s age, individual features of bone marrow functioning, previous treatment modaliities are the factors that may affect efficiency of hematopoietic stem cell mobilization.

Figure 1. Steps of the high-dose intensive therapy (HDIT)-autologous stem cell transplantation (AHSCT)

Notes: G-CSF, Granulocyte Colony Stimulating Factor; HSC, Hematopoietic Stem Cells; HDIT, High-Dose Immunosuppressive Therapy; AHSCT, Autologous Hematopoietic Stem Cell Transplantation; Cy, Cyclophosphamide.

2. Apheresis means removal of CD34+ cells from peripheral blood for subsequent cryopreservation. The HSC apheresis may take 1-2 days for sufficient cell collection. The optimal number of CD34+ cells in the transplant should be 2-5×10⁶/kg of recipient weight.

3. Cryopreservation of the transplant, i.e., storage of the transplant in liquid nitrogen with a cryoprotector (dimethylsulfoxide) is required for the time period of treatment and pre-transplant conditioning therapy.

4. Conditioning regimen (CR) includes high-dose immunosuppressive therapy (HDIT) in order to deplete autoreactive T- and B- lymphocytes. The AHSCT conditioning regimens are heterogeneous for their intensity, being 4 to 7 days long. Atkins H. et al. showed the effectiveness of high-intensity, i.e., myeloablative regimens which include cyclophosphamide and busulfan, even in the patients with progressive forms of MS [12]. However, the use of high-intensity conditioning has an adverse toxicity profile and may lead to increased therapy-associated mortality. Usage of low- and medium-intensity regimens often allows to avoiding significant toxicity and demonstrates high efficacy in patients with remitting MS. The issue of choosing of conditioning regimen still remains open in cases of progressive MS.

5. The AHSCT procedure requires thawing and transfusion of the transplant to the patient (day 0). The duration of the procedure is less than half an hour. The primary goal of an autograft transfusion is to trigger fast recovery of the naive immunocompromised cell pool and to make cytopenic period shorter.

6. Immunotherapy includes usage of antithymocyte globulin (ATG) for additional exhaustion of T-lymphocytes in the transplant as well as lymphocytes in blood flow that survived after chemotherapy. In addition, ATG has an immunomodulating effect, due to increased expansion of T-regulatory cells, which, in turn, positively influences the processes of immunological tolerance [13].

7. The period of cytopenia is characterized by low leukocyte level in circulation. It is a regular complication of HDIT, but it is not the target when treating autoimmune disorders. In the framework of standard protocols, the massive accompanying anti-infectious therapy is carried out at this stage and, if necessary, transfusions of blood products are provided.

8. The period of hemopoietic recovery is achieved upon reconstitution of blood leukocytes to subnormal levels ("exit" from cytopenia). At this stage, G-CSF may be used to reduce the period of cytopenia by an average of 5-7 days. The patient can be discharged from the hospital after sustained hemopoiesis recovery to >1×10⁹/l leukocyte levels; neutrophils to >0.5×10⁹/l; platelets to >20×10⁹/l, does not require transfusions of blood components, in absence of toxic organ, infectious and hemorrhagic complications.

9. Consolidation is a feasible therapeutic option to maintain the HDIT effect (for example, in fast-progressing/aggressive MS). The consolidation treatment (remission support) may include complementary immunosuppressive therapy and is administered exclusively within the framework of internal protocols of specialized centers. To date, there is no consensus protocol for post-transplant management of patients with MS.

The HDIT-AHSCT stages are shown in Figure 1.

Immunopathogenic rationale of HDIT-AHSCT in MS

Multiple sclerosis is a promising disease for the potential HDIT-AHSCT application since it represents a classical autoimmune disease associated with impaired immunological tolerance followed by a sequence of immunopathogenic events directed against the nervous system, including altered antigen recognition and presentation, activation, proliferation and cell differentiation in the course of adaptive immune response. The notion that HSC in autoimmune diseases are intact, and the pathological process involves immunocompetent cells at the early stages of differentiation, was suggested and confirmed by the efficacy of autologous and syngeneic bone marrow transplantation in experimental models for rheumatoid arthritis and experimental autoimmune encephalomyelitis using immunoablation with high-dose cyclophosphamide and total body irradiation (TBI) [14-16].

Potential efficacy of HDIT preceding the AHSCT is based on a double effect upon immune system: a) elimination of pathogenetically significant autoreactive T- and B-lymphocytes using high-dose immunosuppressive therapy followed by de novo repopulation of "naive" lymphocytes from the transfused autologous cells, and b) due to generation of immunological tolerance to the disease-specific autoantigens [17-19]. The proof of concept for HDIT-AHSCT is based on 2 pre-requisites: (1) achievement of immune reconstitution after profound lymphodepletion and restoration of adequate balance between autoreactive cells, and (2) presumed effects of emerging immune cells responsible for immunosuppression and immunoregulation. The expected effect also includes achievement of long-term immunological autotolerance. The absence of radiological activity and clinical relapses after HDIT-AHSCT in patients with aggressive MS forms correlates with a decrease in circulating cell subpopulations of proinflammatory Th17 and dpTh1/Th17 [17].

Due to the intactness of stem cells, the autoimmune diseases (AID) do not require myeloablative conditioning. This concept allowed to eliminate highly intensive myeloablative conditioning, while maintaining the immunoablative action, thus providing total elimination of autoreactive clones of T- and B-cells [20, 21].

However, the use of a nonmyeloablative conditioning for experimental autoimmune encephalomyelitis without hematopoietic stem cell support (only HDIT without AHSCT) did not result in long-term remission, suggesting possible immunomodulating effects of AHSCT [22]. Some studies have shown that the supposed diversification of immune cell repertoire (immunological reconstitution) may occur after AHSCT. One may also expect selective expansion of minor autoreactive T-lymphocyte clones that survived the conditioning treatment immediately after reinfusion of autologous stem cells. Moreover, the transplant itself also contains an admixture of T lymphocytes, which may be a cell substrate for subsequent immune reconstitution. Immunotherapy with ATG on the first days after AHSCT (D+1, D+2, D+3) leads to additional lymphodepletion and exhaustion of T-lymphocyte subpopulations from MAIT (mucosal associated invariant), characterized by CD8+ phenotype, proinflammatory IL-17 and interferon-γ [23].

The second phase of T-cell reconstitution begins in the thymus, where immunological "learning", differentiation and maturation of T-lymphocytes occur. Thereafter, "naive" T cells circulate in the blood and peripheral lymphoid organs and, hence, participate in "reboot" of the immune system. Patients without signs of activity show early expansion of CD8+PD-1+ T-lymphocytes, and inversion of CD4/CD8 ratio. Over the first months after the procedure, the repertoire of CD8+ and (to a lesser extent) CD4+ T-cells undergoes sufficient expansion. It is also known that autologous CD34+ cells may be involved in differentiation of GFAP-producing reactive astrocytes. After 1-2 years, expansion of naive CD4+ and CD8+ thymic cells is observed, which exhibit wider clonal diversity. The regulatory pool of CD4+CD25+CD127 FoxP3+ T-lymphocytes (promoters of immunological tole-rance) is also increasing with time [24].

The B-cell repertoire is also changing as seen by the profile of recovering B-lymphocytes after HDIT-AHSCT which differs from B lymphocytes prior to therapy. The peculiarity of post-transplant B-cell reconstitution is a predominance of "naive" phenotype (CD27-), whereas an imbalance towards proinflammatory profile was evident before AHSCT. For this reason, the reduced secretion of proinflammatory cytokines (FNO, IL-6, GM-CSF) was detected, and an increase of IL-10 was achieved [25]. These changes contribute to the recovery of immunological autotolerance, which may be long-lasting [26]. The changes of adaptive immune response persist for a long time after HSCT and the initial lymphocyte repopulation phase. This hypothesis confirms the concept of immune "reboot" [27].

Clinical Studies of HDIT-AHSCT in multiple sclerosis

According to the data of Autoimmune Diseases Working Party (ADWP), about 4000 SCT for autoimmune diseases (AID) have been performed and officially registered by the European Society for Blood and Marrow Transplantation (EBMT). [28, 29]. More than half of the HDIT-AHSCT were administered in cases of multiple sclerosis. The largest register of the Mexican group, where more than 1000 SCT for MS have been performed, is also known [30].

Despite the experience gained so far, the number of completed clinical trials is limited, and the data obtained are difficult to compare for the patient groups, procedure protocols (CR) and test endpoints (Table 1), and to perform proper statistical evaluation, due to their heterogeneity.

Table 1. Trials for clinical efficiency and safety of HDIT-AHSCT for multiple sclerosis [31]

Notes: Bu – Busulfan; ВЕАМ – Bis-chloroethylnitrosourea (BCNU), Etoposide, cytosine Arabinoside, (Ara-C; cytosine-arabinozide), Melphalan; Cy – Cyclophosphamide, ATG – Antithymocyte immunoglobulin; DMT – Disease-modifying therapy; NCT – National Clinical Trials; AHSCT – autologous hematopoietic stem cell transplantation; CR – conditioning regimen.

According to the HALT-MS study, the patients with active relapsing-remitting MS (RRMS) had sustained clinical remission in 77% of cases during the 5-year follow-up [32]. According to the ASTIMS study, the number of T2-lesions (MRI) was decreased in 79% of patients during 4-year follow up after HDIT-AHSCT [33]. High-intensity CR (Bu-Cy-ATG) showed full clinical and radiological remission in 84% of patients with long-term observation for an average of 6.7 years (3.9 to 12.7) [12].

Data on the efficiency of HDIT-AHSCT according to the NEDA (No Evidence of Disease Activity) criteria in different studies are compared to results of immunotherapy in MS patients (Fig. 2). Absence of clinical exacerbation, progression of disability and physical activity according to MRI data (the summary NEDA estimate) during the three-year observation was observed in 70-94% of patients after HDIT-AHSCT compared to 22-48% following standard immunosuppressive therapy [12; 32; 34-36] with alemtuzumab (anti-CD52), ocrelizumab (anti-CD20) and daclizumab (anti-CD25) (different monoclonal antibody drugs from the group of "highly effective MS therapy") [37-39]. In this regard, interesting data were obtained at the most active transplant centers in Italy over the period of 1996 to 2016, where, after HDIT-AHSCT protocol (BEAM-ATG) applied in 122 patients (59% relapsing-remitting MS (RRRS)), 3-year relapse-free outcomes were registered in 91% of patients with RRMS and in 62% of cases with progressive-type MS (p<0.001). One should note that clinical exacerbations are rarely observed in secondary-progressive MS (SPMS), extremely rare in primary-progressive MS (PPMS). According to the single-center study performed by Mancardi et al., the NEDA criteria were achieved in 72% of RRMS patients and in 55% of SPMS patients within 5 years after HDIT-AHSCT (p=0.07) [26].

Figure 2. Effectiveness of different therapies in MS, according to the NEDA criteria. Presented a comparative analysis of the results of clinical trials (12-24 months from the beginning of therapy) and HDIT-AHSCT (30-80.4 months from therapy) [12; 34-36; 40-46]

Notes: p1 – Phase 1 trial, NEDA - No Evidence of Disease Activity; IFNβ-1a –interferon beta-1a.

The above data point to the effectiveness of HDIT-AHSCT, in advanced-stage MS patients. However, direct comparison of these results is not possible due to the differences in patient selection criteria, follow-up terms, and performance evaluation.

According to meta-analysis by Reston J.T. et al., the success rates of relapse-free period in MS after medium-intensity conditioning (BEAM/carmustine) may be higher than with high-intensity therapy including total body irradiation: 79.4% (69.9-86.5%) and 44.6% (26.5-64.3%) at the observation terms of 6-72 and 6-60 months, respectively [47].

In the MIST study, 110 patients were treated with HDIT-AHSCT (n=55) and with DMT (n=55). After a year of treatment, the disease progression with increasing neurological deficit (EDSS scale) was recorded in only 3 patients after HDIT-AHSCT versus 34 patients who received DMT. The total HDIT-AHSCT group showed an improvement by 1.02 points on the EDSS scale (decreased symptoms), and clinical worsening by 0.67 points in the DMT group (cross-group comparison, 1.7; 95% CI, 2.03 to 1.29; p<0.001). Despite the impressive results, it should be noted that the study had certain limitations, e.g., absence of patients in the group of DMT receiving high-efficiency treatment with ocrelizumab and alemtuzumab [48].

A long-term study of HDIT-AHSCT efficiency in MS from 1990 to 2000 was based on the inclusion of patients with a predominantly high disability levels (EDSS >6.5 points), and 20% of them were with PPMS. Relapse-free course was achieved in 60-80% of patients within 3 years of follow-up [43]. With a 10-year observation after treatment, 65% of SPMS patients had no MS symptoms, and 40% of PPMS patients showed a positive effect in terms of improved quality of life and cognitive functions [49, 50]. The limitations of this study relate to the issues of the outcome assessment, since, as noted above, the frequency of exacerbation for progressive forms of MS are difficult to evaluate in optimal manner.

According to the data of R.M. Gorbacheva Research Institute (Pavlov University, St. Petersburg), over the follow-up period of 19 to 7 years after HDIT-AHSCT only minimal progression of neurological deficit, i.e., 0.5±1.1 EDSS points was documented after treatment (the characteristics of the study group are presented in the Table 2).

The MSSS progression score at the time of HDIT-AHSCT was 76.5±21.36, compared to 62.43±25.05 after 13±2.5 years (p=0.015), which may indicate a delay of progression after treatment [51]. The obtained results (Fig. 3) show that HDIT-AHSCT allowed to influence the aggressive clinical course and to shift the average rank value of MSSS from the group "Fast Progressing Current 3B" to the group "Progressing Current 3A". In general, our results are in accordance with previously reported EBMT data [43, 52, 53].

Unresolved issues in conditioning regimens

As mentioned above, the conditioning regimes (CR/HDIT) differ in immunosuppressive effects: high-, medium- and low-intensity regimens. The most commonly used CRs are presented in Table 3.

Established variants of high-dose conditioning regimens depending on the level of immunosuppression [5, 8-10, 12, 20, 28, 32-36, 41, 43, 58].

As shown in Table 3, the high-intensity conditioning regimens were used predominantly in North America. The European transplant centers applied mostly reduced intensity protocols. Before 2010, high- and medium-intensity regimens were mainly used, followed by later shift towards the use of cyclophosphamide-containing regimens, thus enabling implementation of this approach even in younger MS patients with under 18 years [55].

Duration of the relapse-free course in MS as well as the severity of early and late HSCT complications is shown to depend on the intensity of conditioning regimen. In the report of the EBMT Registry (2005), a stable clinical response was observed in 78% of patients who received high-intensity treatment, compared to 68% for medium- and 30% for low-intensity conditioning (p=0.0001) [56]. However, according to Reston et al. (2011), the patients with SPMS had a longer relapse-free course after medium-intensity conditioning than after high-intensity therapy (Bu-Cy, TBI-Cy, etc.) [47]. According to Arruda et al. the efficiency of conditioning regimen in MS depends more on lymphodepletion than on myeloablation, i.e., prolonged lymphopenia correlates with a longer period of relapse-free course [57].

Current principles of HDIT-AHSCT in MS

The basic principles of HDIT-AHSCT for MS are based on the recommendations of the European and American Societies for Blood and Bone Marrow Transplantation (resp., EBMT and ASBMT) [28, 58-61] being summarized as follows:

Level S/I (treatment standard/efficacy proven in at least one randomized CT):
1. HDIT-AHSCT should be offered to the patients with MS:
- with high clinical and MR-activity (at least two clinical exacerbations or one clinical exacerbation with signs of MR-activity in the form of accumulating contrast substance (Gd+) in post-concussive T1 or 1 new T2 lesions in the last 12 months);
- if one or more DMT are ineffective.
2. The factors of potential effectiveness are:
- the independence in moving (EDSS no more than 5.5);
- age under 45 years;
- the duration of the MS no more than 10 years.

Level CO/II (clinical option, no "corroborating" results of randomized CT/efficiency based on non-randomized CT data, cohort analytical studies):

1. Patients with aggressive MS (criteria: at least 2 clinical exacerbations or one clinical relapse with a centre accumulating contrast agent or a new T2 foci in the last 12 months) with disability in the last 12 months – are the candidates. In view of the potentially irreversible disability, such patients could be considered for HDIT-AHSCT before completing the full course of DMT;

2. Patients with SPMS should be considered for HDIT-AHSCT mainly with inflammatory activity (clinical relapses and Gd+/new lesions on T2 MRI) with documented progression in the previous 12 months;

3. Patients with PPMS should be considered for HDIT-AHSCT only with inflammatory activity (Gd+ and new lesions on T2 MRI) with documented apparent progression of disability in the previous 12 months;

4. Patients with MS under 18 years of age can be considered for HDIT-AHSCT only in case of aggressive MS with selection of less toxic protocols of CR;

5. The criteria for selecting patients are based on the aggressiveness of the disease, analysis of the patient’s anamnesis and comorbidity, analysis of the risk-benefit ratio of the method, and from the personal and social aspects of the patient.

Conclusion

Critical evaluation of the world experience with HDIT- AHSCT in MS allows to consider this therapeutic option as highly effective treatment of multiple sclerosis if applied at early stages of the disease progression, at predominance of active autoimmune inflammation, but not at the stage of neurodegeneration prevalence. In the cases of progressive course of the disease, at a stage where neurodegenerative processes prevail, the method may have a certain delayed stabilizing effect. The selection criteria for HDIT-AHSCT in MS patients should include demographic factors, physical/social activity, type of disease and prognostic factors of adverse MS course as well as safety criteria based on present comorbidities and realistic expectations of the patient. Over last 10-15 years, taking into account the experience of multiple transplant centers, due to lower toxicity of conditioning regimes, we were able to reduce the severity of complications, however, keeping high clinical efficiency of AHSCT. Pathophysiology of multiple sclerosis, as well as in other neurological diseases, does not allow to compensate the irreversible pathomorphological changes that occurred in central nervous system before the therapy, but HDIT-AHSCT allows suppression of the current autoimmune process and, therefore, to avoid further damage and death of nervous tissues, accompanied by progression of irreversible neurological deficiency. When the desired long-term relapse-free course is achieved, an obvious advantage of this approach may be a withdrawal of disease-modifying therapy, which complies with optimal principle of disease control using the "one-off disease control" therapy.

Conflict of interest

The authors state that there is no conflict of interest. The authors bear full responsibility for providing the final version of the manuscript to the press. All authors took part in the development of the concept of the article and the writing of the manuscript. The final version of the manuscript was approved by all authors.

Acknowledgements

We acknowledge the Autoimmune Diseases Working Party (ADWP) of the European Society for Blood and Marrow Transplantation (EBMT) for its support in providing updated registry data and all EBMT member centers and their clinicians, data managers and patients for their valuable contributions to the EBMT registry. The authors confirm that they followed the Declaration of Human Rights with persons involved into the study.

References

1. Sumelahti ML, Tienari PJ, Wikström J, Palo J, Hakama M. Regional and temporal variation in the incidence of multiple sclerosis in Finland 1979-1993. Neuroepidemiology. 2000 Mar-Apr;19(2):67-75. doi: 10.1159/000026241
2. Alonso A, Jick SS, Olek MJ, Hernan MA. Incidence of multiple sclerosis in the United Kingdom: findings from a population-based cohort. J Neurol. 2007; 254:1736-1741. doi: 10.1007/s00415-007-0602-z
3. Fromont A, Binquet C, Sauleau E, Fournel I, Despalins R, Rollot F, et al. National estimate of multiple sclerosis incidence in France (2001-2007). Mult Scler. 2012;18(8):1108-1115. doi: 10.1177/1352458511433305
4. Laureys G, Willekens B, Vanopdenbosch L, Deryck O, Selleslag D, D'Haeseleer M, et al. A Belgian Consensus Protocol for autologous hematopoietic stem cell transplantation in multiple sclerosis. Acta Neurol Belg. 2018;118(2):161-168. doi: 10.1007/s13760-018-0905-0
5. Burman J, Tolf A, Hоgglund H, Askmark H. Autologous haematopoietic stem cell transplantation for neurological diseases. J Neurol Neurosurg Psychiatry. 2018;89(2):147-155. doi: 10.1136/jnnp-2017-316271
6. Sizikova SA, Lisukov IA, Kulagin AD, Kriuchkova IV, Gilevich AV, Chernykh EP et al. Vysokodoznaia immunosuppressivnaia terapiia s autologichnoĭ transplantatsieĭ stvolovykh krovetvornykh kletok pri autoimmunykh zabolevaniiakh. Terapevticheskii Arkhiv. 2002;74(7):22-26. (In Russian). PMID: 12181829
7. Shevchenko YL, Novik AA, Kuznetsov AN, Afanasyev BV, Lisukov IA, Kozlov VA, et al. Autologous transplantation of hematopoietic stem cells in multiple sclerosis: results of a study of the Russian cooperative cell therapy group. Neurological Journal. 2008. Vol. 13. No. 2. pp. 11-18. (In Russian).
8. Fassas A, Anagnostopoulos A, Kazis A, Kapinas K, Sakellari I, Kimiskidis V, et al. Peripheral blood stem cell transplantation in the treatment of progressive multiple sclerosis: first results of a pilot study. Bone Marrow Transplant. 1997; 20(8):631-638.
   doi: 10.1038/sj.bmt.1700944
9. Gavriilaki M, Sakellari I, Gavriilaki E, Kimiskidis VK, Anagnostopoulos A. Autologous hema-topoietic cell transplantation in multiple sclerosis: changing paradigms in the era of novel agents. Stem Cells Int. 2019; 2019:5840286. doi: 10.1155/2019/5840286
10. Currò D, Mancardi G. Autologous hematopoietic stem cell transplantation in multiple sclerosis: 20 years of experience. Neurol Sci. 2016;37(6):857-865. doi: 10.1007/s10072-016-2564-3
11. Moore J, Brooks P, Milliken S, Biggs J, Ma D, Handel M, et al. A pilot randomized trial comparing CD34-selected versus unmanipulated hemopoietic stem cell transplantation for severe, refractory rheumatoid arthritis. Arthritis Rheum. 2002;46(9):2301-2309. doi: 10.1002/art.10495
12. Atkins HL, Bowman M, Allan D, Anstee G, Arnold DL, Bar-Or A, et al. Immunoablation and autologous haemopoietic stem-cell transplantation for aggressive multiple sclerosis: a multicentre single-group phase 2 trial. Lancet. 2016; 388(10044):576-585.
    doi: 10.1016/S0140-6736(16)30169-6
13. Feng X, Kajigaya S, Solomou EE, Keyvanfar K, Xu X, Raghavachari N, et al. Rabbit ATG but not horse ATG promotes expansion of functional CD4+CD25highFOXP3+ regulatory T cells in vitro. Blood. 2008;111(7): 3675-3683. doi: 10.1182/blood-2008-01-130146
14. Karussis DM, Slavin S, Lehmann D, Mizrachi-Koll R, Abramsky O, Ben-Nun A. Prevention of experimental autoimmune encephalomyelitis and induction of tolerance with acute immunosuppression followed by syngeneic bone marrow transplantation.
    J Immunol. 1992; 148(6):1693-1698. PMID: 1541813
15. Karussis DM, Vourka-Karussis U, Lehmann D, Ovadia H, Mizrachi-Koll R, Ben-Nun A, et al. Prevention and reversal of adoptively transferred, chronic relapsing experimental autoimmune encephalomyelitis with a single high dose cytoreductive treatment followed by syngeneic bone marrow transplantation. J Clin Invest. 1993; 92(2):765-772. doi: 10.1172/JCI116648
16. Van Gelder M, Kinwel-Bohré EP, van Bekkum DW. Treatment of experimental allergic encephalomyelitis in rats with total body irradiation and syngeneic BMT. Bone Marrow Transplant 1993;11: 233-241.
17. Darlington PJ, Touil T, Doucet JS, Gaucher D, Zeidan J, Gauchat D, et al. Canadian MS/BMT Study Group. Diminished Th17 (not Th1) responses underlie multiple sclerosis disease abrogation after hematopoietic stem cell transplantation. Ann Neurol. 2013; 73(3):341-354. doi: 10.1002/ana.23784
18. Karnell FG, Lin D, Motley S, Duhen T, Lim N, Campbell DJ, et al. Reconstitution of immune cell populations in multiple sclerosis patients after autologous stem cell transplantation. Clin Exp Immunol. 2017; 189(3):268-278. doi: 10.1111/cei.12985
19. Massey JC, Sutton IJ, Ma DDF, Moore JJ. Regenerating immunotolerance in multiple sclerosis with autologous hematopoietic stem cell transplant. Front Immunol. 2018; 9:410. doi: 10.3389/fimmu.2018.00410
20. Polushin AYu, Zalyalov YuR, Totolyan NA, Kulagin AD, Skoromets AA. High-dose immunosuppressive therapy with autologous hematopoietic stem cell transplantation in multiple sclerosis: a modern view of the method (review of literature). Scientific Notes of Pavlov University. 2021;28(4):9-21. (In Russ.). doi: 10.24884/1607-4181-2021-28-4-9-21
21. Oh S, Cudrici C, Ito T, Rus H. B-cells and humoral immunity in multiple sclerosis. Implications for therapy. Immunol Res. 2008;40(3):224-234. doi: 10.1007/s12026-007-8009-6
22. Meng L, Ouyang J, Zhang H, Wen Y, Chen J, Zhou J. Treatment of an autoimmune encephalomyelitis mouse model with nonmyeloablative conditioning and syngeneic bone marrow transplantation. Restor Neurol Neurosci. 2011; 29:177-185.
    doi: 10.3233/RNN-2011-0590
23. Abrahamsson SV, Angelini DF, Dubinsky AN, Morel E, Oh U, Jones JL, et al. Non-myeloablative autologous haematopoietic stem cell transplantation expands regulatory cells and depletes IL-17 producing mucosal-associated invariant T cells in multiple sclerosis. Brain. 2013; 136(Pt 9):2888-2903. doi: 10.1093/brain/awt182
24. Arruda LC, Lorenzi JC, Sousa AP, Zanette DL, Palma PV, Panepucci RA, et al. Autologous hematopoietic SCT normalizes miR-16, -155 and -142-3p expression in multiple sclerosis patients. Bone Marrow Transplant. 2015; 50(3):380-389. doi: 10.1038/bmt.2014.277
25. Cencioni MT, Genchi A, Brittain G, de Silva TI, Sharrack B, Snowden JA, et al. Immune re-constitution following autologous hematopoietic stem cell transplantation for multiple sclerosis: a re-view on behalf of the EBMT Autoimmune Diseases Working Party. Front. Immunol. 12:813957. doi: 10.3389/fimmu.2021.813957
26. Mancardi G, Sormani MP, Muraro PA, Boffa G, Saccardi R. Intense immunosuppression followed by autologous haematopoietic stem cell transplantation as a therapeutic strategy in aggressive forms of multiple sclerosis. Mult Scler. 2018 Mar;24(3):245-255.
    doi: 10.1177/1352458517742532. Epub 2017 Nov 10. PMID: 29125439
27. Snowden J, Sharrack B, Akil M, Kiely D, Lobo A, Kazmi M, et al. Autologous haematopoietic stem cell transplantation (aHSCT) for severe resistant autoimmune and inflammatory diseases – a guide for the generalist. Clin Med (Lond). 2018 Aug; 18(4): 329-334.
    doi: 10.7861/clinmedicine.18-4-329
28. Sharrack B, Saccardi R, Alexander T, Badoglio M, Burman J, Farge D, et al. European Society for Blood and Marrow Transplantation (EBMT) Autoimmune Diseases Working Party (ADWP) and the Joint Accreditation Committee of the International Society for Cellular Therapy (ISCT) and EBMT (JACIE). Autologous haematopoietic stem cell transplantation and other cellular therapy in multiple sclerosis and immune-mediated neurological diseases: updated guidelines and recommendations from the EBMT Autoimmune Diseases Working Party (ADWP) and the Joint Accreditation Committee of EBMT and ISCT (JACIE). Bone Marrow Transplant. 2020 Feb;55(2):283-306. doi: 10.1038/s41409-019-0684-0. Epub 2019 Sep 26. PMID: 31558790; PMCID: PMC6995781
29. Alexander T, Greco R. Hematopoietic stem cell transplantation and cellular therapies for autoimmune diseases: overview and future considerations from the Autoimmune Diseases Working Party (ADWP) of the European Society for Blood and Marrow Transplantation (EBMT). Bone Marrow Transplant. 2022 May 16:1-8. doi: 10.1038/s41409-022-01702-w. PMID: 35578014; PMCID: PMC9109750
30. Murrieta-Álvarez I, Cantero-Fortiz Y, León-Peña AA, Olivares-Gazca JC, Priesca-Marín JM, Ruiz-Delgado GJ, et al. The 1,000th Transplant for Multiple Sclerosis and Other Autoimmune Disor-ders at the HSCT-México Program: A Myriad of Experiences and Knowledge. Front. Neurol. 12:647425. doi: 10.3389/fneur.2021.647425
31. https://clinicaltrials.gov/ct2/show/
32. Nash RA, Hutton GJ, Racke MK, Popat U, Devine SM, Griffith LM, et al. High-dose immunosuppressive therapy and autologous hematopoietic cell transplantation for relapsing-remitting multiple sclerosis (HALT-MS): a 3-year interim report. JAMA Neurol. 2015; 72(2):159-169. doi: 10.1001/jamaneurol.2014.3780
33. Mancardi GL, Sormani MP, Gualandi F, Saiz A, Carreras E, Merelli E, et al. ASTIMS Haemato-Neurological Collaborative Group, On behalf of the Autoimmune Disease Working Party (ADWP) of the European Group for Blood and Marrow Transplantation (EBMT); ASTIMS Haemato-Neurological Collaborative Group On behalf of the Autoimmune Disease Working Party ADWP of the European Group for Blood and Marrow Transplantation EBMT. Autologous hematopoietic stem cell transplantation in multiple sclerosis: a phase II trial. Neurology. 2015; 84(10):981-988. doi: 10.1212/WNL.0000000000001329
34. Muraro PA, Pasquini M, Atkins HL, Bowen JD, Farge D, Fassas A, et al. Multiple Sclerosis–Autologous Hematopoietic Stem Cell Transplantation (MS-AHSCT) Long-term Outcomes Study Group. Long-term outcomes after autologous hematopoietic stem cell transplantation for multiple sclerosis. JAMA Neurol. 2017;74(4):459-469. doi: 10.1001/jamaneurol.2016.5867
35. Burman J, Iacobaeus E, Svenningsson A, Lycke J, Gunnarsson M, Nilsson P, et al. Autologous haematopoietic stem cell transplantation for aggressive multiple sclerosis: the Swedish experience. J Neurol Neurosurg Psychiatry. 2014 Oct;85(10):1116-21.
    doi: 10.1136/jnnp-2013-307207. Epub 2014 Feb 19. PMID: 24554104
36. Nash RA, Hutton GJ, Racke MK, Popat U, Devine SM, Steinmiller KC, et al. High-dose immunosuppressive therapy and autologous HCT for relapsing-remitting MS. Neurology. 2017 Feb 28;88(9):842-852. doi: 10.1212/WNL.0000000000003660. Epub 2017 Feb 1. PMID: 28148635; PMCID: PMC5331868
37. Jones JL, Coles AJ. Mode of action and clinical studies with alemtuzumab. Exp Neurol. 2014 Dec;262 Pt A:37-43. doi: 10.1016/j.expneurol.2014.04.018
38. Gelfand JM, Cree BAC, Hauser SL. Ocrelizumab and Other CD20+ B-Cell-Depleting Therapies in Multiple Sclerosis. Neurotherapeutics. 2017 Oct;14(4):835-841. doi: 10.1007/s13311-017-0557-4
39. Sormani MP, Muraro PA, Saccardi R, Mancardi G. NEDA status in highly active MS can be more easily obtained with autologous hematopoietic stem cell transplantation than other drugs. Mult Scler. 2017 Feb;23(2):201-204. doi: 10.1177/1352458516645670. Epub 2016 Jul 11. PMID: 27207454
40. Polman CH, O'Connor PW, Havrdova E, Hutchinson M, Kappos L, Miller DH, et al. AFFIRM Investigators. A randomized, placebo-controlled trial of natalizumab for relapsing multiple sclerosis. N Engl J Med. 2006 Mar 2;354(9):899-910. doi: 10.1056/NEJMoa044397
41. Burt RK, Loh Y, Cohen B, Stefoski D, Balabanov R, Katsamakis G, et al. Autologous non-myeloablative haemopoietic stem cell transplantation in relapsing-remitting multiple sclerosis: a phase I/II study. Lancet Neurol. 2009 Mar;8(3):244-53. doi: 10.1016/S1474-4422(09)70017-1. Epub 2009 Jan 29. Erratum in: Lancet Neurol. 2009 Apr; 8(4):309. Stefosky, Dusan [corrected to Stefoski, Dusan]. PMID: 19186105
42. Giovannoni G, Comi G, Cook S, Rammohan K, Rieckmann P, Soelberg Sørensen P, et al. CLARITY Study Group. A placebo-controlled trial of oral cladribine for relapsing multiple sclerosis. N Engl J Med. 2010; 362(5):416-426. doi: 10.1056/NEJMoa0902533
43. Hamerschlak N, Rodrigues M, Moraes DA, Oliveira MC, Stracieri AB, Pieroni F, et al. Brazilian experience with two conditioning regimens in patients with multiple sclerosis: BEAM/horse ATG and CY/rabbit ATG. Bone Marrow Transplant. 2010 Feb;45(2):239-48. doi: 10.1038/bmt.2009.127. Epub 2009 Jul 6. PMID: 19584827
44. Conway DS, Miller DM, O'Brien RG, Cohen JA. Long term benefit of multiple sclerosis treatment: an investigation using a novel data collection technique. Mult Scler. 2012;18(11):1617-1624. doi: 10.1177/1352458512449681
45. Gold R, Kappos L, Arnold DL, Bar-Or A, Giovannoni G, Selmaj K, et al. DEFINE Study Investigators. Placebo-controlled phase 3 study of oral BG-12 for relapsing multiple sclerosis. N Engl J Med. 2012;367(12):1098-1107. doi: 10.1056/NEJMoa1114287
46. Kappos L, O'Connor P, Radue EW, Polman C, Hohlfeld R, Selmaj K, et al. Long-term effects of fingolimod in multiple sclerosis: the randomized FREEDOMS extension trial. Neurology. 2015; 84(15):1582-1591. doi: 10.1212/WNL.0000000000001462
47. Reston JT, Uhl S, Treadwell JR, Nash RA, Schoelles K. Autologous hematopoietic cell transplantation for multiple sclerosis: a systematic review. Mult. Scler. 2011; 17: 204-213.
48. Burt RK, Balabanov R, Burman J, Sharrack B, Snowden JA, Oliveira MC, et al. Effect of Nonmyeloablative Hematopoietic Stem Cell Transplantation vs Continued Disease-Modifying Therapy on Disease Progression in Patients With Relapsing-Remitting Multiple Sclerosis: A Randomized Clinical Trial. JAMA. 2019 Jan 15;321(2):165-174. doi: 10.1001/jama.2018.18743. PMID: 30644983; PMCID: PMC6439765
49. Fassas A. On the evolution of high-dose immunosuppressive therapy with autologous stem cell transplantation in multiple sclerosis. Cell Ther Transplant. 2010;2:e.000060.01. doi: 10.3205/ctt-2010-en-000060.01
50. Saccardi R, Mancardi GL, Solari A, Bosi A, Bruzzi P, Di Bartolomeo P, et al. Autologous HSCT for severe progressive multiple sclerosis in a multicenter trial: impact on disease activity and quality of life. Blood. 2005 Mar 15;105(6):2601-2607. doi: 10.1182/blood-2004-08-3205. Epub 2004 Nov 16. PMID: 15546956
51. Polushin AY, Zalyalov YR, Vinokurova AN, Skiba IB, Estrina MA, Kulagin AD, et al. Effectiveness of high-dose immunosuppressive therapy with subsequent autologous hematopoietic stem cell transplantation in progressive types of multiple sclerosis: the experience of the R.M. Gorbacheva Research Institute of Hematology and Transfusiology. Russian journal of Hematology and Transfusiology (Gematologiya i Transfusiologiya). 2020; 65(1):202. (In Russian).
52. Fassas A, Kimiskidis VK, Sakellari I, Kapinas K, Anagnostopoulos A, Tsimourtou V, et al. Long-term results of stem cell transplantation for MS: a single-center experience. Neurology. 2011;76(12):1066-1070. doi: 10.1212/WNL.0b013e318211c537
53. Cull G, Hall D, Fabis-Pedrini MJ, Carroll WM, Fors-ter L, Robins F, et al. Lymphocyte reconstitution following autologous stem cell transplantation for progressive MS. Mult Scler J Exp Transl Clin. 2017; 3(1):2055217317700167. doi: 10.1177/2055217317700167
54. Roxburgh RH, Seaman SR, Masterman T, Hensiek AE, Sawcer SJ, Vukusic S, et al. Multiple Sclerosis Severity Score: using disability and disease duration to rate disease severity. Neurology. 2005;64(7):1144-1151. doi: 10.1212/01.WNL.0000156155.19270.F8
55. Kirgizov KI, Skorobogatova EV, Bembeeva RT, Volkova EY, Bologov AA, Pilia SV, Maschan AA, Rumyantsev AG. Autologous hematopoietic stem cell transplantation in children with severe refractory forms of multiple sclerosis. Current Pediatrics. 2013;12(1):149-152. (In Russian). doi: 10.15690/vsp.v12i1.572
56. Gratwohl A, Passweg J, Bocelli-Tyndall C, Fassas A, van Laar JM, Farge D, et al. Autoimmune Diseases Working Party of the European Group for Blood and Marrow Transplantation (EBMT). Autologous hematopoietic stem cell transplantation for autoimmune diseases. Bone Marrow Transplant. 2005; 35(9):869-879. doi: 10.1038/sj.bmt.1704892
57. Arruda LCM, de Azevedo JTC, de Oliveira GLV, Scortegagna GT, Rodrigues ES, Palma PVB, et al. Immunological correlates of favorable long-term clinical outcome in multiple sclerosis patients after autologous hematopoietic stem cell transplantation. Clin Immunol. 2016;169:47-57. doi: 10.1016/j.clim.2016.06.005
58. Comi G, Kappos L, Clanet M, Ebers G, Fassas A, Fazekas F, et al. Guidelines for autologous blood and marrow stem cell transplantation in multiple sclerosis: a consensus report written on behalf of the European Group for Blood and Marrow Transplantation and the European Charcot Foundation. BMT-MS Study Group. J Neurol. 2000;247(5):376-382.
    doi: 10.1007/s004150050605
59. Afanasyeva KS, Barabanshchikova MV, Bondarenko SN, Bykova TA, Vlasova YY, Gevorgian AG, Golubovskaya IK, et al. Indications for hematopoietic stem cell transplantation. 2nd Edition. Based on EBMT Recommendations of 2019. 2019; 8(4). Cell Ther Transplant 8(4):101-145. doi: 10.18620/ctt-1866-8836-2019-8-4-101-145
60. Duarte RF, Labopin M, Bader P, Basak GW, Bonini C, Chabannon C, et al. European Society for Blood and Marrow Transplantation (EBMT). Indications for haematopoietic stem cell transplantation for haematological diseases, solid tumours and immune disorders: current practice in Europe, 2019. Bone Marrow Transplant. 2019; 54(10):1525-1552. doi: 10.1038/s41409-019-0516-2
61. Cohen JA, Baldassari LE, Atkins HL, Bowen JD, Bredeson C, Carpenter PA, et al. Autologous hematopoietic cell transplantation for treatment-refractory relapsing multiple sclerosis: position statement from the American Society for Blood and Marrow Transplantation. Biol Blood Marrow Transplant. 2019;25:845-854. doi: 10.1016/j.bbmt.2019.02.014

" ["DETAIL_TEXT_TYPE"]=> string(4) "html" ["~DETAIL_TEXT_TYPE"]=> string(4) "html" ["PREVIEW_TEXT"]=> string(0) "" ["~PREVIEW_TEXT"]=> string(0) "" ["PREVIEW_TEXT_TYPE"]=> string(4) "text" ["~PREVIEW_TEXT_TYPE"]=> string(4) "text" ["PREVIEW_PICTURE"]=> NULL ["~PREVIEW_PICTURE"]=> NULL ["LANG_DIR"]=> string(4) "/ru/" ["~LANG_DIR"]=> string(4) "/ru/" ["SORT"]=> string(2) "10" ["~SORT"]=> string(2) "10" ["CODE"]=> string(100) "vysokodoznaya-immunosupressivnaya-terapiya-s-autologichnoy-transplantatsiey-gemopoeticheskikh-stvolo" ["~CODE"]=> string(100) "vysokodoznaya-immunosupressivnaya-terapiya-s-autologichnoy-transplantatsiey-gemopoeticheskikh-stvolo" ["EXTERNAL_ID"]=> string(4) "2057" ["~EXTERNAL_ID"]=> string(4) "2057" ["IBLOCK_TYPE_ID"]=> string(7) "journal" ["~IBLOCK_TYPE_ID"]=> string(7) "journal" ["IBLOCK_CODE"]=> string(7) "volumes" ["~IBLOCK_CODE"]=> string(7) "volumes" ["IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["~IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["LID"]=> string(2) "s2" ["~LID"]=> string(2) "s2" ["EDIT_LINK"]=> NULL ["DELETE_LINK"]=> NULL ["DISPLAY_ACTIVE_FROM"]=> string(0) "" ["IPROPERTY_VALUES"]=> array(18) { ["ELEMENT_META_TITLE"]=> string(302) "Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток при рассеянном склерозе: современный взгляд на проблему" ["ELEMENT_META_KEYWORDS"]=> string(0) "" ["ELEMENT_META_DESCRIPTION"]=> string(431) "Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток при рассеянном склерозе: современный взгляд на проблемуHigh-dose immunosuppressive therapy with autologous hematopoietic stem cells transplantation for multiple sclerosis: Current view" ["ELEMENT_PREVIEW_PICTURE_FILE_ALT"]=> string(2005) "<p style="text-align: justify;"> Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток (ВИСТ-АТГСК) является перспективным и эффективным методом лечения аутоиммунных заболеваний, включая рассеянный склероз. За последние 15-20 лет уменьшились частота и тяжесть нежелательных явлений при ВИСТ-ТГСК, что было достигнуто при помощи снижения интенсивности режимов кондиционирования. Также привели к улучшению результатов более глубокое понимание иммунологических механизмов восстановления иммунитета и смена тактики отбора пациентов на процедуру. Учитывая возросшую заболеваемость рассеянным склерозом во всем мире, а также недостаточную эффективность стандартной терапии, введение аутологичной трансплантации в клинические рекомендации по лечению рассеянного склероза могло бы сохранить качество жизни молодым пациентам.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;"> Рассеянный склероз, мобилизация, аферез, высокодозная иммуносупрессивная терапия, гемопоэтические стволовые клетки, трансплантация, иммунотерапия. </>" ["ELEMENT_PREVIEW_PICTURE_FILE_TITLE"]=> string(302) "Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток при рассеянном склерозе: современный взгляд на проблему" ["ELEMENT_DETAIL_PICTURE_FILE_ALT"]=> string(302) "Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток при рассеянном склерозе: современный взгляд на проблему" ["ELEMENT_DETAIL_PICTURE_FILE_TITLE"]=> string(302) "Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток при рассеянном склерозе: современный взгляд на проблему" ["SECTION_META_TITLE"]=> string(302) "Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток при рассеянном склерозе: современный взгляд на проблему" ["SECTION_META_KEYWORDS"]=> string(302) "Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток при рассеянном склерозе: современный взгляд на проблему" ["SECTION_META_DESCRIPTION"]=> string(302) "Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток при рассеянном склерозе: современный взгляд на проблему" ["SECTION_PICTURE_FILE_ALT"]=> string(302) "Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток при рассеянном склерозе: современный взгляд на проблему" ["SECTION_PICTURE_FILE_TITLE"]=> string(302) "Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток при рассеянном склерозе: современный взгляд на проблему" ["SECTION_PICTURE_FILE_NAME"]=> string(100) "vysokodoznaya-immunosupressivnaya-terapiya-s-autologichnoy-transplantatsiey-gemopoeticheskikh-stvolo" ["SECTION_DETAIL_PICTURE_FILE_ALT"]=> string(302) "Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток при рассеянном склерозе: современный взгляд на проблему" ["SECTION_DETAIL_PICTURE_FILE_TITLE"]=> string(302) "Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток при рассеянном склерозе: современный взгляд на проблему" ["SECTION_DETAIL_PICTURE_FILE_NAME"]=> string(100) "vysokodoznaya-immunosupressivnaya-terapiya-s-autologichnoy-transplantatsiey-gemopoeticheskikh-stvolo" ["ELEMENT_PREVIEW_PICTURE_FILE_NAME"]=> string(100) "vysokodoznaya-immunosupressivnaya-terapiya-s-autologichnoy-transplantatsiey-gemopoeticheskikh-stvolo" ["ELEMENT_DETAIL_PICTURE_FILE_NAME"]=> string(100) "vysokodoznaya-immunosupressivnaya-terapiya-s-autologichnoy-transplantatsiey-gemopoeticheskikh-stvolo" } ["FIELDS"]=> array(1) { ["IBLOCK_SECTION_ID"]=> string(3) "211" } ["PROPERTIES"]=> array(18) { ["KEYWORDS"]=> array(36) { ["ID"]=> string(2) "19" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:46:01" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(27) "Ключевые слова" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "KEYWORDS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "19" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "4" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "Y" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "Y" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(27) "Ключевые слова" ["~DEFAULT_VALUE"]=> string(0) "" } ["SUBMITTED"]=> array(36) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28590" ["VALUE"]=> string(22) "05/14/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "05/14/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL } ["ACCEPTED"]=> array(36) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28591" ["VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL } ["PUBLISHED"]=> array(36) { ["ID"]=> string(2) "22" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Дата публикации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "PUBLISHED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "22" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Дата публикации" ["~DEFAULT_VALUE"]=> NULL } ["CONTACT"]=> array(36) { ["ID"]=> string(2) "23" ["TIMESTAMP_X"]=> string(19) "2015-09-03 14:43:05" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(14) "Контакт" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "CONTACT" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "23" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(14) "Контакт" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHORS"]=> array(36) { ["ID"]=> string(2) "24" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:45:07" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "AUTHORS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "24" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_RU"]=> array(36) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28592" ["VALUE"]=> array(2) { ["TEXT"]=> string(233) "<p>Алексей Ю. Полушин, Евгения И. Лопатина, Юрий Р. Залялов, Александр А. Цынченко, Наталья А. Тотолян, Александр Д. Кулагин</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(221) "

Алексей Ю. Полушин, Евгения И. Лопатина, Юрий Р. Залялов, Александр А. Цынченко, Наталья А. Тотолян, Александр Д. Кулагин

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_RU"]=> array(36) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28593" ["VALUE"]=> array(2) { ["TEXT"]=> string(234) "<p>Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(222) "

Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_RU"]=> array(36) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28594" ["VALUE"]=> array(2) { ["TEXT"]=> string(2005) "<p style="text-align: justify;"> Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток (ВИСТ-АТГСК) является перспективным и эффективным методом лечения аутоиммунных заболеваний, включая рассеянный склероз. За последние 15-20 лет уменьшились частота и тяжесть нежелательных явлений при ВИСТ-ТГСК, что было достигнуто при помощи снижения интенсивности режимов кондиционирования. Также привели к улучшению результатов более глубокое понимание иммунологических механизмов восстановления иммунитета и смена тактики отбора пациентов на процедуру. Учитывая возросшую заболеваемость рассеянным склерозом во всем мире, а также недостаточную эффективность стандартной терапии, введение аутологичной трансплантации в клинические рекомендации по лечению рассеянного склероза могло бы сохранить качество жизни молодым пациентам.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;"> Рассеянный склероз, мобилизация, аферез, высокодозная иммуносупрессивная терапия, гемопоэтические стволовые клетки, трансплантация, иммунотерапия. </>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1949) "

Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток (ВИСТ-АТГСК) является перспективным и эффективным методом лечения аутоиммунных заболеваний, включая рассеянный склероз. За последние 15-20 лет уменьшились частота и тяжесть нежелательных явлений при ВИСТ-ТГСК, что было достигнуто при помощи снижения интенсивности режимов кондиционирования. Также привели к улучшению результатов более глубокое понимание иммунологических механизмов восстановления иммунитета и смена тактики отбора пациентов на процедуру. Учитывая возросшую заболеваемость рассеянным склерозом во всем мире, а также недостаточную эффективность стандартной терапии, введение аутологичной трансплантации в клинические рекомендации по лечению рассеянного склероза могло бы сохранить качество жизни молодым пациентам.

Ключевые слова

Рассеянный склероз, мобилизация, аферез, высокодозная иммуносупрессивная терапия, гемопоэтические стволовые клетки, трансплантация, иммунотерапия. " ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["DOI"]=> array(36) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28595" ["VALUE"]=> string(37) "10.18620/ctt-1866-8836-2022-11-2-6-15" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(37) "10.18620/ctt-1866-8836-2022-11-2-6-15" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_EN"]=> array(36) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28598" ["VALUE"]=> array(2) { ["TEXT"]=> string(147) "<p>Alexey Yu. Polushin, Evgeniya I. Lopatina, Yury R. Zalyalov, Alexander A. Tsynchenko, Natalia A. Totolyan, Alexander D. Kulagin</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(135) "

Alexey Yu. Polushin, Evgeniya I. Lopatina, Yury R. Zalyalov, Alexander A. Tsynchenko, Natalia A. Totolyan, Alexander D. Kulagin

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_EN"]=> array(36) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28599" ["VALUE"]=> array(2) { ["TEXT"]=> string(587) "<p>Pavlov University, St. Petersburg, Russia</p><br> <p><b>Correspondence:</b><br>Dr. Alexey Yu. Polushin, Pavlov University, 6-8 L. Tolstoy St., 197022, St. Petersburg, Russia<br> Phone: +7 (911) 816-75-59<br> E-mail: alexpolushin@yandex.ru </p><br> <p><b>Citation:</b> Polushin AY, Lopatina EI, Zalyalov YR, et al. High-dose immunosuppressive therapy with autologous hematopoietic stem cells transplantation for multiple sclerosis: Current view. Cell Ther Transplant 2022; 11(2): 6-15.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(497) "

Pavlov University, St. Petersburg, Russia

Correspondence:
Dr. Alexey Yu. Polushin, Pavlov University, 6-8 L. Tolstoy St., 197022, St. Petersburg, Russia
Phone: +7 (911) 816-75-59
E-mail: alexpolushin@yandex.ru

Citation: Polushin AY, Lopatina EI, Zalyalov YR, et al. High-dose immunosuppressive therapy with autologous hematopoietic stem cells transplantation for multiple sclerosis: Current view. Cell Ther Transplant 2022; 11(2): 6-15.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_EN"]=> array(36) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28600" ["VALUE"]=> array(2) { ["TEXT"]=> string(1114) "<p style="text-align: justify;">Autologous hematopoietic stem cells transplantation (aHSCT) followed by high-dose immunosuppressive therapy is a promising and effective method of treating autoimmune diseases, including multiple sclerosis (MS). Over the past 15-20 years, frequency and severity of adverse events in aHSCT were decreased after reducing the intensity of conditioning regimens. Both better understanding of the immunological mechanisms of immune reconstitution and better approach to the selection of patients for this procedure also led to improved results. In view of increased incidence of multiple sclerosis worldwide, as well as insufficient effectiveness of standard therapy, the introduction of autologous transplantation into clinical guidelines for the MS treatment could maintain quality of life in the workforce population.</p> <h2>Keywords</h2> <p style="text-align: justify;">Multiple sclerosis, mobilization, apheresis, high-dose immunosuppressive therapy, autologous hematopoietic stem cells, transplantation, immunotherapy.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1058) "

Autologous hematopoietic stem cells transplantation (aHSCT) followed by high-dose immunosuppressive therapy is a promising and effective method of treating autoimmune diseases, including multiple sclerosis (MS). Over the past 15-20 years, frequency and severity of adverse events in aHSCT were decreased after reducing the intensity of conditioning regimens. Both better understanding of the immunological mechanisms of immune reconstitution and better approach to the selection of patients for this procedure also led to improved results. In view of increased incidence of multiple sclerosis worldwide, as well as insufficient effectiveness of standard therapy, the introduction of autologous transplantation into clinical guidelines for the MS treatment could maintain quality of life in the workforce population.

Keywords

Multiple sclerosis, mobilization, apheresis, high-dose immunosuppressive therapy, autologous hematopoietic stem cells, transplantation, immunotherapy.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["NAME_EN"]=> array(36) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28596" ["VALUE"]=> string(129) "High-dose immunosuppressive therapy with autologous hematopoietic stem cells transplantation for multiple sclerosis: Current view" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(129) "High-dose immunosuppressive therapy with autologous hematopoietic stem cells transplantation for multiple sclerosis: Current view" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" } ["FULL_TEXT_RU"]=> array(36) { ["ID"]=> string(2) "42" ["TIMESTAMP_X"]=> string(19) "2015-09-07 20:29:18" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(23) "Полный текст" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(12) "FULL_TEXT_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "42" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(23) "Полный текст" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["PDF_RU"]=> array(36) { ["ID"]=> string(2) "43" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF RUS" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_RU" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "43" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28597" ["VALUE"]=> string(4) "2817" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2817" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF RUS" ["~DEFAULT_VALUE"]=> string(0) "" } ["PDF_EN"]=> array(36) { ["ID"]=> string(2) "44" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF ENG" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "44" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28601" ["VALUE"]=> string(4) "2819" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2819" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF ENG" ["~DEFAULT_VALUE"]=> string(0) "" } ["NAME_LONG"]=> array(36) { ["ID"]=> string(2) "45" ["TIMESTAMP_X"]=> string(19) "2023-04-13 00:55:00" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(72) "Название (для очень длинных заголовков)" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "NAME_LONG" ["DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "45" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(80) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(72) "Название (для очень длинных заголовков)" ["~DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } } } ["DISPLAY_PROPERTIES"]=> array(10) { ["AUTHOR_EN"]=> array(37) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28598" ["VALUE"]=> array(2) { ["TEXT"]=> string(147) "<p>Alexey Yu. Polushin, Evgeniya I. Lopatina, Yury R. Zalyalov, Alexander A. Tsynchenko, Natalia A. Totolyan, Alexander D. Kulagin</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(135) "

Alexey Yu. Polushin, Evgeniya I. Lopatina, Yury R. Zalyalov, Alexander A. Tsynchenko, Natalia A. Totolyan, Alexander D. Kulagin

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(135) "

Alexey Yu. Polushin, Evgeniya I. Lopatina, Yury R. Zalyalov, Alexander A. Tsynchenko, Natalia A. Totolyan, Alexander D. Kulagin

" } ["SUMMARY_EN"]=> array(37) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28600" ["VALUE"]=> array(2) { ["TEXT"]=> string(1114) "<p style="text-align: justify;">Autologous hematopoietic stem cells transplantation (aHSCT) followed by high-dose immunosuppressive therapy is a promising and effective method of treating autoimmune diseases, including multiple sclerosis (MS). Over the past 15-20 years, frequency and severity of adverse events in aHSCT were decreased after reducing the intensity of conditioning regimens. Both better understanding of the immunological mechanisms of immune reconstitution and better approach to the selection of patients for this procedure also led to improved results. In view of increased incidence of multiple sclerosis worldwide, as well as insufficient effectiveness of standard therapy, the introduction of autologous transplantation into clinical guidelines for the MS treatment could maintain quality of life in the workforce population.</p> <h2>Keywords</h2> <p style="text-align: justify;">Multiple sclerosis, mobilization, apheresis, high-dose immunosuppressive therapy, autologous hematopoietic stem cells, transplantation, immunotherapy.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1058) "

Autologous hematopoietic stem cells transplantation (aHSCT) followed by high-dose immunosuppressive therapy is a promising and effective method of treating autoimmune diseases, including multiple sclerosis (MS). Over the past 15-20 years, frequency and severity of adverse events in aHSCT were decreased after reducing the intensity of conditioning regimens. Both better understanding of the immunological mechanisms of immune reconstitution and better approach to the selection of patients for this procedure also led to improved results. In view of increased incidence of multiple sclerosis worldwide, as well as insufficient effectiveness of standard therapy, the introduction of autologous transplantation into clinical guidelines for the MS treatment could maintain quality of life in the workforce population.

Keywords

Multiple sclerosis, mobilization, apheresis, high-dose immunosuppressive therapy, autologous hematopoietic stem cells, transplantation, immunotherapy.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(1058) "

Autologous hematopoietic stem cells transplantation (aHSCT) followed by high-dose immunosuppressive therapy is a promising and effective method of treating autoimmune diseases, including multiple sclerosis (MS). Over the past 15-20 years, frequency and severity of adverse events in aHSCT were decreased after reducing the intensity of conditioning regimens. Both better understanding of the immunological mechanisms of immune reconstitution and better approach to the selection of patients for this procedure also led to improved results. In view of increased incidence of multiple sclerosis worldwide, as well as insufficient effectiveness of standard therapy, the introduction of autologous transplantation into clinical guidelines for the MS treatment could maintain quality of life in the workforce population.

Keywords

Multiple sclerosis, mobilization, apheresis, high-dose immunosuppressive therapy, autologous hematopoietic stem cells, transplantation, immunotherapy.

" } ["DOI"]=> array(37) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28595" ["VALUE"]=> string(37) "10.18620/ctt-1866-8836-2022-11-2-6-15" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(37) "10.18620/ctt-1866-8836-2022-11-2-6-15" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(37) "10.18620/ctt-1866-8836-2022-11-2-6-15" } ["NAME_EN"]=> array(37) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28596" ["VALUE"]=> string(129) "High-dose immunosuppressive therapy with autologous hematopoietic stem cells transplantation for multiple sclerosis: Current view" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(129) "High-dose immunosuppressive therapy with autologous hematopoietic stem cells transplantation for multiple sclerosis: Current view" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(129) "High-dose immunosuppressive therapy with autologous hematopoietic stem cells transplantation for multiple sclerosis: Current view" } ["ORGANIZATION_EN"]=> array(37) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28599" ["VALUE"]=> array(2) { ["TEXT"]=> string(587) "<p>Pavlov University, St. Petersburg, Russia</p><br> <p><b>Correspondence:</b><br>Dr. Alexey Yu. Polushin, Pavlov University, 6-8 L. Tolstoy St., 197022, St. Petersburg, Russia<br> Phone: +7 (911) 816-75-59<br> E-mail: alexpolushin@yandex.ru </p><br> <p><b>Citation:</b> Polushin AY, Lopatina EI, Zalyalov YR, et al. High-dose immunosuppressive therapy with autologous hematopoietic stem cells transplantation for multiple sclerosis: Current view. Cell Ther Transplant 2022; 11(2): 6-15.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(497) "

Pavlov University, St. Petersburg, Russia

Correspondence:
Dr. Alexey Yu. Polushin, Pavlov University, 6-8 L. Tolstoy St., 197022, St. Petersburg, Russia
Phone: +7 (911) 816-75-59
E-mail: alexpolushin@yandex.ru

Citation: Polushin AY, Lopatina EI, Zalyalov YR, et al. High-dose immunosuppressive therapy with autologous hematopoietic stem cells transplantation for multiple sclerosis: Current view. Cell Ther Transplant 2022; 11(2): 6-15.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(497) "

Pavlov University, St. Petersburg, Russia

Correspondence:
Dr. Alexey Yu. Polushin, Pavlov University, 6-8 L. Tolstoy St., 197022, St. Petersburg, Russia
Phone: +7 (911) 816-75-59
E-mail: alexpolushin@yandex.ru

Citation: Polushin AY, Lopatina EI, Zalyalov YR, et al. High-dose immunosuppressive therapy with autologous hematopoietic stem cells transplantation for multiple sclerosis: Current view. Cell Ther Transplant 2022; 11(2): 6-15.

" } ["AUTHOR_RU"]=> array(37) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28592" ["VALUE"]=> array(2) { ["TEXT"]=> string(233) "<p>Алексей Ю. Полушин, Евгения И. Лопатина, Юрий Р. Залялов, Александр А. Цынченко, Наталья А. Тотолян, Александр Д. Кулагин</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(221) "

Алексей Ю. Полушин, Евгения И. Лопатина, Юрий Р. Залялов, Александр А. Цынченко, Наталья А. Тотолян, Александр Д. Кулагин

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(221) "

Алексей Ю. Полушин, Евгения И. Лопатина, Юрий Р. Залялов, Александр А. Цынченко, Наталья А. Тотолян, Александр Д. Кулагин

" } ["SUBMITTED"]=> array(37) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28590" ["VALUE"]=> string(22) "05/14/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "05/14/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "05/14/2022 12:00:00 am" } ["ACCEPTED"]=> array(37) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28591" ["VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "07/05/2022 12:00:00 am" } ["SUMMARY_RU"]=> array(37) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28594" ["VALUE"]=> array(2) { ["TEXT"]=> string(2005) "<p style="text-align: justify;"> Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток (ВИСТ-АТГСК) является перспективным и эффективным методом лечения аутоиммунных заболеваний, включая рассеянный склероз. За последние 15-20 лет уменьшились частота и тяжесть нежелательных явлений при ВИСТ-ТГСК, что было достигнуто при помощи снижения интенсивности режимов кондиционирования. Также привели к улучшению результатов более глубокое понимание иммунологических механизмов восстановления иммунитета и смена тактики отбора пациентов на процедуру. Учитывая возросшую заболеваемость рассеянным склерозом во всем мире, а также недостаточную эффективность стандартной терапии, введение аутологичной трансплантации в клинические рекомендации по лечению рассеянного склероза могло бы сохранить качество жизни молодым пациентам.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;"> Рассеянный склероз, мобилизация, аферез, высокодозная иммуносупрессивная терапия, гемопоэтические стволовые клетки, трансплантация, иммунотерапия. </>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1949) "

Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток (ВИСТ-АТГСК) является перспективным и эффективным методом лечения аутоиммунных заболеваний, включая рассеянный склероз. За последние 15-20 лет уменьшились частота и тяжесть нежелательных явлений при ВИСТ-ТГСК, что было достигнуто при помощи снижения интенсивности режимов кондиционирования. Также привели к улучшению результатов более глубокое понимание иммунологических механизмов восстановления иммунитета и смена тактики отбора пациентов на процедуру. Учитывая возросшую заболеваемость рассеянным склерозом во всем мире, а также недостаточную эффективность стандартной терапии, введение аутологичной трансплантации в клинические рекомендации по лечению рассеянного склероза могло бы сохранить качество жизни молодым пациентам.

Ключевые слова

Рассеянный склероз, мобилизация, аферез, высокодозная иммуносупрессивная терапия, гемопоэтические стволовые клетки, трансплантация, иммунотерапия. " ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(1949) "

Высокодозная иммуносупрессивная терапия с аутологичной трансплантацией гемопоэтических стволовых клеток (ВИСТ-АТГСК) является перспективным и эффективным методом лечения аутоиммунных заболеваний, включая рассеянный склероз. За последние 15-20 лет уменьшились частота и тяжесть нежелательных явлений при ВИСТ-ТГСК, что было достигнуто при помощи снижения интенсивности режимов кондиционирования. Также привели к улучшению результатов более глубокое понимание иммунологических механизмов восстановления иммунитета и смена тактики отбора пациентов на процедуру. Учитывая возросшую заболеваемость рассеянным склерозом во всем мире, а также недостаточную эффективность стандартной терапии, введение аутологичной трансплантации в клинические рекомендации по лечению рассеянного склероза могло бы сохранить качество жизни молодым пациентам.

Ключевые слова

Рассеянный склероз, мобилизация, аферез, высокодозная иммуносупрессивная терапия, гемопоэтические стволовые клетки, трансплантация, иммунотерапия. " } ["ORGANIZATION_RU"]=> array(37) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28593" ["VALUE"]=> array(2) { ["TEXT"]=> string(234) "<p>Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(222) "

Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(222) "

Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия

" } } } [2]=> array(49) { ["IBLOCK_SECTION_ID"]=> string(3) "212" ["~IBLOCK_SECTION_ID"]=> string(3) "212" ["ID"]=> string(4) "2059" ["~ID"]=> string(4) "2059" ["IBLOCK_ID"]=> string(1) "2" ["~IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(317) "Комбинированная адоптивная иммунотерапия с применением блинатумомаба и инфузий донорских лимфоцитов у детей с рецидивирующим/ рефрактерным течением В-ОЛЛ после алло-ТГСК" ["~NAME"]=> string(317) "Комбинированная адоптивная иммунотерапия с применением блинатумомаба и инфузий донорских лимфоцитов у детей с рецидивирующим/ рефрактерным течением В-ОЛЛ после алло-ТГСК" ["ACTIVE_FROM"]=> NULL ["~ACTIVE_FROM"]=> NULL ["TIMESTAMP_X"]=> string(22) "08/09/2022 12:14:58 pm" ["~TIMESTAMP_X"]=> string(22) "08/09/2022 12:14:58 pm" ["DETAIL_PAGE_URL"]=> string(148) "/en/archive/tom-11-nomer-2/klinicheskie-raboty/kombinirovannaya-adoptivnaya-immunoterapiya-s-primeneniem-blinatumomaba-i-infuziy-donorskikh-limfots/" ["~DETAIL_PAGE_URL"]=> string(148) "/en/archive/tom-11-nomer-2/klinicheskie-raboty/kombinirovannaya-adoptivnaya-immunoterapiya-s-primeneniem-blinatumomaba-i-infuziy-donorskikh-limfots/" ["LIST_PAGE_URL"]=> string(12) "/en/archive/" ["~LIST_PAGE_URL"]=> string(12) "/en/archive/" ["DETAIL_TEXT"]=> string(27544) "

Introduction

Acute lymphoblastic leukemia (ALL) is one of the most spread pediatric cancers. With improvements of protocols for new diagnosed ALL nowadays 5-year survival achieves approximately 80-90% for these children [1]. However, patients with primary chemoresistance disease or relapse have a dismal prognosis with 5-year OS in first relapse of about 50% [2]. Allogeneic hematopoietic stem cells transplantation (allo-HSCT) has become a standard treatment for high-risk pediatric ALL. Many conditions affect the results of allo-HSCT: age, HLA-incompatibility between the donor and recipient, conditioning regimens, status of disease at the moment of allo-HSCT, persistence of minimal residual disease (MRD) and other [3]. Incidence of relapse after allo-HSCT reaches 70% in patients without remission at the moment of allo-HSCT compare with patients having remission (up to 35% of relapses). Patients with clinic of acute or chronic GVHD have a benefit in OS due to proceeding graft-versus-leukemia reaction [4, 5]. Patients with relapsed/refractory (r/r) disease after allo-HSCT have a poor prognosis with 3-year probability OS about 20% using different salvage option [6]. There are no standard recommendations for this group of patients. Clinical approaches include cytoreductive chemotherapy, target drugs, donor lymphocyte infusion (DLI), CAR-T cells, monoclonal antibody or palliative care. Treatment choices are individualized and depend on somatic status of patients, time of relapse, type of relapse and immune response.

Because most ALL cells in relapse have chemoresistance and get ability to escape the immune-suppressive tumor response conventional chemo-drug induce very short remission and not effective in long time survival.

DLI is a form of adoptive immunotherapy, which mechanism of action based on induction of graft-versus-leukemia (GVL) effect. Patients with ALL in general are less sensitive for immunotherapy, than AML patients, and other reasons of weak response to DLI is immune resistance by immune checkpoint expression, tumor microenvironment or loss of recipient-specific HLA genes [7, 8].

However, the study Nicole Liberio et al. [9] showed, that DLIs could promote durable survival after allo-HSCT in childhood ALL cohort. Moreover, the results of DLI as a therapy for relapsed acute leukemia may be shown comparable to second allo-HSCT [10].

Blinatumomab is a bispecific T-cell engager (BiTE) with two different single-chain Fv fragments binding T-cell CD3 and B-cell CD19 antigens. According to previous studies, blinatumomab has been demonstrated high efficacy in pediatric r/r B-ALL with a good tolerable safety profile. Response rate may reach 90% depending on tumor burden with a long median relapse-free survival (RFS) [11]. Low toxicity allows using this drug after allo-HSCT with comparable results [12, 13].

In study Hengwei Wu et al., [14] blinatumomab showed efficacy in patients undergoing HLA loss relapse after haplo-HSCT. Supposed, that blinatumomab may restore GVL effect.

So, we expect blinatumomab may not only reduce tumor cells, but also make stronger immune pressure for action of DLI.

Here we present first single-center experience of using immunotherapy with Blinatumomab and DLI in 17 children with refractory/relapsed (r/r) CD19+ B-ALL after allo-HSCT.

Patients and methods

We enrolled in this prospective study 17 B-ALL patients with the median age 10 years (8 months-18 years), who were treated by immunotherapy with Blinatumomab and DLI after allo- HSCT. Among them 3 patients (18%) had infant ALL with rearrangement KMT2A. All patients underwent allo-HSCT at RM Gorbacheva Research Institute within a period from 2012 to 2021. Eleven patients (65%) had received a myeloablative conditioning regimen (MAC), including 8 (47%) Bu-based (12-16 mg/kg) conditioning regimen, 2 GIAC [busulfan 3 mg/kg, сyclophosphamide 100 mg/kg, lomustine 120 mg/m², cytarabine 6000 mg/m²] protocol (12%) and one Treosulfan+Fludarabin+Thiotepa followed by TCR αβ+/CD19+ cell depletion. Six patients (35%) had received a reduced-intensity conditioning regimen (RIC) Fludarabin 150mg/m² and Melphalan 140 mg/m². Most children (n=13, 76%) had haploidentical donor, three (18%) patients had matched unrelated donor and one patient had matched related donor. Sixteen (94%) were given regimen of prophylaxis GVHD with сyclophosphamide (PtCy) 50 mg/kg on D+3, D+4, one patient was given immunosuppressive therapy with Rituximab, Tocilizumab, Abatacept after transplantation with TCR αβ+/CD19+ cell depletion. Engraftment with full donor chimerism was confirmed in all analyzed patients. History of acute GVHD of skin grade II after allo-HSCT was observed in 1 (6%) child, history of chronic GVHD of skin mild grade – in 2 children (12%). Disease status before starting of blinatumomab was post-transplant bone marrow relapse in 11 (65%) patients, MRD in 6 (35%) patients. Extramedullary lesions before blinatumomab therapy were observed in 4 patients (24%): 3 patients with involvement of central neural system (CNS) and 1 patient with testicular involvement. Early bone marrow relapse/MRD >10^-4 leukemic blasts of leukemia (up to one year after allo-HSCT) developed in 9 patients (53%). BM relapse occurred up to D+100 in 6 (35%) patients. Five patients (29%) with relapse of the disease had received salvage fludarabine-containing chemotherapy before treatment with blinatumomab. Four patients (24%) had response as blast cell reduction after salvage chemotherapy. Patients with MRD had full donor chimerism before starting blinatumomab and DLI, among patients with relapse 10/11 had chimerism more 50%.

Primary endpoints of the study were overall response rate, relapse-free survival (RFS), overall survival (OS). Overall response included morphologic CR (<5% blasts) and MRD response (<10^-4 leukemic blasts by flow cytometry or polymerase chain reaction) within the first 2 cycles of treatment with blinatumomab and DLI. RFS and OS was calculated from the start of blinatumomab treatment to time of relapse, death, consequently.

Relapse was determined as bone marrow recurrence of disease or extramedullary lesions. Secondary endpoints included frequency of induced acute and chronic GVHD after immunotherapy, grade 3 or higher treatment-related adverse events by NCI CTCAE 5.0, duration of bone marrow response (DOR). DOR was defined as time from initial response to bone marrow relapse, death. Patients alive were censored on the last documented visit date or last contact date.

Relapse-free survival and overall survival are described with Kaplan-Meier with 95% CI estimates. Statistical analysis was performed using IBM SPSS Statistics v 26 and Free statistical software: EZR (Easy R).

Table 1. Demographic Data and Baseline Disease Characteristics (n=17)

Results

Median time from allo-HSCT to blinatumomab therapy was 12 months (range, 2 months – 43 months). Blinatumomab (5-15 µg/m² per day) was administered as a 4-week induction cycle. Patients received up to 3 courses of blinatumomab with the median 1 course. First DLI was mostly given after starting blinatumomab course 1 (ranged from course 1 to course 2) on median day 32 therapy (1-123). Seven patients got first dose of DLI at the moment blinatumomab administration, 3 patients – in several days after finishing blinatumomab administration and seven patients – in 1-3 months after finishing blinatumomab at CR. Total, from 1 to 4 DLI were performed at follow up, doses varied between 1×10⁵ and 6×10⁷ CD3+/kg. Summary median dose of DLI during the combined therapy was 1.7×10⁶ CD3+/kg (range, 1×10⁵-6×10⁷).

Efficacy

The median overall survival for all patients was not reached at a median follow-up of 13.3 months (95% CI, 8.8 to 27.4 months); four (24%) died from progression of leukemia. The Kaplan-Meier estimate overall survival was 76.5% (95% CI, 44%-92%) at a median follow-up time (Fig. 1).

Fifteen (88%) of patients achieved a CR within the first 2 cycles of treatment with blinatumomab +DLI, among them 14 (82%) had MRD negative CR. Median duration of bone marrow response was 7 months (range, 1 to 55.0 months). The median relapse-free survival was 9.1 months (95% CI, 3.0 to 37.2 months) in patients who achieved CR, with the median duration follow up 13,3 months (95% CI, 10.0 to 30.3 months); 10 (67%) patients relapsed, including bone marrow relapse in 4 patients (27%), combined (BM+CNS/bones/parenchymal organs) in 3 (18%) and isolated extramedullary relapse (СNS in 2 and soft tissues in 1) in three (18%) patients (Fig. 2). One patient underwent successful subsequent allo-HSCT after relapse and still alive in MRD negative CR.

Safety

Three children (18%) experienced drug-related adverse events grade 3. One patient had seizure and required transient blinatumomab discontinuation, 1 patient had generalized cytomegalovirus (CMV) infection with involvement of blood, lung and urinary tract, 2 patients had infectious enterocolitis grade 3 (Clostridia, Serratia spp., CMV). There were no observed cytokine release events, grade 4 or fatal reactions.

There were no fatal acute and chronic GVHD after therapy by blinatumomab and DLI. But, one patient (6%) experienced induced acute GVHD of skin and gastrointestinal tract grade 3 after combined immunotherapy. Three children (18%) had chronic GVHD. One patient had classical severe GVHD of skin, gastrointestinal tract and liver after acute GVHD grade 3. One patient had classical mild GVHD of skin and oral mucosa. One patient had "overlap" moderate GVHD of skin and eyes. One patient with history of mild chronic GVHD developed mild chronic GVHD during combined immunotherapy. GVHD was induced in one month after DLI administration in all children. Two patients with chronic GVHD (moderate and severe form) received immunosuppressive therapy (steroids, tacrolimus/sirolimus and ruxolitinib) with success control of symptoms. DLI were discontinued after development of moderate and severe chronic GVHD. Two of 3 patients with chronic GVHD remain in long term CR during 12 and 35 months with good quality of life. Clinical outcomes are shown in Table 2 and Table 3.

Table 3. Treatment details in the distinct clinical B-ALL cases

Discussion

Allo-HSCT may be a curative treatment option for high-risk ALL, however, a portion of patients become refractory or relapse after allo-HSCT with the rate between 30% and 70%. Progressive leukemia remains the main cause of mortality after allo-HSCT.

In our study we have demonstrated results of adoptive immunotherapy based on combination bispecific T cell engager (BiTE) blinatumomab and DLI for salvage group of 17 pediatric B-ALL, including 3 infant ALL with rearrangement KMT2A. This combination is promising with overall rate response (88%) both in patients with persistence MRD and bone marrow relapse. Incidence complete response was higher, than that observed in patients who receive mono-DLI (43%) [9]. It is known that tumor burden has great importance before immunotherapy, so cytoreductive chemotherapy was administered previous in 5 (29%) relapsed patients [12]. One patient with early 4^th relapse and large tumor burden didn’t receive cytoreductive therapy and progressed during immunotherapy.

We have found good short-term toxicity profile of this therapy without the necessary for complete withdrawal of therapy due to adverse events. Infectious complications grade 3, observed in 3 children, could be associated also with pretreatment and absent of full immunological reconstitution after allo-HSCT.

The most common complication after DLI is the induction of acute and chronic GVHD, which develops general in 40-50% of patients. However, the use of PtCy may reduce the risk of developing induced GVHD [15]. The occurrence of chronic GVHD after DLI is considered to be a favorable factor associated with a reduced risk of recurrence and long-term disease-free survival [16, 17, 18, 19, 20, 21].

While the most lymphocyte infusions were haploidentical, the incidence of GVHD was low (24%), that similar with early published study, where haplo-DLI was used for relapse treatment after T cell replete bone marrow transplantation with post-transplantation cyclophosphamide. [15]. Two of 3 patients with GVHD remains in long CR during 12 and 35 months.

Systematic review reported summarized data about concomitant use of blinatumomab and DLI for post-transplant relapsed CD19 positive ALL on 15 adult patients according 2 studies. Before starting blinatumomab therapy, 12 patients had post-transplant bone marrow relapse, 1 patient had an extramedullary relapse, and 2 patients had a MRD without marrow relapse. DLI was mostly given with blinatumomab during cycle 3 (ranged from cycle 2 to cycle 4). Complete remission (CR) with MRD negative status was achieved after 2 cycles of blinatumomab in 3 patients, 2 of them remained in CR for 7 and 13 months. Ten patients showed RR of 70%. One patient developed grade II aGVHD after the combination therapy, Grade 3 late-onset acute skin and gut GVHD were reported in one patient. One patient continued progression of extramedullary disease, 1 patient died to extramedullary and hematologic relapse 12 months after blinatumomab initiation [22, 23].

In our study totally 6 (35%) patients developed relapse with extramedullary involvement, 2 of them had extramedullary before immunotherapy. Five patients with extramedullary involvement are still alive after relapse, 3 of them continue the treatment.

Unfortunately, despite high response rate and a durable remission in our work relapse of disease occurred in 67% of patients. These patients need in continuation of escalated DLI with/without courses of blinatumomab should be considered to control the disease, if there are no signs of clinically significant GVHD.

Further alternative approaches to overcome immune resistance may include chimeric antigen receptor T-cell therapies, checkpoint inhibitors or undergo second allo-HSCT [24, 25, 26, 27].

In the era of immunotherapy, future challenges and goals will be based on understanding the mechanisms of immune evasion by leukemia cells for developing novel therapeutic strategies.

Conclusion

Combination adoptive immunotherapy of blinatumomab and DLI is effective and can induce long-term bone marrow remissions in some relapsed pediatric CD19+ B-ALL after allo-HSCT.

1. Blinatumomab+DLI has a low toxicity profile, low incidence of GVHD and is well tolerated even by young children after haplo-HSCT.

2. The use of immunotherapy after cytoreductive chemotherapy is preferable in patients with extensive bone marrow relapse.

3. For maintaining of durable remission responded patients are needed further treatment.

Conflict of interest

None declared.

Acknowledgments

The study was funded by a grant from Russian Science Foundation № 22-15-00491, https://rscf.ru/project/22-15-00491/

References

1. Inaba H, Mullighan CG. Pediatric acute lymphoblastic leukemia. Haematologica. 2020; 105: 2524-2539.
   doi: 10.3324/haematol.2020.247031
2. Bhojwani D, Pui CH. Relapsed childhood acute lymphoblastic leukaemia. Lancet.Oncol. 2013; 14, e205-e217.
   doi: 10.1016/S1470-2045(12)70580-6
3. Shen X, Pan J, Qi C, Feng Y, Wu H, Qian S, Lu H, et al. Impact of pre-transplantation minimal residual disease (MRD) on the outcome of Allogeneic hematopoietic stem cell transplantation for acute leukemia. Hematology. 2021; 26(1): 295-300.
   doi: 10.1080/16078454.2021.1889162
4. Bondarenko SN, Moiseev IS, Slesarchuk OA, Darskaya EI, Ekushev KA, Smirnova AG, et al. Allogeneic hematopoietic stem cell transplantation in children and adults with acute lymphoblastic leukemia. Cell Ther Transplant. 2016; 5(2):12-20.
   doi: 10.18620/1866-8836-2016-5-2-12-20
5. Semenova EV, Kozhokar PV, Paina OV, Rakhmanova ZZ, Frolova AS, Tsvetkova LA, et al. Factors affecting post-transplant relapse of acute lymphoblastic leukemia (ALL) in children according on the intensity of conditioning. Blood. 2020; 136 (Supplement 1): 26-27. doi: 10.1182/blood-2020-139466
6. Kuhlen M, Willasch AM, Dalle JH, Wachowiak J, Yaniv I, Ifversen M, et al. Outcome of relapse after allogeneic HSCT in children with ALL enrolled in the ALL-SCT 2003/2007 trial. Br J Haematol. 2018; 180(1): 82-89, https://doi.org/10.1111/bjh.14965
7. Arnold PY. Review: HLA loss and detection in the setting of relapse from HLA-mismatched hematopoietic cell transplant, Human Immunol. 2022. doi: 10.1016/j.humimm.2022.03.001
8. Jiménez-Morales S, Aranda-Uribe IS, Pérez-Amado CJ, Ramírez-Bello J, Hidalgo-Miranda A. Mechanisms of immunosuppressive tumor evasion: focus on acute lymphoblastic leukemia, Front Immunol. 2021; 12. doi: 10.3389/fimmu.2021.737340
9. Liberio N, Robinson H, Nugent M, Simpson P, Margolis DA, Malarkannan S, et al. Single-center experience suggests donor lymphocyte infusion may promote long-term survival in children with high-risk acute lymphoblastic leukemia, Pediat Blood & Cancer. 2019; 66 (11): e27950. doi: 10.1002/pbc.27950
10. Ortí G, Sanz J, García-Cadenas I, Sánchez-Ortega I, Alonso L, Jiménez MJ, et al. Analysis of relapse after transplantation in acute leukemia: A comparative on second allogeneic hematopoietic cell transplantation and donor lymphocyte infusions. Exp Hematol. 2018; 62: 24-32. doi: 10.1016/j.exphem.2018.03.002
11. Beneduce G, De Matteo A, Stellato P, Testi AM, Bertorello N, Colombini A,et al. Blinatumomab in children and adolescents with relapsed/refractory B cell precursor acute lymphoblastic leukemia: a real-life multicenter retrospective study in seven AIEOP (Associazione Italiana di Ematologia e Oncologia Pediatrica) Centers. Cancers. 2022; 14(2): 426. doi: 10.3390/cancers14020426
12. Markova IV, Bondarenko SN, Paina OV, Aubova BI, Kozhokar PV, Frolova AS, et al. Features of response to blinatumomab and inotuzumab ozogamicin therapy in patients with relapsed/refractory B-cells acute lymphoblastic leukemia in real clinical practice, Cell Ther Transplant. 2020;9(10): 47-51. doi: 10.18620/ctt-1866-8836-2020-9-1-47-52
13. Stein AS, Kantarjian H, Gökbuget N, Bargou R, Litzow MR, Rambaldi A, et al. Blinatumomab for acute lymphoblastic leukemia relapse after allogeneic hematopoietic stem cell transplantation. Biol Blood Marrow Transplant. 2019;25(8):1498-1504. doi: 10.1016/j.bbmt.2019.04.010
14. Wu H, Cai Z, Shi J, Luo Y, Huang H, Zhao Y. Blinatumomab for HLA loss relapse after haploidentical hematopoietic stem cell transplantation. Am J Cancer Res. 2021;11(6):3111-3122. PMID: 34249448
15. Zeidan AM, Forde PM, Symons H, Chen A, Douglas Smith B, Pratz K, et al. HLA-haploidentical donor lymphocyte infusions for patients with relapsed hematologic malignancies after related HLA-haploidentical bone marrow transplantation. Biol Blood Marrow Transplant. 2014;20(3):314-318. doi: 10.1016/j.bbmt.2013.11.020
16. Yan CH, Liu QF, Wu DP, Zhang X, Xu LP, Zhang XH, et al. Prophylactic donor lymphocyte infusion (DLI) followed by minimal residual disease and graft-versus-host disease–guided multiple DLIs could improve outcomes after allogeneic hematopoietic stem cell transplantation in patients with refractory/relapsed acute leukemia, Biol Blood Marrow Transplant. 2017; 23(8):1311-1319.
    doi: 10.1016/j.bbmt.2017.04.028
17. Mo XD, Xu LP, Zhang XH, Liu DH, Wang Y, Chen H, et al. Chronic GVHD induced GVL effect after unmanipulated haploidentical hematopoietic SCT for AML and myelodysplastic syndrome. Bone Marrow Transplant. 2015; 50(1):127-133. doi: 10.1038/bmt.2014.223
18. van de Donk NWCJ, Kröger N, Hegenbart U, Corradini P, San Miguel JF, Goldschmidt H, et al. Prognostic factors for donor lymphocyte infusions following non-myeloablative allogeneic stem cell transplantation in multiple myeloma, Bone Marrow Transplant. 2006; 37(12):1135-1141. doi: 10.1038/sj.bmt.1705393
19. Mo X-D, Zhang X-H, Xu L-P, Wang Y, Yan C-H, Chen H, et al. Salvage chemotherapy followed by granulocyte colony-stimulating factor-primed donor leukocyte infusion with graft-vs.-host disease control for minimal residual disease in acute leukemia/myelodysplastic syndrome after allogeneic hematopoietic stem cell transpaltantion. Eur J Haematol. 2016;96(3):297-308. doi: 10.1111/ejh.12591
20. Schmid C, Labopin M, Nagler A, Bornhäuser M, Finke J, Fassas A, et al. Donor lymphocyte infusion in the treatment of first hematological relapse after allogeneic stem-cell transplantation in adults with acute myeloid leukemia: a retrospective risk factors analysis and comparison with other strategies by the EBMT Acute Leukemia Working Party. J Clin Oncol. 2007;25(31):4938-4945.
    doi: 10.1200/jco.2007.11.6053
21. Claiborne J, Bandyopathyay D, Roberts C, Hawks K, Aziz M, Simmons G, et al. Managing post allograft relapse of myeloid neoplasms: azacitidine and donor lymphocyte infusions as salvage therapy. Leukemia & Lymphoma. 2019:60(11):2733-2743. doi: 10.1080/10428194.2019.1605066
22. Durer C, Durer S, Shafqat M, Shah Z, Sadiq M, Asad Fraz M, et al. Concomitant use of blinatumomab and donor lymphocyte infusion for post-transplant relapsed CD19 positive acute lymphoblastic leukemia: systema- tic review. Blood. 2018; 132 (Suppl 1): 5742. doi: 10.1182/blood-2018-99-109998
23. Ueda M, de Lima M, Caimi P, Tomlinson B, Little J, Creger R, et al. Concurrent blinatumomab and donor lymphocyte infusions for treatment of relapsed pre-B-cell ALL after allogeneic hematopoietic cell transplant, Bone Marrow Transplant. 2016; 51(9): 1253-1255. doi: 10.1038/bmt.2016.104
24. Kozhokar PV, Paina OV, Frolova AS, Rakhmanova ZZ, Borovkova AS , Semenova EV, et al. Efficiency of second allogeneic HSCT in the children with acute leukemias with relapses after first transplantation. Cell Ther Ttransplant. 2019; 8(4): 33-40.
    doi: 10.18620/ctt-1866-8836-2019-8-4-33-40
25. Hua J, Zhang J, Wu X, Zhou L, Bao X, Han Y, et al. Allogeneic donor-derived anti-CD19 CAR T cell is a promising therapy for relapsed/refractory B-ALL after allogeneic hematopoietic stem-cell transplantation. Clin Lymphoma Myeloma Leuk. 2020;20(9); 610-616. doi: 10.1016/j.clml.2020.04.007
26. Webster J, Luskin MR, Prince GT, DeZern AE, DeAngelo DJ, Levis MJ, et al. Blinatumomab in combination with immune checkpoint inhibitors of PD-1 and CTLA-4 in adult patients with relapsed/refractory (R/R) CD19 positive B-cell acute lymphoblastic leukemia (ALL): Preliminary results of a phase I study. Blood. 2018; 132(Suppl 1); 557. doi: 10.1182/blood-2018-99-111845
27. Wunderlich M, Manning N, Sexton C, O’Brien E, Byerly L, Stillwell C, et al. PD-1 inhibition enhances blinatumomab response in a UCB/PDX model of relapsed pediatric B-cell acute lymphoblastic leukemia. Front Oncol. 2021; 11. doi: 10.3389/fonc.2021.642466

" ["~DETAIL_TEXT"]=> string(27544) "

Introduction

Acute lymphoblastic leukemia (ALL) is one of the most spread pediatric cancers. With improvements of protocols for new diagnosed ALL nowadays 5-year survival achieves approximately 80-90% for these children [1]. However, patients with primary chemoresistance disease or relapse have a dismal prognosis with 5-year OS in first relapse of about 50% [2]. Allogeneic hematopoietic stem cells transplantation (allo-HSCT) has become a standard treatment for high-risk pediatric ALL. Many conditions affect the results of allo-HSCT: age, HLA-incompatibility between the donor and recipient, conditioning regimens, status of disease at the moment of allo-HSCT, persistence of minimal residual disease (MRD) and other [3]. Incidence of relapse after allo-HSCT reaches 70% in patients without remission at the moment of allo-HSCT compare with patients having remission (up to 35% of relapses). Patients with clinic of acute or chronic GVHD have a benefit in OS due to proceeding graft-versus-leukemia reaction [4, 5]. Patients with relapsed/refractory (r/r) disease after allo-HSCT have a poor prognosis with 3-year probability OS about 20% using different salvage option [6]. There are no standard recommendations for this group of patients. Clinical approaches include cytoreductive chemotherapy, target drugs, donor lymphocyte infusion (DLI), CAR-T cells, monoclonal antibody or palliative care. Treatment choices are individualized and depend on somatic status of patients, time of relapse, type of relapse and immune response.

Because most ALL cells in relapse have chemoresistance and get ability to escape the immune-suppressive tumor response conventional chemo-drug induce very short remission and not effective in long time survival.

DLI is a form of adoptive immunotherapy, which mechanism of action based on induction of graft-versus-leukemia (GVL) effect. Patients with ALL in general are less sensitive for immunotherapy, than AML patients, and other reasons of weak response to DLI is immune resistance by immune checkpoint expression, tumor microenvironment or loss of recipient-specific HLA genes [7, 8].

However, the study Nicole Liberio et al. [9] showed, that DLIs could promote durable survival after allo-HSCT in childhood ALL cohort. Moreover, the results of DLI as a therapy for relapsed acute leukemia may be shown comparable to second allo-HSCT [10].

Blinatumomab is a bispecific T-cell engager (BiTE) with two different single-chain Fv fragments binding T-cell CD3 and B-cell CD19 antigens. According to previous studies, blinatumomab has been demonstrated high efficacy in pediatric r/r B-ALL with a good tolerable safety profile. Response rate may reach 90% depending on tumor burden with a long median relapse-free survival (RFS) [11]. Low toxicity allows using this drug after allo-HSCT with comparable results [12, 13].

In study Hengwei Wu et al., [14] blinatumomab showed efficacy in patients undergoing HLA loss relapse after haplo-HSCT. Supposed, that blinatumomab may restore GVL effect.

So, we expect blinatumomab may not only reduce tumor cells, but also make stronger immune pressure for action of DLI.

Here we present first single-center experience of using immunotherapy with Blinatumomab and DLI in 17 children with refractory/relapsed (r/r) CD19+ B-ALL after allo-HSCT.

Patients and methods

We enrolled in this prospective study 17 B-ALL patients with the median age 10 years (8 months-18 years), who were treated by immunotherapy with Blinatumomab and DLI after allo- HSCT. Among them 3 patients (18%) had infant ALL with rearrangement KMT2A. All patients underwent allo-HSCT at RM Gorbacheva Research Institute within a period from 2012 to 2021. Eleven patients (65%) had received a myeloablative conditioning regimen (MAC), including 8 (47%) Bu-based (12-16 mg/kg) conditioning regimen, 2 GIAC [busulfan 3 mg/kg, сyclophosphamide 100 mg/kg, lomustine 120 mg/m², cytarabine 6000 mg/m²] protocol (12%) and one Treosulfan+Fludarabin+Thiotepa followed by TCR αβ+/CD19+ cell depletion. Six patients (35%) had received a reduced-intensity conditioning regimen (RIC) Fludarabin 150mg/m² and Melphalan 140 mg/m². Most children (n=13, 76%) had haploidentical donor, three (18%) patients had matched unrelated donor and one patient had matched related donor. Sixteen (94%) were given regimen of prophylaxis GVHD with сyclophosphamide (PtCy) 50 mg/kg on D+3, D+4, one patient was given immunosuppressive therapy with Rituximab, Tocilizumab, Abatacept after transplantation with TCR αβ+/CD19+ cell depletion. Engraftment with full donor chimerism was confirmed in all analyzed patients. History of acute GVHD of skin grade II after allo-HSCT was observed in 1 (6%) child, history of chronic GVHD of skin mild grade – in 2 children (12%). Disease status before starting of blinatumomab was post-transplant bone marrow relapse in 11 (65%) patients, MRD in 6 (35%) patients. Extramedullary lesions before blinatumomab therapy were observed in 4 patients (24%): 3 patients with involvement of central neural system (CNS) and 1 patient with testicular involvement. Early bone marrow relapse/MRD >10^-4 leukemic blasts of leukemia (up to one year after allo-HSCT) developed in 9 patients (53%). BM relapse occurred up to D+100 in 6 (35%) patients. Five patients (29%) with relapse of the disease had received salvage fludarabine-containing chemotherapy before treatment with blinatumomab. Four patients (24%) had response as blast cell reduction after salvage chemotherapy. Patients with MRD had full donor chimerism before starting blinatumomab and DLI, among patients with relapse 10/11 had chimerism more 50%.

Primary endpoints of the study were overall response rate, relapse-free survival (RFS), overall survival (OS). Overall response included morphologic CR (<5% blasts) and MRD response (<10^-4 leukemic blasts by flow cytometry or polymerase chain reaction) within the first 2 cycles of treatment with blinatumomab and DLI. RFS and OS was calculated from the start of blinatumomab treatment to time of relapse, death, consequently.

Relapse was determined as bone marrow recurrence of disease or extramedullary lesions. Secondary endpoints included frequency of induced acute and chronic GVHD after immunotherapy, grade 3 or higher treatment-related adverse events by NCI CTCAE 5.0, duration of bone marrow response (DOR). DOR was defined as time from initial response to bone marrow relapse, death. Patients alive were censored on the last documented visit date or last contact date.

Relapse-free survival and overall survival are described with Kaplan-Meier with 95% CI estimates. Statistical analysis was performed using IBM SPSS Statistics v 26 and Free statistical software: EZR (Easy R).

Table 1. Demographic Data and Baseline Disease Characteristics (n=17)

Results

Median time from allo-HSCT to blinatumomab therapy was 12 months (range, 2 months – 43 months). Blinatumomab (5-15 µg/m² per day) was administered as a 4-week induction cycle. Patients received up to 3 courses of blinatumomab with the median 1 course. First DLI was mostly given after starting blinatumomab course 1 (ranged from course 1 to course 2) on median day 32 therapy (1-123). Seven patients got first dose of DLI at the moment blinatumomab administration, 3 patients – in several days after finishing blinatumomab administration and seven patients – in 1-3 months after finishing blinatumomab at CR. Total, from 1 to 4 DLI were performed at follow up, doses varied between 1×10⁵ and 6×10⁷ CD3+/kg. Summary median dose of DLI during the combined therapy was 1.7×10⁶ CD3+/kg (range, 1×10⁵-6×10⁷).

Efficacy

The median overall survival for all patients was not reached at a median follow-up of 13.3 months (95% CI, 8.8 to 27.4 months); four (24%) died from progression of leukemia. The Kaplan-Meier estimate overall survival was 76.5% (95% CI, 44%-92%) at a median follow-up time (Fig. 1).

Fifteen (88%) of patients achieved a CR within the first 2 cycles of treatment with blinatumomab +DLI, among them 14 (82%) had MRD negative CR. Median duration of bone marrow response was 7 months (range, 1 to 55.0 months). The median relapse-free survival was 9.1 months (95% CI, 3.0 to 37.2 months) in patients who achieved CR, with the median duration follow up 13,3 months (95% CI, 10.0 to 30.3 months); 10 (67%) patients relapsed, including bone marrow relapse in 4 patients (27%), combined (BM+CNS/bones/parenchymal organs) in 3 (18%) and isolated extramedullary relapse (СNS in 2 and soft tissues in 1) in three (18%) patients (Fig. 2). One patient underwent successful subsequent allo-HSCT after relapse and still alive in MRD negative CR.

Safety

Three children (18%) experienced drug-related adverse events grade 3. One patient had seizure and required transient blinatumomab discontinuation, 1 patient had generalized cytomegalovirus (CMV) infection with involvement of blood, lung and urinary tract, 2 patients had infectious enterocolitis grade 3 (Clostridia, Serratia spp., CMV). There were no observed cytokine release events, grade 4 or fatal reactions.

There were no fatal acute and chronic GVHD after therapy by blinatumomab and DLI. But, one patient (6%) experienced induced acute GVHD of skin and gastrointestinal tract grade 3 after combined immunotherapy. Three children (18%) had chronic GVHD. One patient had classical severe GVHD of skin, gastrointestinal tract and liver after acute GVHD grade 3. One patient had classical mild GVHD of skin and oral mucosa. One patient had "overlap" moderate GVHD of skin and eyes. One patient with history of mild chronic GVHD developed mild chronic GVHD during combined immunotherapy. GVHD was induced in one month after DLI administration in all children. Two patients with chronic GVHD (moderate and severe form) received immunosuppressive therapy (steroids, tacrolimus/sirolimus and ruxolitinib) with success control of symptoms. DLI were discontinued after development of moderate and severe chronic GVHD. Two of 3 patients with chronic GVHD remain in long term CR during 12 and 35 months with good quality of life. Clinical outcomes are shown in Table 2 and Table 3.

Table 3. Treatment details in the distinct clinical B-ALL cases

Discussion

Allo-HSCT may be a curative treatment option for high-risk ALL, however, a portion of patients become refractory or relapse after allo-HSCT with the rate between 30% and 70%. Progressive leukemia remains the main cause of mortality after allo-HSCT.

In our study we have demonstrated results of adoptive immunotherapy based on combination bispecific T cell engager (BiTE) blinatumomab and DLI for salvage group of 17 pediatric B-ALL, including 3 infant ALL with rearrangement KMT2A. This combination is promising with overall rate response (88%) both in patients with persistence MRD and bone marrow relapse. Incidence complete response was higher, than that observed in patients who receive mono-DLI (43%) [9]. It is known that tumor burden has great importance before immunotherapy, so cytoreductive chemotherapy was administered previous in 5 (29%) relapsed patients [12]. One patient with early 4^th relapse and large tumor burden didn’t receive cytoreductive therapy and progressed during immunotherapy.

We have found good short-term toxicity profile of this therapy without the necessary for complete withdrawal of therapy due to adverse events. Infectious complications grade 3, observed in 3 children, could be associated also with pretreatment and absent of full immunological reconstitution after allo-HSCT.

The most common complication after DLI is the induction of acute and chronic GVHD, which develops general in 40-50% of patients. However, the use of PtCy may reduce the risk of developing induced GVHD [15]. The occurrence of chronic GVHD after DLI is considered to be a favorable factor associated with a reduced risk of recurrence and long-term disease-free survival [16, 17, 18, 19, 20, 21].

While the most lymphocyte infusions were haploidentical, the incidence of GVHD was low (24%), that similar with early published study, where haplo-DLI was used for relapse treatment after T cell replete bone marrow transplantation with post-transplantation cyclophosphamide. [15]. Two of 3 patients with GVHD remains in long CR during 12 and 35 months.

Systematic review reported summarized data about concomitant use of blinatumomab and DLI for post-transplant relapsed CD19 positive ALL on 15 adult patients according 2 studies. Before starting blinatumomab therapy, 12 patients had post-transplant bone marrow relapse, 1 patient had an extramedullary relapse, and 2 patients had a MRD without marrow relapse. DLI was mostly given with blinatumomab during cycle 3 (ranged from cycle 2 to cycle 4). Complete remission (CR) with MRD negative status was achieved after 2 cycles of blinatumomab in 3 patients, 2 of them remained in CR for 7 and 13 months. Ten patients showed RR of 70%. One patient developed grade II aGVHD after the combination therapy, Grade 3 late-onset acute skin and gut GVHD were reported in one patient. One patient continued progression of extramedullary disease, 1 patient died to extramedullary and hematologic relapse 12 months after blinatumomab initiation [22, 23].

In our study totally 6 (35%) patients developed relapse with extramedullary involvement, 2 of them had extramedullary before immunotherapy. Five patients with extramedullary involvement are still alive after relapse, 3 of them continue the treatment.

Unfortunately, despite high response rate and a durable remission in our work relapse of disease occurred in 67% of patients. These patients need in continuation of escalated DLI with/without courses of blinatumomab should be considered to control the disease, if there are no signs of clinically significant GVHD.

Further alternative approaches to overcome immune resistance may include chimeric antigen receptor T-cell therapies, checkpoint inhibitors or undergo second allo-HSCT [24, 25, 26, 27].

In the era of immunotherapy, future challenges and goals will be based on understanding the mechanisms of immune evasion by leukemia cells for developing novel therapeutic strategies.

Conclusion

Combination adoptive immunotherapy of blinatumomab and DLI is effective and can induce long-term bone marrow remissions in some relapsed pediatric CD19+ B-ALL after allo-HSCT.

1. Blinatumomab+DLI has a low toxicity profile, low incidence of GVHD and is well tolerated even by young children after haplo-HSCT.

2. The use of immunotherapy after cytoreductive chemotherapy is preferable in patients with extensive bone marrow relapse.

3. For maintaining of durable remission responded patients are needed further treatment.

Conflict of interest

None declared.

Acknowledgments

The study was funded by a grant from Russian Science Foundation № 22-15-00491, https://rscf.ru/project/22-15-00491/

References

1. Inaba H, Mullighan CG. Pediatric acute lymphoblastic leukemia. Haematologica. 2020; 105: 2524-2539.
   doi: 10.3324/haematol.2020.247031
2. Bhojwani D, Pui CH. Relapsed childhood acute lymphoblastic leukaemia. Lancet.Oncol. 2013; 14, e205-e217.
   doi: 10.1016/S1470-2045(12)70580-6
3. Shen X, Pan J, Qi C, Feng Y, Wu H, Qian S, Lu H, et al. Impact of pre-transplantation minimal residual disease (MRD) on the outcome of Allogeneic hematopoietic stem cell transplantation for acute leukemia. Hematology. 2021; 26(1): 295-300.
   doi: 10.1080/16078454.2021.1889162
4. Bondarenko SN, Moiseev IS, Slesarchuk OA, Darskaya EI, Ekushev KA, Smirnova AG, et al. Allogeneic hematopoietic stem cell transplantation in children and adults with acute lymphoblastic leukemia. Cell Ther Transplant. 2016; 5(2):12-20.
   doi: 10.18620/1866-8836-2016-5-2-12-20
5. Semenova EV, Kozhokar PV, Paina OV, Rakhmanova ZZ, Frolova AS, Tsvetkova LA, et al. Factors affecting post-transplant relapse of acute lymphoblastic leukemia (ALL) in children according on the intensity of conditioning. Blood. 2020; 136 (Supplement 1): 26-27. doi: 10.1182/blood-2020-139466
6. Kuhlen M, Willasch AM, Dalle JH, Wachowiak J, Yaniv I, Ifversen M, et al. Outcome of relapse after allogeneic HSCT in children with ALL enrolled in the ALL-SCT 2003/2007 trial. Br J Haematol. 2018; 180(1): 82-89, https://doi.org/10.1111/bjh.14965
7. Arnold PY. Review: HLA loss and detection in the setting of relapse from HLA-mismatched hematopoietic cell transplant, Human Immunol. 2022. doi: 10.1016/j.humimm.2022.03.001
8. Jiménez-Morales S, Aranda-Uribe IS, Pérez-Amado CJ, Ramírez-Bello J, Hidalgo-Miranda A. Mechanisms of immunosuppressive tumor evasion: focus on acute lymphoblastic leukemia, Front Immunol. 2021; 12. doi: 10.3389/fimmu.2021.737340
9. Liberio N, Robinson H, Nugent M, Simpson P, Margolis DA, Malarkannan S, et al. Single-center experience suggests donor lymphocyte infusion may promote long-term survival in children with high-risk acute lymphoblastic leukemia, Pediat Blood & Cancer. 2019; 66 (11): e27950. doi: 10.1002/pbc.27950
10. Ortí G, Sanz J, García-Cadenas I, Sánchez-Ortega I, Alonso L, Jiménez MJ, et al. Analysis of relapse after transplantation in acute leukemia: A comparative on second allogeneic hematopoietic cell transplantation and donor lymphocyte infusions. Exp Hematol. 2018; 62: 24-32. doi: 10.1016/j.exphem.2018.03.002
11. Beneduce G, De Matteo A, Stellato P, Testi AM, Bertorello N, Colombini A,et al. Blinatumomab in children and adolescents with relapsed/refractory B cell precursor acute lymphoblastic leukemia: a real-life multicenter retrospective study in seven AIEOP (Associazione Italiana di Ematologia e Oncologia Pediatrica) Centers. Cancers. 2022; 14(2): 426. doi: 10.3390/cancers14020426
12. Markova IV, Bondarenko SN, Paina OV, Aubova BI, Kozhokar PV, Frolova AS, et al. Features of response to blinatumomab and inotuzumab ozogamicin therapy in patients with relapsed/refractory B-cells acute lymphoblastic leukemia in real clinical practice, Cell Ther Transplant. 2020;9(10): 47-51. doi: 10.18620/ctt-1866-8836-2020-9-1-47-52
13. Stein AS, Kantarjian H, Gökbuget N, Bargou R, Litzow MR, Rambaldi A, et al. Blinatumomab for acute lymphoblastic leukemia relapse after allogeneic hematopoietic stem cell transplantation. Biol Blood Marrow Transplant. 2019;25(8):1498-1504. doi: 10.1016/j.bbmt.2019.04.010
14. Wu H, Cai Z, Shi J, Luo Y, Huang H, Zhao Y. Blinatumomab for HLA loss relapse after haploidentical hematopoietic stem cell transplantation. Am J Cancer Res. 2021;11(6):3111-3122. PMID: 34249448
15. Zeidan AM, Forde PM, Symons H, Chen A, Douglas Smith B, Pratz K, et al. HLA-haploidentical donor lymphocyte infusions for patients with relapsed hematologic malignancies after related HLA-haploidentical bone marrow transplantation. Biol Blood Marrow Transplant. 2014;20(3):314-318. doi: 10.1016/j.bbmt.2013.11.020
16. Yan CH, Liu QF, Wu DP, Zhang X, Xu LP, Zhang XH, et al. Prophylactic donor lymphocyte infusion (DLI) followed by minimal residual disease and graft-versus-host disease–guided multiple DLIs could improve outcomes after allogeneic hematopoietic stem cell transplantation in patients with refractory/relapsed acute leukemia, Biol Blood Marrow Transplant. 2017; 23(8):1311-1319.
    doi: 10.1016/j.bbmt.2017.04.028
17. Mo XD, Xu LP, Zhang XH, Liu DH, Wang Y, Chen H, et al. Chronic GVHD induced GVL effect after unmanipulated haploidentical hematopoietic SCT for AML and myelodysplastic syndrome. Bone Marrow Transplant. 2015; 50(1):127-133. doi: 10.1038/bmt.2014.223
18. van de Donk NWCJ, Kröger N, Hegenbart U, Corradini P, San Miguel JF, Goldschmidt H, et al. Prognostic factors for donor lymphocyte infusions following non-myeloablative allogeneic stem cell transplantation in multiple myeloma, Bone Marrow Transplant. 2006; 37(12):1135-1141. doi: 10.1038/sj.bmt.1705393
19. Mo X-D, Zhang X-H, Xu L-P, Wang Y, Yan C-H, Chen H, et al. Salvage chemotherapy followed by granulocyte colony-stimulating factor-primed donor leukocyte infusion with graft-vs.-host disease control for minimal residual disease in acute leukemia/myelodysplastic syndrome after allogeneic hematopoietic stem cell transpaltantion. Eur J Haematol. 2016;96(3):297-308. doi: 10.1111/ejh.12591
20. Schmid C, Labopin M, Nagler A, Bornhäuser M, Finke J, Fassas A, et al. Donor lymphocyte infusion in the treatment of first hematological relapse after allogeneic stem-cell transplantation in adults with acute myeloid leukemia: a retrospective risk factors analysis and comparison with other strategies by the EBMT Acute Leukemia Working Party. J Clin Oncol. 2007;25(31):4938-4945.
    doi: 10.1200/jco.2007.11.6053
21. Claiborne J, Bandyopathyay D, Roberts C, Hawks K, Aziz M, Simmons G, et al. Managing post allograft relapse of myeloid neoplasms: azacitidine and donor lymphocyte infusions as salvage therapy. Leukemia & Lymphoma. 2019:60(11):2733-2743. doi: 10.1080/10428194.2019.1605066
22. Durer C, Durer S, Shafqat M, Shah Z, Sadiq M, Asad Fraz M, et al. Concomitant use of blinatumomab and donor lymphocyte infusion for post-transplant relapsed CD19 positive acute lymphoblastic leukemia: systema- tic review. Blood. 2018; 132 (Suppl 1): 5742. doi: 10.1182/blood-2018-99-109998
23. Ueda M, de Lima M, Caimi P, Tomlinson B, Little J, Creger R, et al. Concurrent blinatumomab and donor lymphocyte infusions for treatment of relapsed pre-B-cell ALL after allogeneic hematopoietic cell transplant, Bone Marrow Transplant. 2016; 51(9): 1253-1255. doi: 10.1038/bmt.2016.104
24. Kozhokar PV, Paina OV, Frolova AS, Rakhmanova ZZ, Borovkova AS , Semenova EV, et al. Efficiency of second allogeneic HSCT in the children with acute leukemias with relapses after first transplantation. Cell Ther Ttransplant. 2019; 8(4): 33-40.
    doi: 10.18620/ctt-1866-8836-2019-8-4-33-40
25. Hua J, Zhang J, Wu X, Zhou L, Bao X, Han Y, et al. Allogeneic donor-derived anti-CD19 CAR T cell is a promising therapy for relapsed/refractory B-ALL after allogeneic hematopoietic stem-cell transplantation. Clin Lymphoma Myeloma Leuk. 2020;20(9); 610-616. doi: 10.1016/j.clml.2020.04.007
26. Webster J, Luskin MR, Prince GT, DeZern AE, DeAngelo DJ, Levis MJ, et al. Blinatumomab in combination with immune checkpoint inhibitors of PD-1 and CTLA-4 in adult patients with relapsed/refractory (R/R) CD19 positive B-cell acute lymphoblastic leukemia (ALL): Preliminary results of a phase I study. Blood. 2018; 132(Suppl 1); 557. doi: 10.1182/blood-2018-99-111845
27. Wunderlich M, Manning N, Sexton C, O’Brien E, Byerly L, Stillwell C, et al. PD-1 inhibition enhances blinatumomab response in a UCB/PDX model of relapsed pediatric B-cell acute lymphoblastic leukemia. Front Oncol. 2021; 11. doi: 10.3389/fonc.2021.642466

" ["DETAIL_TEXT_TYPE"]=> string(4) "html" ["~DETAIL_TEXT_TYPE"]=> string(4) "html" ["PREVIEW_TEXT"]=> string(0) "" ["~PREVIEW_TEXT"]=> string(0) "" ["PREVIEW_TEXT_TYPE"]=> string(4) "text" ["~PREVIEW_TEXT_TYPE"]=> string(4) "text" ["PREVIEW_PICTURE"]=> NULL ["~PREVIEW_PICTURE"]=> NULL ["LANG_DIR"]=> string(4) "/ru/" ["~LANG_DIR"]=> string(4) "/ru/" ["SORT"]=> string(2) "10" ["~SORT"]=> string(2) "10" ["CODE"]=> string(100) "kombinirovannaya-adoptivnaya-immunoterapiya-s-primeneniem-blinatumomaba-i-infuziy-donorskikh-limfots" ["~CODE"]=> string(100) "kombinirovannaya-adoptivnaya-immunoterapiya-s-primeneniem-blinatumomaba-i-infuziy-donorskikh-limfots" ["EXTERNAL_ID"]=> string(4) "2059" ["~EXTERNAL_ID"]=> string(4) "2059" ["IBLOCK_TYPE_ID"]=> string(7) "journal" ["~IBLOCK_TYPE_ID"]=> string(7) "journal" ["IBLOCK_CODE"]=> string(7) "volumes" ["~IBLOCK_CODE"]=> string(7) "volumes" ["IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["~IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["LID"]=> string(2) "s2" ["~LID"]=> string(2) "s2" ["EDIT_LINK"]=> NULL ["DELETE_LINK"]=> NULL ["DISPLAY_ACTIVE_FROM"]=> string(0) "" ["IPROPERTY_VALUES"]=> array(18) { ["ELEMENT_META_TITLE"]=> string(317) "Комбинированная адоптивная иммунотерапия с применением блинатумомаба и инфузий донорских лимфоцитов у детей с рецидивирующим/ рефрактерным течением В-ОЛЛ после алло-ТГСК" ["ELEMENT_META_KEYWORDS"]=> string(0) "" ["ELEMENT_META_DESCRIPTION"]=> string(484) "Комбинированная адоптивная иммунотерапия с применением блинатумомаба и инфузий донорских лимфоцитов у детей с рецидивирующим/ рефрактерным течением В-ОЛЛ после алло-ТГСКCombined adoptive immunotherapy with Blinatumomab and donor lymphocyte infusions in children with relapsed/refractory B-ALL after allogeneic stem cells transplantation" ["ELEMENT_PREVIEW_PICTURE_FILE_ALT"]=> string(3409) "<p style="text-align: justify;">Алло-ТГСК является потенциально излечивающим методом терапии детей с В лимфобластным лейкозом (В-ОЛЛ) группы высокого риска. Тем не менее, примерно у 30-70% пациентов возникает рецидив после алло-ТГСК. Пациенты с рецидивирующим/ рефрактерным течением В-ОЛЛ имеют неблагоприятный прогноз с 3-летней общей выживаемостью (ОВ) около 20%. В этом исследовании мы впервые оценили эффективность и безопасность комбинированной адоптивной иммунотерапии биспецифическим активатором Т-клеток блинатумомабом и инфузиями донорских лимфоцитов (ИДЛ) у 17 детей, перенесших алло-ТГСК и имевших после этого рецидив или персистенцию минимальной остаточной болезни. Пятнадцать (88%) пациентов достигли ремиссии в течение первых 2 циклов лечения блинатумомабом +ИДЛ. Медиана безрецидивной выживаемости составила 9,1 мес (95% ДИ, от 3,0 до 37,2 мес.) у пациентов, достигших ответа, с медианой наблюдения 13,3 мес. (95% ДИ, 10,0-30,3 мес.). Медиана OB для всех пациентов не была достигнута при медиане наблюдения 13,3 месяца (95% ДИ, от 8,8 до 27,4 месяцев). ОВ по Каплану-Мейеру составила 76,5% (95% ДИ, 44-92%) при медиане наблюдения 13,3 месяца. Трое детей (18%) развили нежелательные явления 3-й степени тяжести, связанные с введением препарата, и двое детей (12%) имели клинически значимую индуцированную реакцию «трансплантат против хозяина» (РТПХ). Летальных случаев, связанных с терапией, отмечено не было. Дальнейшие варианты иммунотерапии детей с рецидивирующим течением В-ОЛЛ могут включать продолжение курсов комбинированной адоптивной иммунотерапии, монотерапию ИДЛ в эскалированных дозах, терапию Т-клетками с антигенным химерным рецептором, ингибиторами контрольных точек, а также проведение повторной алло-ТГСК.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">В-клеточный острый лимфобластный лейкоз, дети, рецидив, алло-ТГСК, блинатумомаб, инфузии донорских лимфоцитов.</p>" ["ELEMENT_PREVIEW_PICTURE_FILE_TITLE"]=> string(317) "Комбинированная адоптивная иммунотерапия с применением блинатумомаба и инфузий донорских лимфоцитов у детей с рецидивирующим/ рефрактерным течением В-ОЛЛ после алло-ТГСК" ["ELEMENT_DETAIL_PICTURE_FILE_ALT"]=> string(317) "Комбинированная адоптивная иммунотерапия с применением блинатумомаба и инфузий донорских лимфоцитов у детей с рецидивирующим/ рефрактерным течением В-ОЛЛ после алло-ТГСК" ["ELEMENT_DETAIL_PICTURE_FILE_TITLE"]=> string(317) "Комбинированная адоптивная иммунотерапия с применением блинатумомаба и инфузий донорских лимфоцитов у детей с рецидивирующим/ рефрактерным течением В-ОЛЛ после алло-ТГСК" ["SECTION_META_TITLE"]=> string(317) "Комбинированная адоптивная иммунотерапия с применением блинатумомаба и инфузий донорских лимфоцитов у детей с рецидивирующим/ рефрактерным течением В-ОЛЛ после алло-ТГСК" ["SECTION_META_KEYWORDS"]=> string(317) "Комбинированная адоптивная иммунотерапия с применением блинатумомаба и инфузий донорских лимфоцитов у детей с рецидивирующим/ рефрактерным течением В-ОЛЛ после алло-ТГСК" ["SECTION_META_DESCRIPTION"]=> string(317) "Комбинированная адоптивная иммунотерапия с применением блинатумомаба и инфузий донорских лимфоцитов у детей с рецидивирующим/ рефрактерным течением В-ОЛЛ после алло-ТГСК" ["SECTION_PICTURE_FILE_ALT"]=> string(317) "Комбинированная адоптивная иммунотерапия с применением блинатумомаба и инфузий донорских лимфоцитов у детей с рецидивирующим/ рефрактерным течением В-ОЛЛ после алло-ТГСК" ["SECTION_PICTURE_FILE_TITLE"]=> string(317) "Комбинированная адоптивная иммунотерапия с применением блинатумомаба и инфузий донорских лимфоцитов у детей с рецидивирующим/ рефрактерным течением В-ОЛЛ после алло-ТГСК" ["SECTION_PICTURE_FILE_NAME"]=> string(100) "kombinirovannaya-adoptivnaya-immunoterapiya-s-primeneniem-blinatumomaba-i-infuziy-donorskikh-limfots" ["SECTION_DETAIL_PICTURE_FILE_ALT"]=> string(317) "Комбинированная адоптивная иммунотерапия с применением блинатумомаба и инфузий донорских лимфоцитов у детей с рецидивирующим/ рефрактерным течением В-ОЛЛ после алло-ТГСК" ["SECTION_DETAIL_PICTURE_FILE_TITLE"]=> string(317) "Комбинированная адоптивная иммунотерапия с применением блинатумомаба и инфузий донорских лимфоцитов у детей с рецидивирующим/ рефрактерным течением В-ОЛЛ после алло-ТГСК" ["SECTION_DETAIL_PICTURE_FILE_NAME"]=> string(100) "kombinirovannaya-adoptivnaya-immunoterapiya-s-primeneniem-blinatumomaba-i-infuziy-donorskikh-limfots" ["ELEMENT_PREVIEW_PICTURE_FILE_NAME"]=> string(100) "kombinirovannaya-adoptivnaya-immunoterapiya-s-primeneniem-blinatumomaba-i-infuziy-donorskikh-limfots" ["ELEMENT_DETAIL_PICTURE_FILE_NAME"]=> string(100) "kombinirovannaya-adoptivnaya-immunoterapiya-s-primeneniem-blinatumomaba-i-infuziy-donorskikh-limfots" } ["FIELDS"]=> array(1) { ["IBLOCK_SECTION_ID"]=> string(3) "212" } ["PROPERTIES"]=> array(18) { ["KEYWORDS"]=> array(36) { ["ID"]=> string(2) "19" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:46:01" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(27) "Ключевые слова" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "KEYWORDS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "19" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "4" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "Y" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "Y" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(27) "Ключевые слова" ["~DEFAULT_VALUE"]=> string(0) "" } ["SUBMITTED"]=> array(36) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28614" ["VALUE"]=> string(22) "06/21/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "06/21/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL } ["ACCEPTED"]=> array(36) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28615" ["VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL } ["PUBLISHED"]=> array(36) { ["ID"]=> string(2) "22" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Дата публикации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "PUBLISHED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "22" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Дата публикации" ["~DEFAULT_VALUE"]=> NULL } ["CONTACT"]=> array(36) { ["ID"]=> string(2) "23" ["TIMESTAMP_X"]=> string(19) "2015-09-03 14:43:05" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(14) "Контакт" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "CONTACT" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "23" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(14) "Контакт" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHORS"]=> array(36) { ["ID"]=> string(2) "24" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:45:07" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "AUTHORS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "24" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_RU"]=> array(36) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28616" ["VALUE"]=> array(2) { ["TEXT"]=> string(335) "<p>Любовь А. Цветкова, Олеся В. Паина, Полина В. Кожокарь, Анастасия С. Фролова, Жемал З. Рахманова, Елена В. Бабенко, Елена В. Семенова, Александр Д. Кулагин, Людмила С. Зубаровская</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(323) "

Любовь А. Цветкова, Олеся В. Паина, Полина В. Кожокарь, Анастасия С. Фролова, Жемал З. Рахманова, Елена В. Бабенко, Елена В. Семенова, Александр Д. Кулагин, Людмила С. Зубаровская

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_RU"]=> array(36) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28617" ["VALUE"]=> array(2) { ["TEXT"]=> string(373) "<p>НИИ детской онкологии, гематологии и трансплантологии им. Р. М. Горбачевой, Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(361) "

НИИ детской онкологии, гематологии и трансплантологии им. Р. М. Горбачевой, Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_RU"]=> array(36) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28618" ["VALUE"]=> array(2) { ["TEXT"]=> string(3409) "<p style="text-align: justify;">Алло-ТГСК является потенциально излечивающим методом терапии детей с В лимфобластным лейкозом (В-ОЛЛ) группы высокого риска. Тем не менее, примерно у 30-70% пациентов возникает рецидив после алло-ТГСК. Пациенты с рецидивирующим/ рефрактерным течением В-ОЛЛ имеют неблагоприятный прогноз с 3-летней общей выживаемостью (ОВ) около 20%. В этом исследовании мы впервые оценили эффективность и безопасность комбинированной адоптивной иммунотерапии биспецифическим активатором Т-клеток блинатумомабом и инфузиями донорских лимфоцитов (ИДЛ) у 17 детей, перенесших алло-ТГСК и имевших после этого рецидив или персистенцию минимальной остаточной болезни. Пятнадцать (88%) пациентов достигли ремиссии в течение первых 2 циклов лечения блинатумомабом +ИДЛ. Медиана безрецидивной выживаемости составила 9,1 мес (95% ДИ, от 3,0 до 37,2 мес.) у пациентов, достигших ответа, с медианой наблюдения 13,3 мес. (95% ДИ, 10,0-30,3 мес.). Медиана OB для всех пациентов не была достигнута при медиане наблюдения 13,3 месяца (95% ДИ, от 8,8 до 27,4 месяцев). ОВ по Каплану-Мейеру составила 76,5% (95% ДИ, 44-92%) при медиане наблюдения 13,3 месяца. Трое детей (18%) развили нежелательные явления 3-й степени тяжести, связанные с введением препарата, и двое детей (12%) имели клинически значимую индуцированную реакцию «трансплантат против хозяина» (РТПХ). Летальных случаев, связанных с терапией, отмечено не было. Дальнейшие варианты иммунотерапии детей с рецидивирующим течением В-ОЛЛ могут включать продолжение курсов комбинированной адоптивной иммунотерапии, монотерапию ИДЛ в эскалированных дозах, терапию Т-клетками с антигенным химерным рецептором, ингибиторами контрольных точек, а также проведение повторной алло-ТГСК.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">В-клеточный острый лимфобластный лейкоз, дети, рецидив, алло-ТГСК, блинатумомаб, инфузии донорских лимфоцитов.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(3353) "

Алло-ТГСК является потенциально излечивающим методом терапии детей с В лимфобластным лейкозом (В-ОЛЛ) группы высокого риска. Тем не менее, примерно у 30-70% пациентов возникает рецидив после алло-ТГСК. Пациенты с рецидивирующим/ рефрактерным течением В-ОЛЛ имеют неблагоприятный прогноз с 3-летней общей выживаемостью (ОВ) около 20%. В этом исследовании мы впервые оценили эффективность и безопасность комбинированной адоптивной иммунотерапии биспецифическим активатором Т-клеток блинатумомабом и инфузиями донорских лимфоцитов (ИДЛ) у 17 детей, перенесших алло-ТГСК и имевших после этого рецидив или персистенцию минимальной остаточной болезни. Пятнадцать (88%) пациентов достигли ремиссии в течение первых 2 циклов лечения блинатумомабом +ИДЛ. Медиана безрецидивной выживаемости составила 9,1 мес (95% ДИ, от 3,0 до 37,2 мес.) у пациентов, достигших ответа, с медианой наблюдения 13,3 мес. (95% ДИ, 10,0-30,3 мес.). Медиана OB для всех пациентов не была достигнута при медиане наблюдения 13,3 месяца (95% ДИ, от 8,8 до 27,4 месяцев). ОВ по Каплану-Мейеру составила 76,5% (95% ДИ, 44-92%) при медиане наблюдения 13,3 месяца. Трое детей (18%) развили нежелательные явления 3-й степени тяжести, связанные с введением препарата, и двое детей (12%) имели клинически значимую индуцированную реакцию «трансплантат против хозяина» (РТПХ). Летальных случаев, связанных с терапией, отмечено не было. Дальнейшие варианты иммунотерапии детей с рецидивирующим течением В-ОЛЛ могут включать продолжение курсов комбинированной адоптивной иммунотерапии, монотерапию ИДЛ в эскалированных дозах, терапию Т-клетками с антигенным химерным рецептором, ингибиторами контрольных точек, а также проведение повторной алло-ТГСК.

Ключевые слова

В-клеточный острый лимфобластный лейкоз, дети, рецидив, алло-ТГСК, блинатумомаб, инфузии донорских лимфоцитов.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["DOI"]=> array(36) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28619" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-31-38" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-31-38" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_EN"]=> array(36) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28622" ["VALUE"]=> array(2) { ["TEXT"]=> string(208) "<p>Liubov A. Tsvetkova, Olesya V. Paina, Polina V. Kozhokar’, Аnastasia S. Frolova, Zhemal Z. Rakhmanova, Elena V. Babenko, Elena V. Semenova, Alexander D. Kulagin, Ludmila S. Zubarovskaya</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(196) "

Liubov A. Tsvetkova, Olesya V. Paina, Polina V. Kozhokar’, Аnastasia S. Frolova, Zhemal Z. Rakhmanova, Elena V. Babenko, Elena V. Semenova, Alexander D. Kulagin, Ludmila S. Zubarovskaya

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_EN"]=> array(36) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28623" ["VALUE"]=> array(2) { ["TEXT"]=> string(807) "<p>RM Gorbacheva Research Institute of Pediatric Oncology, Hematology and Transplantology, Pavlov University, St. Petersburg, Russia</p><br> <p><b>Correspondence:</b><br> Dr. Liubov A. Tsvetkova, RM Gorbacheva Memorial Research Institute of Pediatric Oncology, Hematology and Transplantology, Pavlov University, L. Tolstoy St. 6-8, 197022, St. Petersburg, Russia<br> Phone: +7 (921) 643-39-05<br> E-mail: tsvetluibov@mail.ru</p><br> <p><b>Citation:</b> Tsvetkova LA, Paina OV, Kozhokar' PV, et al. Combined adoptive immunotherapy with Blinatumomab and donor lymphocyte infusions in children with relapsed/refractory B-ALL after allogeneic stem cells transplantation. Cell Ther Transplant 2022; 11(2): 31-38. </p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(717) "

RM Gorbacheva Research Institute of Pediatric Oncology, Hematology and Transplantology, Pavlov University, St. Petersburg, Russia

Correspondence:
Dr. Liubov A. Tsvetkova, RM Gorbacheva Memorial Research Institute of Pediatric Oncology, Hematology and Transplantology, Pavlov University, L. Tolstoy St. 6-8, 197022, St. Petersburg, Russia
Phone: +7 (921) 643-39-05
E-mail: tsvetluibov@mail.ru

Citation: Tsvetkova LA, Paina OV, Kozhokar' PV, et al. Combined adoptive immunotherapy with Blinatumomab and donor lymphocyte infusions in children with relapsed/refractory B-ALL after allogeneic stem cells transplantation. Cell Ther Transplant 2022; 11(2): 31-38.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_EN"]=> array(36) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28624" ["VALUE"]=> array(2) { ["TEXT"]=> string(1810) "<p style="text-align: justify;">Allo-HSCT is potential curative option for high-risk pediatric B-cell acute leukemia (B-ALL), nevertheless about 30-70% of patients relapsed after allo-HSCT. Patients with relapsed/refractory (r/r) B-ALL have a dismal prognosis with 3-year probability overall survival (OS) about 20%. In this study we firstly appreciated efficacy and safety of combined adoptive immunotherapy with bispecific T-cell engager Blinatumomab and donor lymphocyte infusions (DLI) for 17 children underwent allo-HSCT and having relapse or minimal residual disease (MRD) after that. Fifteen (88%) of patients achieved a complete remission within the first 2 cycles of treatment with blinatumomab and DLI. The median relapse-free survival was 9.1 months (95% CI, 3.0 to 37.2 months) in patients who achieved CR, with the median duration follow up 13,3 months (95% CI, 10.0 to 30.3 months). The median overall survival for all patients was not reached at a median follow-up of 13.3 months (95% CI, 8.8 to 27.4 months). The Kaplan-Meier estimate overall survival was 76.5% (95% CI, 44%-92%) at a median follow-up time 13,3 months. Three children (18%) experienced drug-related adverse events grade 3 and two children (12%) had clinically significant induced "graft- versus-host disease" (GVHD). There were no fatal cases due to the therapy. Further immunotherapy options for r/r pediatric ALL may include repeated courses of combined adoptive immunotherapy, monotherapy of escalated DLI, chimeric antigen receptor T-cell therapies, checkpoint inhibitors or undergo second allo-HSCT. </p> <h2>Keywords</h2> <p style="text-align: justify;">B-cell acute leukemia, children, relapse, allo-HSCT, blinatumomab, donor lymphocyte infusions.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1744) "

Allo-HSCT is potential curative option for high-risk pediatric B-cell acute leukemia (B-ALL), nevertheless about 30-70% of patients relapsed after allo-HSCT. Patients with relapsed/refractory (r/r) B-ALL have a dismal prognosis with 3-year probability overall survival (OS) about 20%. In this study we firstly appreciated efficacy and safety of combined adoptive immunotherapy with bispecific T-cell engager Blinatumomab and donor lymphocyte infusions (DLI) for 17 children underwent allo-HSCT and having relapse or minimal residual disease (MRD) after that. Fifteen (88%) of patients achieved a complete remission within the first 2 cycles of treatment with blinatumomab and DLI. The median relapse-free survival was 9.1 months (95% CI, 3.0 to 37.2 months) in patients who achieved CR, with the median duration follow up 13,3 months (95% CI, 10.0 to 30.3 months). The median overall survival for all patients was not reached at a median follow-up of 13.3 months (95% CI, 8.8 to 27.4 months). The Kaplan-Meier estimate overall survival was 76.5% (95% CI, 44%-92%) at a median follow-up time 13,3 months. Three children (18%) experienced drug-related adverse events grade 3 and two children (12%) had clinically significant induced "graft- versus-host disease" (GVHD). There were no fatal cases due to the therapy. Further immunotherapy options for r/r pediatric ALL may include repeated courses of combined adoptive immunotherapy, monotherapy of escalated DLI, chimeric antigen receptor T-cell therapies, checkpoint inhibitors or undergo second allo-HSCT.

Keywords

B-cell acute leukemia, children, relapse, allo-HSCT, blinatumomab, donor lymphocyte infusions.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["NAME_EN"]=> array(36) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28620" ["VALUE"]=> string(167) "Combined adoptive immunotherapy with Blinatumomab and donor lymphocyte infusions in children with relapsed/refractory B-ALL after allogeneic stem cells transplantation" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(167) "Combined adoptive immunotherapy with Blinatumomab and donor lymphocyte infusions in children with relapsed/refractory B-ALL after allogeneic stem cells transplantation" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" } ["FULL_TEXT_RU"]=> array(36) { ["ID"]=> string(2) "42" ["TIMESTAMP_X"]=> string(19) "2015-09-07 20:29:18" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(23) "Полный текст" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(12) "FULL_TEXT_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "42" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(23) "Полный текст" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["PDF_RU"]=> array(36) { ["ID"]=> string(2) "43" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF RUS" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_RU" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "43" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28621" ["VALUE"]=> string(4) "2830" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2830" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF RUS" ["~DEFAULT_VALUE"]=> string(0) "" } ["PDF_EN"]=> array(36) { ["ID"]=> string(2) "44" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF ENG" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "44" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28625" ["VALUE"]=> string(4) "2835" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2835" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF ENG" ["~DEFAULT_VALUE"]=> string(0) "" } ["NAME_LONG"]=> array(36) { ["ID"]=> string(2) "45" ["TIMESTAMP_X"]=> string(19) "2023-04-13 00:55:00" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(72) "Название (для очень длинных заголовков)" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "NAME_LONG" ["DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "45" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(80) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(72) "Название (для очень длинных заголовков)" ["~DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } } } ["DISPLAY_PROPERTIES"]=> array(10) { ["AUTHOR_EN"]=> array(37) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28622" ["VALUE"]=> array(2) { ["TEXT"]=> string(208) "<p>Liubov A. Tsvetkova, Olesya V. Paina, Polina V. Kozhokar’, Аnastasia S. Frolova, Zhemal Z. Rakhmanova, Elena V. Babenko, Elena V. Semenova, Alexander D. Kulagin, Ludmila S. Zubarovskaya</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(196) "

Liubov A. Tsvetkova, Olesya V. Paina, Polina V. Kozhokar’, Аnastasia S. Frolova, Zhemal Z. Rakhmanova, Elena V. Babenko, Elena V. Semenova, Alexander D. Kulagin, Ludmila S. Zubarovskaya

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(196) "

Liubov A. Tsvetkova, Olesya V. Paina, Polina V. Kozhokar’, Аnastasia S. Frolova, Zhemal Z. Rakhmanova, Elena V. Babenko, Elena V. Semenova, Alexander D. Kulagin, Ludmila S. Zubarovskaya

" } ["SUMMARY_EN"]=> array(37) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28624" ["VALUE"]=> array(2) { ["TEXT"]=> string(1810) "<p style="text-align: justify;">Allo-HSCT is potential curative option for high-risk pediatric B-cell acute leukemia (B-ALL), nevertheless about 30-70% of patients relapsed after allo-HSCT. Patients with relapsed/refractory (r/r) B-ALL have a dismal prognosis with 3-year probability overall survival (OS) about 20%. In this study we firstly appreciated efficacy and safety of combined adoptive immunotherapy with bispecific T-cell engager Blinatumomab and donor lymphocyte infusions (DLI) for 17 children underwent allo-HSCT and having relapse or minimal residual disease (MRD) after that. Fifteen (88%) of patients achieved a complete remission within the first 2 cycles of treatment with blinatumomab and DLI. The median relapse-free survival was 9.1 months (95% CI, 3.0 to 37.2 months) in patients who achieved CR, with the median duration follow up 13,3 months (95% CI, 10.0 to 30.3 months). The median overall survival for all patients was not reached at a median follow-up of 13.3 months (95% CI, 8.8 to 27.4 months). The Kaplan-Meier estimate overall survival was 76.5% (95% CI, 44%-92%) at a median follow-up time 13,3 months. Three children (18%) experienced drug-related adverse events grade 3 and two children (12%) had clinically significant induced "graft- versus-host disease" (GVHD). There were no fatal cases due to the therapy. Further immunotherapy options for r/r pediatric ALL may include repeated courses of combined adoptive immunotherapy, monotherapy of escalated DLI, chimeric antigen receptor T-cell therapies, checkpoint inhibitors or undergo second allo-HSCT. </p> <h2>Keywords</h2> <p style="text-align: justify;">B-cell acute leukemia, children, relapse, allo-HSCT, blinatumomab, donor lymphocyte infusions.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1744) "

Allo-HSCT is potential curative option for high-risk pediatric B-cell acute leukemia (B-ALL), nevertheless about 30-70% of patients relapsed after allo-HSCT. Patients with relapsed/refractory (r/r) B-ALL have a dismal prognosis with 3-year probability overall survival (OS) about 20%. In this study we firstly appreciated efficacy and safety of combined adoptive immunotherapy with bispecific T-cell engager Blinatumomab and donor lymphocyte infusions (DLI) for 17 children underwent allo-HSCT and having relapse or minimal residual disease (MRD) after that. Fifteen (88%) of patients achieved a complete remission within the first 2 cycles of treatment with blinatumomab and DLI. The median relapse-free survival was 9.1 months (95% CI, 3.0 to 37.2 months) in patients who achieved CR, with the median duration follow up 13,3 months (95% CI, 10.0 to 30.3 months). The median overall survival for all patients was not reached at a median follow-up of 13.3 months (95% CI, 8.8 to 27.4 months). The Kaplan-Meier estimate overall survival was 76.5% (95% CI, 44%-92%) at a median follow-up time 13,3 months. Three children (18%) experienced drug-related adverse events grade 3 and two children (12%) had clinically significant induced "graft- versus-host disease" (GVHD). There were no fatal cases due to the therapy. Further immunotherapy options for r/r pediatric ALL may include repeated courses of combined adoptive immunotherapy, monotherapy of escalated DLI, chimeric antigen receptor T-cell therapies, checkpoint inhibitors or undergo second allo-HSCT.

Keywords

B-cell acute leukemia, children, relapse, allo-HSCT, blinatumomab, donor lymphocyte infusions.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(1744) "

Allo-HSCT is potential curative option for high-risk pediatric B-cell acute leukemia (B-ALL), nevertheless about 30-70% of patients relapsed after allo-HSCT. Patients with relapsed/refractory (r/r) B-ALL have a dismal prognosis with 3-year probability overall survival (OS) about 20%. In this study we firstly appreciated efficacy and safety of combined adoptive immunotherapy with bispecific T-cell engager Blinatumomab and donor lymphocyte infusions (DLI) for 17 children underwent allo-HSCT and having relapse or minimal residual disease (MRD) after that. Fifteen (88%) of patients achieved a complete remission within the first 2 cycles of treatment with blinatumomab and DLI. The median relapse-free survival was 9.1 months (95% CI, 3.0 to 37.2 months) in patients who achieved CR, with the median duration follow up 13,3 months (95% CI, 10.0 to 30.3 months). The median overall survival for all patients was not reached at a median follow-up of 13.3 months (95% CI, 8.8 to 27.4 months). The Kaplan-Meier estimate overall survival was 76.5% (95% CI, 44%-92%) at a median follow-up time 13,3 months. Three children (18%) experienced drug-related adverse events grade 3 and two children (12%) had clinically significant induced "graft- versus-host disease" (GVHD). There were no fatal cases due to the therapy. Further immunotherapy options for r/r pediatric ALL may include repeated courses of combined adoptive immunotherapy, monotherapy of escalated DLI, chimeric antigen receptor T-cell therapies, checkpoint inhibitors or undergo second allo-HSCT.

Keywords

B-cell acute leukemia, children, relapse, allo-HSCT, blinatumomab, donor lymphocyte infusions.

" } ["DOI"]=> array(37) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28619" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-31-38" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-31-38" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-31-38" } ["NAME_EN"]=> array(37) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28620" ["VALUE"]=> string(167) "Combined adoptive immunotherapy with Blinatumomab and donor lymphocyte infusions in children with relapsed/refractory B-ALL after allogeneic stem cells transplantation" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(167) "Combined adoptive immunotherapy with Blinatumomab and donor lymphocyte infusions in children with relapsed/refractory B-ALL after allogeneic stem cells transplantation" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(167) "Combined adoptive immunotherapy with Blinatumomab and donor lymphocyte infusions in children with relapsed/refractory B-ALL after allogeneic stem cells transplantation" } ["ORGANIZATION_EN"]=> array(37) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28623" ["VALUE"]=> array(2) { ["TEXT"]=> string(807) "<p>RM Gorbacheva Research Institute of Pediatric Oncology, Hematology and Transplantology, Pavlov University, St. Petersburg, Russia</p><br> <p><b>Correspondence:</b><br> Dr. Liubov A. Tsvetkova, RM Gorbacheva Memorial Research Institute of Pediatric Oncology, Hematology and Transplantology, Pavlov University, L. Tolstoy St. 6-8, 197022, St. Petersburg, Russia<br> Phone: +7 (921) 643-39-05<br> E-mail: tsvetluibov@mail.ru</p><br> <p><b>Citation:</b> Tsvetkova LA, Paina OV, Kozhokar' PV, et al. Combined adoptive immunotherapy with Blinatumomab and donor lymphocyte infusions in children with relapsed/refractory B-ALL after allogeneic stem cells transplantation. Cell Ther Transplant 2022; 11(2): 31-38. </p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(717) "

RM Gorbacheva Research Institute of Pediatric Oncology, Hematology and Transplantology, Pavlov University, St. Petersburg, Russia

Correspondence:
Dr. Liubov A. Tsvetkova, RM Gorbacheva Memorial Research Institute of Pediatric Oncology, Hematology and Transplantology, Pavlov University, L. Tolstoy St. 6-8, 197022, St. Petersburg, Russia
Phone: +7 (921) 643-39-05
E-mail: tsvetluibov@mail.ru

Citation: Tsvetkova LA, Paina OV, Kozhokar' PV, et al. Combined adoptive immunotherapy with Blinatumomab and donor lymphocyte infusions in children with relapsed/refractory B-ALL after allogeneic stem cells transplantation. Cell Ther Transplant 2022; 11(2): 31-38.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(717) "

RM Gorbacheva Research Institute of Pediatric Oncology, Hematology and Transplantology, Pavlov University, St. Petersburg, Russia

Correspondence:
Dr. Liubov A. Tsvetkova, RM Gorbacheva Memorial Research Institute of Pediatric Oncology, Hematology and Transplantology, Pavlov University, L. Tolstoy St. 6-8, 197022, St. Petersburg, Russia
Phone: +7 (921) 643-39-05
E-mail: tsvetluibov@mail.ru

Citation: Tsvetkova LA, Paina OV, Kozhokar' PV, et al. Combined adoptive immunotherapy with Blinatumomab and donor lymphocyte infusions in children with relapsed/refractory B-ALL after allogeneic stem cells transplantation. Cell Ther Transplant 2022; 11(2): 31-38.

" } ["AUTHOR_RU"]=> array(37) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28616" ["VALUE"]=> array(2) { ["TEXT"]=> string(335) "<p>Любовь А. Цветкова, Олеся В. Паина, Полина В. Кожокарь, Анастасия С. Фролова, Жемал З. Рахманова, Елена В. Бабенко, Елена В. Семенова, Александр Д. Кулагин, Людмила С. Зубаровская</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(323) "

Любовь А. Цветкова, Олеся В. Паина, Полина В. Кожокарь, Анастасия С. Фролова, Жемал З. Рахманова, Елена В. Бабенко, Елена В. Семенова, Александр Д. Кулагин, Людмила С. Зубаровская

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(323) "

Любовь А. Цветкова, Олеся В. Паина, Полина В. Кожокарь, Анастасия С. Фролова, Жемал З. Рахманова, Елена В. Бабенко, Елена В. Семенова, Александр Д. Кулагин, Людмила С. Зубаровская

" } ["SUBMITTED"]=> array(37) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28614" ["VALUE"]=> string(22) "06/21/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "06/21/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "06/21/2022 12:00:00 am" } ["ACCEPTED"]=> array(37) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28615" ["VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "07/05/2022 12:00:00 am" } ["SUMMARY_RU"]=> array(37) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28618" ["VALUE"]=> array(2) { ["TEXT"]=> string(3409) "<p style="text-align: justify;">Алло-ТГСК является потенциально излечивающим методом терапии детей с В лимфобластным лейкозом (В-ОЛЛ) группы высокого риска. Тем не менее, примерно у 30-70% пациентов возникает рецидив после алло-ТГСК. Пациенты с рецидивирующим/ рефрактерным течением В-ОЛЛ имеют неблагоприятный прогноз с 3-летней общей выживаемостью (ОВ) около 20%. В этом исследовании мы впервые оценили эффективность и безопасность комбинированной адоптивной иммунотерапии биспецифическим активатором Т-клеток блинатумомабом и инфузиями донорских лимфоцитов (ИДЛ) у 17 детей, перенесших алло-ТГСК и имевших после этого рецидив или персистенцию минимальной остаточной болезни. Пятнадцать (88%) пациентов достигли ремиссии в течение первых 2 циклов лечения блинатумомабом +ИДЛ. Медиана безрецидивной выживаемости составила 9,1 мес (95% ДИ, от 3,0 до 37,2 мес.) у пациентов, достигших ответа, с медианой наблюдения 13,3 мес. (95% ДИ, 10,0-30,3 мес.). Медиана OB для всех пациентов не была достигнута при медиане наблюдения 13,3 месяца (95% ДИ, от 8,8 до 27,4 месяцев). ОВ по Каплану-Мейеру составила 76,5% (95% ДИ, 44-92%) при медиане наблюдения 13,3 месяца. Трое детей (18%) развили нежелательные явления 3-й степени тяжести, связанные с введением препарата, и двое детей (12%) имели клинически значимую индуцированную реакцию «трансплантат против хозяина» (РТПХ). Летальных случаев, связанных с терапией, отмечено не было. Дальнейшие варианты иммунотерапии детей с рецидивирующим течением В-ОЛЛ могут включать продолжение курсов комбинированной адоптивной иммунотерапии, монотерапию ИДЛ в эскалированных дозах, терапию Т-клетками с антигенным химерным рецептором, ингибиторами контрольных точек, а также проведение повторной алло-ТГСК.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">В-клеточный острый лимфобластный лейкоз, дети, рецидив, алло-ТГСК, блинатумомаб, инфузии донорских лимфоцитов.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(3353) "

Алло-ТГСК является потенциально излечивающим методом терапии детей с В лимфобластным лейкозом (В-ОЛЛ) группы высокого риска. Тем не менее, примерно у 30-70% пациентов возникает рецидив после алло-ТГСК. Пациенты с рецидивирующим/ рефрактерным течением В-ОЛЛ имеют неблагоприятный прогноз с 3-летней общей выживаемостью (ОВ) около 20%. В этом исследовании мы впервые оценили эффективность и безопасность комбинированной адоптивной иммунотерапии биспецифическим активатором Т-клеток блинатумомабом и инфузиями донорских лимфоцитов (ИДЛ) у 17 детей, перенесших алло-ТГСК и имевших после этого рецидив или персистенцию минимальной остаточной болезни. Пятнадцать (88%) пациентов достигли ремиссии в течение первых 2 циклов лечения блинатумомабом +ИДЛ. Медиана безрецидивной выживаемости составила 9,1 мес (95% ДИ, от 3,0 до 37,2 мес.) у пациентов, достигших ответа, с медианой наблюдения 13,3 мес. (95% ДИ, 10,0-30,3 мес.). Медиана OB для всех пациентов не была достигнута при медиане наблюдения 13,3 месяца (95% ДИ, от 8,8 до 27,4 месяцев). ОВ по Каплану-Мейеру составила 76,5% (95% ДИ, 44-92%) при медиане наблюдения 13,3 месяца. Трое детей (18%) развили нежелательные явления 3-й степени тяжести, связанные с введением препарата, и двое детей (12%) имели клинически значимую индуцированную реакцию «трансплантат против хозяина» (РТПХ). Летальных случаев, связанных с терапией, отмечено не было. Дальнейшие варианты иммунотерапии детей с рецидивирующим течением В-ОЛЛ могут включать продолжение курсов комбинированной адоптивной иммунотерапии, монотерапию ИДЛ в эскалированных дозах, терапию Т-клетками с антигенным химерным рецептором, ингибиторами контрольных точек, а также проведение повторной алло-ТГСК.

Ключевые слова

В-клеточный острый лимфобластный лейкоз, дети, рецидив, алло-ТГСК, блинатумомаб, инфузии донорских лимфоцитов.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(3353) "

Алло-ТГСК является потенциально излечивающим методом терапии детей с В лимфобластным лейкозом (В-ОЛЛ) группы высокого риска. Тем не менее, примерно у 30-70% пациентов возникает рецидив после алло-ТГСК. Пациенты с рецидивирующим/ рефрактерным течением В-ОЛЛ имеют неблагоприятный прогноз с 3-летней общей выживаемостью (ОВ) около 20%. В этом исследовании мы впервые оценили эффективность и безопасность комбинированной адоптивной иммунотерапии биспецифическим активатором Т-клеток блинатумомабом и инфузиями донорских лимфоцитов (ИДЛ) у 17 детей, перенесших алло-ТГСК и имевших после этого рецидив или персистенцию минимальной остаточной болезни. Пятнадцать (88%) пациентов достигли ремиссии в течение первых 2 циклов лечения блинатумомабом +ИДЛ. Медиана безрецидивной выживаемости составила 9,1 мес (95% ДИ, от 3,0 до 37,2 мес.) у пациентов, достигших ответа, с медианой наблюдения 13,3 мес. (95% ДИ, 10,0-30,3 мес.). Медиана OB для всех пациентов не была достигнута при медиане наблюдения 13,3 месяца (95% ДИ, от 8,8 до 27,4 месяцев). ОВ по Каплану-Мейеру составила 76,5% (95% ДИ, 44-92%) при медиане наблюдения 13,3 месяца. Трое детей (18%) развили нежелательные явления 3-й степени тяжести, связанные с введением препарата, и двое детей (12%) имели клинически значимую индуцированную реакцию «трансплантат против хозяина» (РТПХ). Летальных случаев, связанных с терапией, отмечено не было. Дальнейшие варианты иммунотерапии детей с рецидивирующим течением В-ОЛЛ могут включать продолжение курсов комбинированной адоптивной иммунотерапии, монотерапию ИДЛ в эскалированных дозах, терапию Т-клетками с антигенным химерным рецептором, ингибиторами контрольных точек, а также проведение повторной алло-ТГСК.

Ключевые слова

В-клеточный острый лимфобластный лейкоз, дети, рецидив, алло-ТГСК, блинатумомаб, инфузии донорских лимфоцитов.

" } ["ORGANIZATION_RU"]=> array(37) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28617" ["VALUE"]=> array(2) { ["TEXT"]=> string(373) "<p>НИИ детской онкологии, гематологии и трансплантологии им. Р. М. Горбачевой, Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(361) "

НИИ детской онкологии, гематологии и трансплантологии им. Р. М. Горбачевой, Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(361) "

НИИ детской онкологии, гематологии и трансплантологии им. Р. М. Горбачевой, Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия

" } } } [3]=> array(49) { ["IBLOCK_SECTION_ID"]=> string(3) "212" ["~IBLOCK_SECTION_ID"]=> string(3) "212" ["ID"]=> string(4) "2061" ["~ID"]=> string(4) "2061" ["IBLOCK_ID"]=> string(1) "2" ["~IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(288) "Спектр бронхоальвеолярной бактериальной микробиоты после трансплантации гемопоэтических стволовых клеток: возрастная зависимость и нарушения микробиоты" ["~NAME"]=> string(288) "Спектр бронхоальвеолярной бактериальной микробиоты после трансплантации гемопоэтических стволовых клеток: возрастная зависимость и нарушения микробиоты" ["ACTIVE_FROM"]=> NULL ["~ACTIVE_FROM"]=> NULL ["TIMESTAMP_X"]=> string(22) "08/09/2022 01:30:59 pm" ["~TIMESTAMP_X"]=> string(22) "08/09/2022 01:30:59 pm" ["DETAIL_PAGE_URL"]=> string(149) "/en/archive/tom-11-nomer-2/klinicheskie-raboty/spektr-bronkhoalveolyarnoy-bakterialnoy-mikrobioty-posle-transplantatsii-gemopoeticheskikh-stvolovykh/" ["~DETAIL_PAGE_URL"]=> string(149) "/en/archive/tom-11-nomer-2/klinicheskie-raboty/spektr-bronkhoalveolyarnoy-bakterialnoy-mikrobioty-posle-transplantatsii-gemopoeticheskikh-stvolovykh/" ["LIST_PAGE_URL"]=> string(12) "/en/archive/" ["~LIST_PAGE_URL"]=> string(12) "/en/archive/" ["DETAIL_TEXT"]=> string(33117) "

Introduction

Microbial, fungal and viral communities of bronchial and alveolar surfaces are closely related to microbiota of upper airways and oropharyngeal mucosa. Therefore, their microbiological variability shows sufficient intercorrelations [1]. In healthy persons, the microbial composition in lungs closely matches the upper respiratory tract (URT), especially in periglottic region. The total contents of bacteria are gradually decreasing from upper respiratory ways to the lower bronchoalveolar structures [2].

Meanwhile, in severe pneumonias, the clinically relevant changes of lung microbiota are generally, assessed by analy-sis of bronchoalveolar lavage (BAL) sampled during diagnostic bronchoscopy, thus representing a direct and efficient way to get a reliable etiological diagnosis in suggested infectious complications. Along with bacteriological studies, a number of viral pathogens are routinely detected, mainly, by PCR techniques or immunohistochemistry, whereas fungal infections could be suggested by specific polysaccharide antigens, or direct cultures. The bacterial diversity may be assayed both by classical cultural methods, and by modern DNA deep sequencing methods.

In particular, a range of techniques could be used for the search of opportunistic pathogenic bacteria in bronchoalveolar samples. E.g., Gaibani et al. [3] examined the BAL specimens from 24 patients with post-COVID pneumonia. The samples were cultured on conventional selective agar plates. The species of bacterial isolates were identified by MALDI-TOF mass-spectrometry, and in vitro antimicrobial susceptibility was tested by routine methods. Moreover, V3 to V4 region of the standard 16S rRNA gene was subjected to PCR, the resulting amplicon libraries were sequenced using MySec platform by means of next-generation sequencing (NGS). In summary, the lung microbiome of these patients showed predominance of Pseudomonas spp. (25%), Enterobacteriaceae (19%), Streptococcaceae (12%), Staphylococcaceae (11%). In particular, the DNA sequences of Klebsiella spp. (7%), Enterococci (5%), and Prevotella (4%) were also detected.

A number of patients with systemic malignant disorders present with polymicrobial airway colonization caused by preceding cytostatic therapy resulting into severe immune deficiency. Bronchoscopic examination of 436 consecutive adult patients with hematological malignancies and pulmonary infiltrates had revealed infectious agents in BAL of 219 patients of them 45 (20.5%), with microbial colonization, 39 of them with two pathogens, and 6 with three agents [4]. Aspergillus spp. was the most common co-pathogen identified. The authors have confirmed a more severe clinical course and higher hospital mortality in the patients with polymicrobial pulmonary infections.

A sufficient issue concerns relative diagnostic value of classical bacterial cultures and DNA-based NGS diagnostics. Such studies are now underway. E.g., direct comparisons between the diagnostic significance of was performed by a Chinese team who have enrolled a group of severe community-acquired pneumonia (SCAP) patients admitted to intensive care unit (ICU). BAL samples were taken by bronchoscopy within 48 h of ICU admission [5]. The isolated DNA was sequenced in the V3-V4 hypervariable region of the 16S rRNA gene of all PCR-amplified samples by means of Illumina Miseq platform. The multivariate analysis of variance has shown that positive bacteria lab test results had the strongest independent association with lung microbiota (P=0.018), thus confirming permanent diagnostic value of standard clinical culture of bacterial microbiota.

A number of studies concerned total contents and species diversity of lung microbiota in HSCT patients. Currently, the pre-transplant diagnostics of infectious respiratory disorders in the patients planned for HSCT is based on complex examination including pulmonary function tests (PFT), chest high-resolution computed tomography (HRCT), and laboratory examination of available BAL samples [6]. The authors have examined 142 children that should be subjected to HSCT. Different abnormalities were revealed in 74% of patients, mostly, for subnormal PFT tests. Chest HRCT showed clinically significant disturbances in 19% of the cases. BAL microbiota was abnormal in 43% of patients; respiratory viruses (PCR) were found in 35 patients, fungi (antigen or culture) in 21, and bacteria (culture) in 22. Prognostic value of these disorders could influence subsequent treatment approaches.

In the patients undergoing HSCT, severe impairement of lung microbiota is observed, due to transient cytopenia, immunocompromised state and massive antibiotic prophylaxis at early terms posttransplant. Early and late pulmonary infections post-HSCT are well known and described in details as reviewed by Astaschanka et al. [7].

The BAL microbiology, may yield a variety of common bacterial agents S. aureus, E.coli, coagulase-negative staphylococci, Enterococci spp., P.aeruginosa, Klebsiella pneumonia etc. Additional PCR and antigen assays revealed multiple viral and fungal species. E.g., BAL samples taken after hematopoietic transplants may often contain a number of different bacterial, fungal and viral species, sometimes, presenting mixed infection [8]. Fungal species, especially, Aspergillus, is a common finding in BAL samples taken from HSCT patients [9].

Similar study was carried out in 193 children and adolescents who underwent myeloablative conditioning and HSCT has revealed mixed microbiota [10]. Of them, 34% underwent bronchoscopy with a total of 101 BAL samples, mostly after allogeneic HSCT (allo-HSCT). The lung-derived samples were tested for bacterial, fungal and viral infectious pathogens using staining and culture methods. 40% of samples proved to be positive, with a majority showing bacterial pathogen as well as fungal and viral agents. In particular, the diagnostic assays revealed Mycobacteria, S. epidermidis, vancomycin-resistant enterococci, coagulase-negative staphylococci, P.aeruginosa, Legionells, Serratia, Streptococcus spp., Enterococcus faecium, Lactobacilli spp.

Despite recent advent of novel DNA-sequencing approaches, the classical bacteriological evaluation of biological samples retains its diagnostic value, in particular due to its ability to assess antibiotic resistance of microbial isolates. Hence, the aim of this study was a comparative evaluation of aerobic and facultative anaerobic microbiota components in bronchoalveolar lavage samples taken in immunocompromised patients with infectious lung complications which developed after intensive chemotherapy, antibiotic therapy and subsequent hematopoietic stem cell transplantation (HSCT).

Materials and methods

Our study included clinical and laboratory data of 691 patients subjected to hematopoietic stem cell transplantation (HSCT) 2013 through 2020, aged from 1 to 71 years (a mean of 38.5+ 23.9).

Distribution of BAL samples by distinct disorders was as follows: acute lymphoid leukemia (ALL, n=232 samples); acute myeloid leukemia (AML, n=331); aplastic and refractory anemias (AA, n=104); Hodgkin disease (HD, n=163); chronic myeloid leukemia (CML, n=79); non-Hodgkin lymphomas (NHL, n=63), other malignant and inherited disorders (n=58).

Myeloablative and non-myeloablative conditioning regimens for HSCT were carried out in 44% and 56% of cases, respectively. Stem cells were obtained from bone marrow or peripheral blood 497 : 596).

The types of HSCT were as follows: related compatible donors (19.2%); related haploidentical donors (21.6%); unrelated compatible donors (49.1%); autologous transplants (10.2%).

The doses of transfused CD34+ cells widely varied from 0.8 to 18×10⁶ cells /kg body weight.

Prophylaxis of graft-versus-host disease was mostly, performed by the posttransplant cyclophosphamide (PtCy) as well cyclosporin A, tacrolimus, sirolimus and glucocorticosteroids.

For statistical analysis, the groups of patients were also divided by age: 0-5 years (group 1, n=79); 6-14 children (group 2, n=129); 15-21 years old (group 3, n=194); >22 years (group 4, n=720). Moreover, the results of bacteriological examination were classified by terms post-transplant, starting from <100 days before HSCT (point 0); during the 1^st month (point 1); 2^nd month (point 2); 3^rd month (point 3), etc., up to 6 months after HSCT (point 6).

In the course of conditioning treatment and HSCT, the patients obtained antibiotic prophylaxis including administration of fluoroquinolones from D+1 to D+60. Amoxicillin was also administered, especially, to children. In cases of posttransplant febrile neutropenia, empirical therapy with broad-spectrum antibiotics was prescribed. Upon isolation of antibiotic-resistant microbial strains, the treatment was changed to other antibiotics (per os or intravenously) as guided by the in vitro testing of microbial sensitivity.

A total of 1123 samples of bronchoalveolar lavage were collected by means of diagnostic bronchoscopy within D-100 to D+180 post-HSCT. The endoscopy was performed according to appropriate clinical indications as prescribed by the attending doctor and intensive care specialist. Written informed consent for the procedure was obtained from the patients or their guardians.

Inoculation of laboratory cultures and isolation of bacteria from the BAL samples were made to differential culture media by classical bacteriological techniques. The isolated microorganisms were identified by means of commercial biochemical test systems (BBL Crystal), as well as with MALDI-TOF mass spectrometry using VITEK MS instrument. The sensitivity of clinical isolates to antibiotics was determined by means of disk diffusion test systems. The results of microbial sensitivity tests were interpreted according to the Guidelines of European Committee on Antimicrobial Susceptibility Testing (EUCAST) criteria.

Statistical evaluation of results was performed using parametric and nonparametric statistic criteria, to analyze time- and age-dependent course of the bacterial landscape revealed by microbial cultures, and for distinct microbial associations after HSCT using the STATISTICA 10 program.

Results

The detection rates for distinct cultured bacterial species among the total BAL sample massive was as follows: bacteria of Enterobacterales order were revealed in 25% of the samples (280/1123), with Klebsiella pneumoniae (19.1%, 215/1123) being prevailing species, whereas Escherichia coli (2.5%) and Enterobacter spp. (2.3%) were detected at similarly low rates (28/1123 and 26/1123, respectively. The incidence of Citrobacter spp., Proteus mirabilis, Serratia marcescens did not exceed 1%. Among Gram-negative, non-fermenting bacteria, Pseudomonas aeruginosa was detected in 5% of BAL specimens (56/1123). In particular, P. аeruginosa v. non mucosa, and v. mucosa were found at similar rates (29/1123 и 27/1123). Other Pseudomonas species were isolated in 4.5% (51/1123); Acinetobacter spp., 3.7% (41/1123); Stenotrophomonas maltophilia, 2.1% (24/1123). The ratio of coagulase-negative staphylococci was 5.6% (63/1123), of them Staphylococcus epidermidis was found in 4.2% (47/1123). Staphylococcus aureus was isolated in 4.5% of the samples (51/1123). Streptococcus spp. was revealed in 20.7% (233/1123 samples) including Streptococcus viridans group (15.7%, 176/1123); Streptococcus pneumoniae (1.5%, 17/1123). Enterococci encountered in 12.4% of BAL samples (139/1123), of them Enterococcus faecium was identified in 7.0% (79/1123); Enterococcus faecalis, in 5.3% (60/1123). Different Candida species were found in 14% of the BAL specimens (157/1123), as a rule, within microbial associations; the incidence of Haemophilus spp. was 0.9% (10/1123).

Detection rates for the most common bacterial species as classified by the age of patients are shown in Fig. 1. Of note, the seeding rates for S.viridans, a common member of normal mucosal microbiota, tended to decrease with age, reaching a significant decline in adolescents of >15 years old and adult patients (p<0.01). Meanwhile, the rates of Klebsiella detection, in our experience, proved to be relatively high in all studied age groups.

Figure 1. Age dependence of bacterial seeding rates for the dominant bacterial species in bronchoalveolar lavage of oncohematological patients both before and after HSCT (group 1: 0-5 years; group 2: 6-14 years; group 3: 15-21 years; group 4: >22 years. A, S.epidermidis; B, S.viridans; C, Klebsiella spp. Abscissa, age groups (group 1, 0-5 y.o.; group 2, 6-14 y.o.; group 3, 15-21 y.o.; group 4, >22 y.o. Ordinate, ratio of positive microbial findings.

To prove the trends of posttransplant microbial colonization, we have assessed time dynamics for the dominant bacterial species within 6 months after HSCT (Fig. 2).

As seen from Fig. 2A, the S.epidermidis seeding frequency did not sufficiently change over time posttransplant (a mean of 10-18%). By contrary, S.viridans detection rates dropped ca. 2-fold during 1^st month after HSCT (approx. from 30% to 10%), probably, due to intensive antibiotic prophylaxis over the period of transient cytopenia (p<0.02). Meanwhile, the most interesting finding concerned posttransplant changes in Klebsiella spp. detection. Its low seeding rates before HSCT and over 1^st month posttransplant (3 to 5%) were followed by sharply increased emergence of this commensal bacteria at later terms after HSCT (2 to 6 months), as seen from Fig. 2C (p<0.001). Interestingly, its detection was not affected by antibiotic treatment during early posttransplant period and additional antibacterial treatment due to presumed infectious complications requiring bronchoscopy and BAL sampling.

Figure 2. Frequency of S.epidermidis (A); S.viridans (B), and Klebsiella spp. (C) detection in bronchoalveolar lavage of oncohematololgical patients collected at various times after HSCT. Abscissa, terms post-HSCT (months); ordinate, ratio of positive microbial findings.

Antibiotic resistance was tested for all bacterial isolates derived from the BAL samples. Figures 3 to 8 depict the resistance patterns of the leading BAL microbiota members obtained from the subjected to HSCT between 2013 and 2020. Antibiotic resistance of Klebsiella pneumoniae ssp pneumoniae, was equally high during the entire tine period. It comprised over 80% for III generation cephalosporins, aztreonam, fluoroquinolones and protected aminopenicillins. Carbapenem resistance varied from 33% to imipenem to 54% for meropenem. 96% of the tested isolates were colistin-sensitive. Colistin sensitivity was determined by serial dilutions technique in liquid nutrient medium.

Common detection of K.pneumoniae accomplished by increased resistance rate presume high relevance of this pathogen for development of nosocomial infections in various clinical settings, especially in immunocompromised patients. Within mentioned time period, the meticillin-resistant S.aureus (MRSA) was isolated in 6% of BAL samples, whereas the rate of MRCoNS was 71%. All isolates of Staphylococci proved to be tigecycline-sensitive. Sensitivity of staphylococci to vancomycin was assessed by means of gradient diffusion (Е test). S.aureus showed 100% sensitivity to vancomycin and linezolid. Among the CoNS strains, 2% were resistant for vancomycin, and 5%, for linezolid. The isolates sensitive to linezolid were also considered tedizolid-sensitive. Erythromycin was used to determine sensitivity to azithromycin, clarithromycin, and roxythromycin. Fluorochinolone sensitivity of staphylococci was evaluated by their sensitivity to norfloxacine. The norfloxacin-sensitive strains were considered to be sensitive to moxyfloxacin and, at higher exposure, to ciprofloxacin and levofloxacin. Fluorochinolone sensitivity of S.aureus proved to be 97%, appropriate rate for CoNS was 35%.

Figure 3. Resistance of Klebsiella pneumoniae ssp pneumonia to various antibiotics (biological samples: bronchoalveolar lavage, 2013 to 2020)

The members of Gram-negative non-fermenting bacteria exhibited high resistance levels to carbapenems, i.e., >70% of resistant isolates among Acinetobacter spp., over 50% resistant strains were documented for P.aeruginosa. Colistin sensitivity was as high as 96% for Pseudomonas spp. (two resistant strains from 52 isolates) and 93% for Acinetobacter spp. (one case of resistance of 15).

The Enterococcus isolates from BAL samples have shown 100% resistance rates for linezolid and tigecycline; resistance rate was 3% for vancomycin (4 isolates of 137). 50% of E.faecium isolates proved to be ampicillin-resistant, whereas 92% of E.faecalis isolates remained sensitive to this drug.

Discussion

The significance of bacterial findings in BAL was considered in different transplantological aspects. E.g., a review article by Gudiol et al. [11] was dedicated to Hospital-acquired pneumonia (HAP) which present serious complications in transplant patients. Bacteria are the leading cause of nosocomial pneumonia for both immunocompetent and transplant recipients caused by Gram-negative organisms, and, especially, highly prevalent Pseudomonas aeruginosa. In addition to the usual colonizing microorganisms of the respiratory tract, such as Streptococcus pneumoniae, Branhamella catharralis and Staphylococcus aureus, and various Gram-negative bacilli are an important cause of HAP/VAP in both populations. The most relevant opportunistic pathogens are Aspergillus fumigatus, Pneumocystis jirovecii and cytomegalovirus.

Streptococcus viridians is nearly absent from normal lungs, but it proved to be a common commensal microbe cultured from many BAL samples in the patients with chronic obstructive pulmonary disease, bronchial carcinoma, as well as following tracheostomy [12], thus presuming massive colonization with this species in various chronic respiratory disorders. Rapid bacterial colonization, especially, with S.viridans, S.aureus, P. aeruginosa was observed after bronchial valve implantation in lung emphysema patients [13]. Therefore, predominance of S.viridans in BAL samples both before and after HSCT seems to be a useful marker of chronic lung damage due to massive cytotoxic therapies in oncohematological patients. Increased frequency of S.viridans in younger patients (<15 years old) revealed in our study could be also explained by higher susceptibility of respiratory mucosa in children to previous anticancer treatment.

To our knowledge, there are no published data on the time-dependent changes of Klebsiella spp. in bronchoalveolar lavage following hematopoietic stem cell transplantation. Rather high prevalence of this bacteria was found among the HSCT patients with sinusitis and other disorders of upper respiratory ways at our BMT Center. Interestingly, higher rates of Klebsiella detection were found in the maxillary cavities which represent a common reservoir of pathogenic agents in immunocompromised persons [14].

One may presume that the late activation of Klebsiella on respiratory mucosa may be caused by antibiotic-resistant strains colonizing these areas.

To suggest possible origin of these strains, one may refer a study of 91 BAL specimens obtained from critically ill patients with acute respiratory disorder (ARDS). Next-generation sequencing of bacterial DNA fragments was performed by means of Illumina MiSeq platform [15]. The ARDS-associated sequencing reads were similar to Enterobacteriaceae, including Escherichia coli, Enterobacter spp., and Klebsiella pneumoniae. The authors conclude that lung microbiota in ARDS patients is characterized by relative enrichment with gut-associated species of the Enterobacteriaceae family. Our findings concerning Klebsiella colonization of lower airways confirm these observations and provide evidence for higher risk of gut bacteria migration to other anatomic sites, due to extended septic process. This suggestion was made in our previous review [16].

A complex study of general cytokine responses and NGS-based evaluation of BAL bacterial microbiota in HSCT patients with pneumonias has shown reactive and non-reactive microbiota phenotypes [17, 18]. In the reactive phenotype, Pseudomonas Aeruginosa was the most abundant species, while in the nonreactive phenotype, cytomegalovirus (CMV) predominated. Moreover, other bacteria, S.pneumoniae, S.aureus, Acinetobacter spp., Klebsiella spp., Stenotrophomonas spp. were found in different quantities.

The new sequencing methods are recently applied for analy-sis of BAL microbiota. When comparing relative diagnostic efficiency of conventional bacterial cultures and novel metagenomic next-generation sequencing (mNGS) of BAL samples, a much higher sensitivity was revealed by analysis of different biological samples from pediatric HSCT patients by means of NGS approach, due to versatility of DNA reading technique and larger number of potentially pathogenic agents found by the multiple DNA sequencing [19]. The sensitivity of mNGS for diagnosing pulmonary infections post-transplant was 91.7 vs 22.9% by conventional testing. However, mNGS proved to be less specific (78.5%) than traditional methods (92.9%).

Later recolonization of pathogenic microorganisms post-HSCT is possible, including Klebsiella spp., S. aureus, S.pneumoniae, at a high risk of resistant strain selection, which was confirmed by us in the present work. One should note, however, that these 3 types of pathogenic bacteria were detected in a total of 13% of patients with sinusitis, i.e. the pathogen remained unknown in most cases. For additional diagnostics, along with search for pathogenic fungi and viruses, the extended diagnostics, e.g., of strictly anaerobic microbiota, are needed. In this aspect, implementation of advanced sequencing (NGS technique) will be of great importance, thus making it possible to assess biological diversity and the ratio of main microbiota classes in complex clinical samples, e.g., from mucosal surfaces.

Conclusion

1. In summary, the patients with oncohematological disease subjected to massive cytostatic therapy and allogeneic HSCT exhibit sufficient evolution of bronchoalveolar microbiota over the first 6 months posttransplant.

2. Follow-up of the BAL bacterial microbiota has revealed early exhaustion of S.viridans pool post-transplant, more likely, due to intensive anti-infectious treatment over the cytopenic period.

3. Decreased seeding levels are shown for S.viridans and S.epidermidis in adolescents over 15 years and adult patients.

4. Sharp increase of Klebsiella spp. detection rates at later terms (>2 months) after HSCT suggests airway colonization by the antibiotic-resistant microorganisms.

5. Future studies of BAL microbiota require combined diagnostic approaches, including mass spectrometry, PCR techniques for detection of strictly anaerobic bacteria, viral and fungal agents, as well as novel DNA-based technologies (e.g., next-generation DNA sequencing).

Conflict of interest

None declared.

Acknowledgement

This study was partially funded from Russian Ministry of Health and by Russian Science Foundation, grant No. №22-15-00149 of 18.05.2022.

References

1. Whiteside SA, McGinniss JE, Collman RG. The lung microbiome: progress and promise. J Clin Invest. 2021; 131(15):e150473.
   doi: 10.1172/JCI150473
2. Dickson RP, Freeman CP, McCloskey L, Falkowski NR, Huffnagle GB, Curtis JL. Bacterial topography of the healthy human lower respiratory tract. mBio. 2017;8(1):e02287-16. doi: 10.1128/mBio.02287-16
3. Gaibani P, Viciani E, Bartoletti M, Lewis RE, Tonetti T, Lombardo D, et al. The lower respiratory tract microbiome of critically ill patients with COVID-19. Sci Rep. 2021;11(1):10103. doi: 10.1038/s41598-021-89516-6
4. Hardak E, Avivi I, Berkun L, Raz-Pasteur A, Lavi N, Geffen Y, et al. Polymicrobial pulmonary infection in patients with hematological malignancies: prevalence, co-pathogens, course and outcome. Infection. 2016;44(4):491-497. doi: 10.1007/s15010-016-0873-3
5. Du S, Wu X, Li B, Wang Y, Shang L, Huang X. Clinical factors associated with composition of lung microbiota and important taxa predicting clinical prognosis in patients with severe community-acquired pneumonia. Front Med. 2021:1-14. doi: 10.1007/s11684-021-0856-3
6. Versluys AB, van der Ent K, Boelens JJ, Wolfs T, de Jong P, Bierings MB. High diagnostic yield of dedicated pulmonary screening before hematopoietic cell transplantation in children. Biol Blood Marrow Transplant. 2015;21(9):1622-1626. doi: 10.1016/j.bbmt.2015.06.002
7. Astashchanka A, Ryan J, Lin E, Nokes B, Jamieson C, Kligerman S, et al. Pulmonary complications in hematopoietic stem cell transplant recipients – a clinician primer. J Clin Med 2021; 10, 3227. doi: 10.3390/jcm10153227
8. Burger CD. Utility of positive bronchoalveolar lavage in predicting respiratory failure after hematopoietic stem cell transplantation: a retrospective analysis. Transplant Proc. 2007; 39(5):1623-1625. doi: 10.1016/j.transproceed.2007.02.065
9. Chellapandian D, Lehrnbecher T, Phillips B, Fisher BT, Zaoutis TE, Steinbach WJ, et al. Bronchoalveolar lavage and lung biopsy in patients with cancer and hematopoietic stem-cell transplantation recipients: a systematic review and meta-analysis. J Clin Oncol. 2015; 33(5):501-509. doi: 10.1200/JCO.2014.58.0480
10. Qualter E, Satwani P, Ricci A, Jin Z, Geyer MB, Alobeid B, et al. A comparison of bronchoalveolar lavage versus lung biopsy in pediatric recipients after stem cell transplantation. Biol Blood Marrow Transplant. 2014; 20(8):1229-1237. doi: 10.1016/j.bbmt.2014.04.019
11. Gudiol C, Sabe N, Carratala J. Is hospital-acquired pneumonia different in transplant recipients? Clin Microbiol Infect. 2019; 25(10): 1186-1194. doi: 10.1016/j.cmi.2019.04.003
12. Cabello H, Torres A, Celis R, El-Ebiary M, Puig de la Bellacasa J, Xaubet A, González J, et al. Bacterial colonization of distal airways in healthy subjects and chronic lung disease: a bronchoscopic study. Eur Respir J. 1997; 10: 1137-1144. doi: 10.1183/09031936.97.10051137
13. Sarmand N, Gompelmann D, Kontogianni K, Polke M, Herth FJ, Eberhardt R. New bacterial growth in bronchial secretions after bronchoscopic valve implantation. Int J Chron Obstruct Pulmon Dis. 2018;13:565-570. doi: 10.2147/COPD.S148196
14. Dolgov OI, Karpishchenko SA, Utimisheva ES, Grigoryanz DA, Spiridonova AA, Moiseev IS, et al. Aerobic microbiota of nasal cavity in sinusitis following hematopoietic stem cell transplantation. Cell Ther Transplant. 2022; 11(1): 36-42.
    doi: 10.18620/ctt-1866-8836-2022-11-1-36-42
15. Dickson RP, Schultz MJ, van der Pollt, Schouten LR, Falkowski NR, Luth JE, et al. Lung microbiota predict clinical outcomes in critically ill patients. Am J Respir Crit Care Med. 2020; 201(5): 555-563. doi: 10.1164/rccm.201907-1487OC
16. Chukhlovin AB, Pankratova OS. Opportunistic microflora at unusual sites: marker pathogens in severe posttransplant immune deficiency. Cell Ther Transplant. 2017; 6(4): 28-41. doi: 10.18620/ctt-1866-8836-2017-6-4-28-41
17. Hu Y, Jiang Y, Liu S, Shen J, An Y. Phenotypes, lung microbiota and cytokine responses in pneumonia after hematopoietic stem cell transplantation. J Inflammation Res. 2021;14: 6055-606.
18. Chen H, Yin Y, Gao H, et al. Clinical utility of in-house metagenomic next-generation sequencing for the diagnosis of lower respiratory tract infections and analysis of the host immune response. Clin Infect Dis. 2020;71(Suppl 4):S416-S426.
    doi: 10.1093/cid/ciaa1516
19. Qu Y, Ding W, Liu S, Wang X, Wang P, Liu H, et al. Metagenomic next-generation sequencing vs. traditional pathogen detection in the diagnosis of infection after allogeneic hematopoietic stem cell transplantation in children. Front. Microbiol. 2022. 13:868160.
    doi: 10.3389/fmicb.2022.868160

" ["~DETAIL_TEXT"]=> string(33117) "

Introduction

Microbial, fungal and viral communities of bronchial and alveolar surfaces are closely related to microbiota of upper airways and oropharyngeal mucosa. Therefore, their microbiological variability shows sufficient intercorrelations [1]. In healthy persons, the microbial composition in lungs closely matches the upper respiratory tract (URT), especially in periglottic region. The total contents of bacteria are gradually decreasing from upper respiratory ways to the lower bronchoalveolar structures [2].

Meanwhile, in severe pneumonias, the clinically relevant changes of lung microbiota are generally, assessed by analy-sis of bronchoalveolar lavage (BAL) sampled during diagnostic bronchoscopy, thus representing a direct and efficient way to get a reliable etiological diagnosis in suggested infectious complications. Along with bacteriological studies, a number of viral pathogens are routinely detected, mainly, by PCR techniques or immunohistochemistry, whereas fungal infections could be suggested by specific polysaccharide antigens, or direct cultures. The bacterial diversity may be assayed both by classical cultural methods, and by modern DNA deep sequencing methods.

In particular, a range of techniques could be used for the search of opportunistic pathogenic bacteria in bronchoalveolar samples. E.g., Gaibani et al. [3] examined the BAL specimens from 24 patients with post-COVID pneumonia. The samples were cultured on conventional selective agar plates. The species of bacterial isolates were identified by MALDI-TOF mass-spectrometry, and in vitro antimicrobial susceptibility was tested by routine methods. Moreover, V3 to V4 region of the standard 16S rRNA gene was subjected to PCR, the resulting amplicon libraries were sequenced using MySec platform by means of next-generation sequencing (NGS). In summary, the lung microbiome of these patients showed predominance of Pseudomonas spp. (25%), Enterobacteriaceae (19%), Streptococcaceae (12%), Staphylococcaceae (11%). In particular, the DNA sequences of Klebsiella spp. (7%), Enterococci (5%), and Prevotella (4%) were also detected.

A number of patients with systemic malignant disorders present with polymicrobial airway colonization caused by preceding cytostatic therapy resulting into severe immune deficiency. Bronchoscopic examination of 436 consecutive adult patients with hematological malignancies and pulmonary infiltrates had revealed infectious agents in BAL of 219 patients of them 45 (20.5%), with microbial colonization, 39 of them with two pathogens, and 6 with three agents [4]. Aspergillus spp. was the most common co-pathogen identified. The authors have confirmed a more severe clinical course and higher hospital mortality in the patients with polymicrobial pulmonary infections.

A sufficient issue concerns relative diagnostic value of classical bacterial cultures and DNA-based NGS diagnostics. Such studies are now underway. E.g., direct comparisons between the diagnostic significance of was performed by a Chinese team who have enrolled a group of severe community-acquired pneumonia (SCAP) patients admitted to intensive care unit (ICU). BAL samples were taken by bronchoscopy within 48 h of ICU admission [5]. The isolated DNA was sequenced in the V3-V4 hypervariable region of the 16S rRNA gene of all PCR-amplified samples by means of Illumina Miseq platform. The multivariate analysis of variance has shown that positive bacteria lab test results had the strongest independent association with lung microbiota (P=0.018), thus confirming permanent diagnostic value of standard clinical culture of bacterial microbiota.

A number of studies concerned total contents and species diversity of lung microbiota in HSCT patients. Currently, the pre-transplant diagnostics of infectious respiratory disorders in the patients planned for HSCT is based on complex examination including pulmonary function tests (PFT), chest high-resolution computed tomography (HRCT), and laboratory examination of available BAL samples [6]. The authors have examined 142 children that should be subjected to HSCT. Different abnormalities were revealed in 74% of patients, mostly, for subnormal PFT tests. Chest HRCT showed clinically significant disturbances in 19% of the cases. BAL microbiota was abnormal in 43% of patients; respiratory viruses (PCR) were found in 35 patients, fungi (antigen or culture) in 21, and bacteria (culture) in 22. Prognostic value of these disorders could influence subsequent treatment approaches.

In the patients undergoing HSCT, severe impairement of lung microbiota is observed, due to transient cytopenia, immunocompromised state and massive antibiotic prophylaxis at early terms posttransplant. Early and late pulmonary infections post-HSCT are well known and described in details as reviewed by Astaschanka et al. [7].

The BAL microbiology, may yield a variety of common bacterial agents S. aureus, E.coli, coagulase-negative staphylococci, Enterococci spp., P.aeruginosa, Klebsiella pneumonia etc. Additional PCR and antigen assays revealed multiple viral and fungal species. E.g., BAL samples taken after hematopoietic transplants may often contain a number of different bacterial, fungal and viral species, sometimes, presenting mixed infection [8]. Fungal species, especially, Aspergillus, is a common finding in BAL samples taken from HSCT patients [9].

Similar study was carried out in 193 children and adolescents who underwent myeloablative conditioning and HSCT has revealed mixed microbiota [10]. Of them, 34% underwent bronchoscopy with a total of 101 BAL samples, mostly after allogeneic HSCT (allo-HSCT). The lung-derived samples were tested for bacterial, fungal and viral infectious pathogens using staining and culture methods. 40% of samples proved to be positive, with a majority showing bacterial pathogen as well as fungal and viral agents. In particular, the diagnostic assays revealed Mycobacteria, S. epidermidis, vancomycin-resistant enterococci, coagulase-negative staphylococci, P.aeruginosa, Legionells, Serratia, Streptococcus spp., Enterococcus faecium, Lactobacilli spp.

Despite recent advent of novel DNA-sequencing approaches, the classical bacteriological evaluation of biological samples retains its diagnostic value, in particular due to its ability to assess antibiotic resistance of microbial isolates. Hence, the aim of this study was a comparative evaluation of aerobic and facultative anaerobic microbiota components in bronchoalveolar lavage samples taken in immunocompromised patients with infectious lung complications which developed after intensive chemotherapy, antibiotic therapy and subsequent hematopoietic stem cell transplantation (HSCT).

Materials and methods

Our study included clinical and laboratory data of 691 patients subjected to hematopoietic stem cell transplantation (HSCT) 2013 through 2020, aged from 1 to 71 years (a mean of 38.5+ 23.9).

Distribution of BAL samples by distinct disorders was as follows: acute lymphoid leukemia (ALL, n=232 samples); acute myeloid leukemia (AML, n=331); aplastic and refractory anemias (AA, n=104); Hodgkin disease (HD, n=163); chronic myeloid leukemia (CML, n=79); non-Hodgkin lymphomas (NHL, n=63), other malignant and inherited disorders (n=58).

Myeloablative and non-myeloablative conditioning regimens for HSCT were carried out in 44% and 56% of cases, respectively. Stem cells were obtained from bone marrow or peripheral blood 497 : 596).

The types of HSCT were as follows: related compatible donors (19.2%); related haploidentical donors (21.6%); unrelated compatible donors (49.1%); autologous transplants (10.2%).

The doses of transfused CD34+ cells widely varied from 0.8 to 18×10⁶ cells /kg body weight.

Prophylaxis of graft-versus-host disease was mostly, performed by the posttransplant cyclophosphamide (PtCy) as well cyclosporin A, tacrolimus, sirolimus and glucocorticosteroids.

For statistical analysis, the groups of patients were also divided by age: 0-5 years (group 1, n=79); 6-14 children (group 2, n=129); 15-21 years old (group 3, n=194); >22 years (group 4, n=720). Moreover, the results of bacteriological examination were classified by terms post-transplant, starting from <100 days before HSCT (point 0); during the 1^st month (point 1); 2^nd month (point 2); 3^rd month (point 3), etc., up to 6 months after HSCT (point 6).

In the course of conditioning treatment and HSCT, the patients obtained antibiotic prophylaxis including administration of fluoroquinolones from D+1 to D+60. Amoxicillin was also administered, especially, to children. In cases of posttransplant febrile neutropenia, empirical therapy with broad-spectrum antibiotics was prescribed. Upon isolation of antibiotic-resistant microbial strains, the treatment was changed to other antibiotics (per os or intravenously) as guided by the in vitro testing of microbial sensitivity.

A total of 1123 samples of bronchoalveolar lavage were collected by means of diagnostic bronchoscopy within D-100 to D+180 post-HSCT. The endoscopy was performed according to appropriate clinical indications as prescribed by the attending doctor and intensive care specialist. Written informed consent for the procedure was obtained from the patients or their guardians.

Inoculation of laboratory cultures and isolation of bacteria from the BAL samples were made to differential culture media by classical bacteriological techniques. The isolated microorganisms were identified by means of commercial biochemical test systems (BBL Crystal), as well as with MALDI-TOF mass spectrometry using VITEK MS instrument. The sensitivity of clinical isolates to antibiotics was determined by means of disk diffusion test systems. The results of microbial sensitivity tests were interpreted according to the Guidelines of European Committee on Antimicrobial Susceptibility Testing (EUCAST) criteria.

Statistical evaluation of results was performed using parametric and nonparametric statistic criteria, to analyze time- and age-dependent course of the bacterial landscape revealed by microbial cultures, and for distinct microbial associations after HSCT using the STATISTICA 10 program.

Results

The detection rates for distinct cultured bacterial species among the total BAL sample massive was as follows: bacteria of Enterobacterales order were revealed in 25% of the samples (280/1123), with Klebsiella pneumoniae (19.1%, 215/1123) being prevailing species, whereas Escherichia coli (2.5%) and Enterobacter spp. (2.3%) were detected at similarly low rates (28/1123 and 26/1123, respectively. The incidence of Citrobacter spp., Proteus mirabilis, Serratia marcescens did not exceed 1%. Among Gram-negative, non-fermenting bacteria, Pseudomonas aeruginosa was detected in 5% of BAL specimens (56/1123). In particular, P. аeruginosa v. non mucosa, and v. mucosa were found at similar rates (29/1123 и 27/1123). Other Pseudomonas species were isolated in 4.5% (51/1123); Acinetobacter spp., 3.7% (41/1123); Stenotrophomonas maltophilia, 2.1% (24/1123). The ratio of coagulase-negative staphylococci was 5.6% (63/1123), of them Staphylococcus epidermidis was found in 4.2% (47/1123). Staphylococcus aureus was isolated in 4.5% of the samples (51/1123). Streptococcus spp. was revealed in 20.7% (233/1123 samples) including Streptococcus viridans group (15.7%, 176/1123); Streptococcus pneumoniae (1.5%, 17/1123). Enterococci encountered in 12.4% of BAL samples (139/1123), of them Enterococcus faecium was identified in 7.0% (79/1123); Enterococcus faecalis, in 5.3% (60/1123). Different Candida species were found in 14% of the BAL specimens (157/1123), as a rule, within microbial associations; the incidence of Haemophilus spp. was 0.9% (10/1123).

Detection rates for the most common bacterial species as classified by the age of patients are shown in Fig. 1. Of note, the seeding rates for S.viridans, a common member of normal mucosal microbiota, tended to decrease with age, reaching a significant decline in adolescents of >15 years old and adult patients (p<0.01). Meanwhile, the rates of Klebsiella detection, in our experience, proved to be relatively high in all studied age groups.

Figure 1. Age dependence of bacterial seeding rates for the dominant bacterial species in bronchoalveolar lavage of oncohematological patients both before and after HSCT (group 1: 0-5 years; group 2: 6-14 years; group 3: 15-21 years; group 4: >22 years. A, S.epidermidis; B, S.viridans; C, Klebsiella spp. Abscissa, age groups (group 1, 0-5 y.o.; group 2, 6-14 y.o.; group 3, 15-21 y.o.; group 4, >22 y.o. Ordinate, ratio of positive microbial findings.

To prove the trends of posttransplant microbial colonization, we have assessed time dynamics for the dominant bacterial species within 6 months after HSCT (Fig. 2).

As seen from Fig. 2A, the S.epidermidis seeding frequency did not sufficiently change over time posttransplant (a mean of 10-18%). By contrary, S.viridans detection rates dropped ca. 2-fold during 1^st month after HSCT (approx. from 30% to 10%), probably, due to intensive antibiotic prophylaxis over the period of transient cytopenia (p<0.02). Meanwhile, the most interesting finding concerned posttransplant changes in Klebsiella spp. detection. Its low seeding rates before HSCT and over 1^st month posttransplant (3 to 5%) were followed by sharply increased emergence of this commensal bacteria at later terms after HSCT (2 to 6 months), as seen from Fig. 2C (p<0.001). Interestingly, its detection was not affected by antibiotic treatment during early posttransplant period and additional antibacterial treatment due to presumed infectious complications requiring bronchoscopy and BAL sampling.

Figure 2. Frequency of S.epidermidis (A); S.viridans (B), and Klebsiella spp. (C) detection in bronchoalveolar lavage of oncohematololgical patients collected at various times after HSCT. Abscissa, terms post-HSCT (months); ordinate, ratio of positive microbial findings.

Antibiotic resistance was tested for all bacterial isolates derived from the BAL samples. Figures 3 to 8 depict the resistance patterns of the leading BAL microbiota members obtained from the subjected to HSCT between 2013 and 2020. Antibiotic resistance of Klebsiella pneumoniae ssp pneumoniae, was equally high during the entire tine period. It comprised over 80% for III generation cephalosporins, aztreonam, fluoroquinolones and protected aminopenicillins. Carbapenem resistance varied from 33% to imipenem to 54% for meropenem. 96% of the tested isolates were colistin-sensitive. Colistin sensitivity was determined by serial dilutions technique in liquid nutrient medium.

Common detection of K.pneumoniae accomplished by increased resistance rate presume high relevance of this pathogen for development of nosocomial infections in various clinical settings, especially in immunocompromised patients. Within mentioned time period, the meticillin-resistant S.aureus (MRSA) was isolated in 6% of BAL samples, whereas the rate of MRCoNS was 71%. All isolates of Staphylococci proved to be tigecycline-sensitive. Sensitivity of staphylococci to vancomycin was assessed by means of gradient diffusion (Е test). S.aureus showed 100% sensitivity to vancomycin and linezolid. Among the CoNS strains, 2% were resistant for vancomycin, and 5%, for linezolid. The isolates sensitive to linezolid were also considered tedizolid-sensitive. Erythromycin was used to determine sensitivity to azithromycin, clarithromycin, and roxythromycin. Fluorochinolone sensitivity of staphylococci was evaluated by their sensitivity to norfloxacine. The norfloxacin-sensitive strains were considered to be sensitive to moxyfloxacin and, at higher exposure, to ciprofloxacin and levofloxacin. Fluorochinolone sensitivity of S.aureus proved to be 97%, appropriate rate for CoNS was 35%.

Figure 3. Resistance of Klebsiella pneumoniae ssp pneumonia to various antibiotics (biological samples: bronchoalveolar lavage, 2013 to 2020)

The members of Gram-negative non-fermenting bacteria exhibited high resistance levels to carbapenems, i.e., >70% of resistant isolates among Acinetobacter spp., over 50% resistant strains were documented for P.aeruginosa. Colistin sensitivity was as high as 96% for Pseudomonas spp. (two resistant strains from 52 isolates) and 93% for Acinetobacter spp. (one case of resistance of 15).

The Enterococcus isolates from BAL samples have shown 100% resistance rates for linezolid and tigecycline; resistance rate was 3% for vancomycin (4 isolates of 137). 50% of E.faecium isolates proved to be ampicillin-resistant, whereas 92% of E.faecalis isolates remained sensitive to this drug.

Discussion

The significance of bacterial findings in BAL was considered in different transplantological aspects. E.g., a review article by Gudiol et al. [11] was dedicated to Hospital-acquired pneumonia (HAP) which present serious complications in transplant patients. Bacteria are the leading cause of nosocomial pneumonia for both immunocompetent and transplant recipients caused by Gram-negative organisms, and, especially, highly prevalent Pseudomonas aeruginosa. In addition to the usual colonizing microorganisms of the respiratory tract, such as Streptococcus pneumoniae, Branhamella catharralis and Staphylococcus aureus, and various Gram-negative bacilli are an important cause of HAP/VAP in both populations. The most relevant opportunistic pathogens are Aspergillus fumigatus, Pneumocystis jirovecii and cytomegalovirus.

Streptococcus viridians is nearly absent from normal lungs, but it proved to be a common commensal microbe cultured from many BAL samples in the patients with chronic obstructive pulmonary disease, bronchial carcinoma, as well as following tracheostomy [12], thus presuming massive colonization with this species in various chronic respiratory disorders. Rapid bacterial colonization, especially, with S.viridans, S.aureus, P. aeruginosa was observed after bronchial valve implantation in lung emphysema patients [13]. Therefore, predominance of S.viridans in BAL samples both before and after HSCT seems to be a useful marker of chronic lung damage due to massive cytotoxic therapies in oncohematological patients. Increased frequency of S.viridans in younger patients (<15 years old) revealed in our study could be also explained by higher susceptibility of respiratory mucosa in children to previous anticancer treatment.

To our knowledge, there are no published data on the time-dependent changes of Klebsiella spp. in bronchoalveolar lavage following hematopoietic stem cell transplantation. Rather high prevalence of this bacteria was found among the HSCT patients with sinusitis and other disorders of upper respiratory ways at our BMT Center. Interestingly, higher rates of Klebsiella detection were found in the maxillary cavities which represent a common reservoir of pathogenic agents in immunocompromised persons [14].

One may presume that the late activation of Klebsiella on respiratory mucosa may be caused by antibiotic-resistant strains colonizing these areas.

To suggest possible origin of these strains, one may refer a study of 91 BAL specimens obtained from critically ill patients with acute respiratory disorder (ARDS). Next-generation sequencing of bacterial DNA fragments was performed by means of Illumina MiSeq platform [15]. The ARDS-associated sequencing reads were similar to Enterobacteriaceae, including Escherichia coli, Enterobacter spp., and Klebsiella pneumoniae. The authors conclude that lung microbiota in ARDS patients is characterized by relative enrichment with gut-associated species of the Enterobacteriaceae family. Our findings concerning Klebsiella colonization of lower airways confirm these observations and provide evidence for higher risk of gut bacteria migration to other anatomic sites, due to extended septic process. This suggestion was made in our previous review [16].

A complex study of general cytokine responses and NGS-based evaluation of BAL bacterial microbiota in HSCT patients with pneumonias has shown reactive and non-reactive microbiota phenotypes [17, 18]. In the reactive phenotype, Pseudomonas Aeruginosa was the most abundant species, while in the nonreactive phenotype, cytomegalovirus (CMV) predominated. Moreover, other bacteria, S.pneumoniae, S.aureus, Acinetobacter spp., Klebsiella spp., Stenotrophomonas spp. were found in different quantities.

The new sequencing methods are recently applied for analy-sis of BAL microbiota. When comparing relative diagnostic efficiency of conventional bacterial cultures and novel metagenomic next-generation sequencing (mNGS) of BAL samples, a much higher sensitivity was revealed by analysis of different biological samples from pediatric HSCT patients by means of NGS approach, due to versatility of DNA reading technique and larger number of potentially pathogenic agents found by the multiple DNA sequencing [19]. The sensitivity of mNGS for diagnosing pulmonary infections post-transplant was 91.7 vs 22.9% by conventional testing. However, mNGS proved to be less specific (78.5%) than traditional methods (92.9%).

Later recolonization of pathogenic microorganisms post-HSCT is possible, including Klebsiella spp., S. aureus, S.pneumoniae, at a high risk of resistant strain selection, which was confirmed by us in the present work. One should note, however, that these 3 types of pathogenic bacteria were detected in a total of 13% of patients with sinusitis, i.e. the pathogen remained unknown in most cases. For additional diagnostics, along with search for pathogenic fungi and viruses, the extended diagnostics, e.g., of strictly anaerobic microbiota, are needed. In this aspect, implementation of advanced sequencing (NGS technique) will be of great importance, thus making it possible to assess biological diversity and the ratio of main microbiota classes in complex clinical samples, e.g., from mucosal surfaces.

Conclusion

1. In summary, the patients with oncohematological disease subjected to massive cytostatic therapy and allogeneic HSCT exhibit sufficient evolution of bronchoalveolar microbiota over the first 6 months posttransplant.

2. Follow-up of the BAL bacterial microbiota has revealed early exhaustion of S.viridans pool post-transplant, more likely, due to intensive anti-infectious treatment over the cytopenic period.

3. Decreased seeding levels are shown for S.viridans and S.epidermidis in adolescents over 15 years and adult patients.

4. Sharp increase of Klebsiella spp. detection rates at later terms (>2 months) after HSCT suggests airway colonization by the antibiotic-resistant microorganisms.

5. Future studies of BAL microbiota require combined diagnostic approaches, including mass spectrometry, PCR techniques for detection of strictly anaerobic bacteria, viral and fungal agents, as well as novel DNA-based technologies (e.g., next-generation DNA sequencing).

Conflict of interest

None declared.

Acknowledgement

This study was partially funded from Russian Ministry of Health and by Russian Science Foundation, grant No. №22-15-00149 of 18.05.2022.

References

1. Whiteside SA, McGinniss JE, Collman RG. The lung microbiome: progress and promise. J Clin Invest. 2021; 131(15):e150473.
   doi: 10.1172/JCI150473
2. Dickson RP, Freeman CP, McCloskey L, Falkowski NR, Huffnagle GB, Curtis JL. Bacterial topography of the healthy human lower respiratory tract. mBio. 2017;8(1):e02287-16. doi: 10.1128/mBio.02287-16
3. Gaibani P, Viciani E, Bartoletti M, Lewis RE, Tonetti T, Lombardo D, et al. The lower respiratory tract microbiome of critically ill patients with COVID-19. Sci Rep. 2021;11(1):10103. doi: 10.1038/s41598-021-89516-6
4. Hardak E, Avivi I, Berkun L, Raz-Pasteur A, Lavi N, Geffen Y, et al. Polymicrobial pulmonary infection in patients with hematological malignancies: prevalence, co-pathogens, course and outcome. Infection. 2016;44(4):491-497. doi: 10.1007/s15010-016-0873-3
5. Du S, Wu X, Li B, Wang Y, Shang L, Huang X. Clinical factors associated with composition of lung microbiota and important taxa predicting clinical prognosis in patients with severe community-acquired pneumonia. Front Med. 2021:1-14. doi: 10.1007/s11684-021-0856-3
6. Versluys AB, van der Ent K, Boelens JJ, Wolfs T, de Jong P, Bierings MB. High diagnostic yield of dedicated pulmonary screening before hematopoietic cell transplantation in children. Biol Blood Marrow Transplant. 2015;21(9):1622-1626. doi: 10.1016/j.bbmt.2015.06.002
7. Astashchanka A, Ryan J, Lin E, Nokes B, Jamieson C, Kligerman S, et al. Pulmonary complications in hematopoietic stem cell transplant recipients – a clinician primer. J Clin Med 2021; 10, 3227. doi: 10.3390/jcm10153227
8. Burger CD. Utility of positive bronchoalveolar lavage in predicting respiratory failure after hematopoietic stem cell transplantation: a retrospective analysis. Transplant Proc. 2007; 39(5):1623-1625. doi: 10.1016/j.transproceed.2007.02.065
9. Chellapandian D, Lehrnbecher T, Phillips B, Fisher BT, Zaoutis TE, Steinbach WJ, et al. Bronchoalveolar lavage and lung biopsy in patients with cancer and hematopoietic stem-cell transplantation recipients: a systematic review and meta-analysis. J Clin Oncol. 2015; 33(5):501-509. doi: 10.1200/JCO.2014.58.0480
10. Qualter E, Satwani P, Ricci A, Jin Z, Geyer MB, Alobeid B, et al. A comparison of bronchoalveolar lavage versus lung biopsy in pediatric recipients after stem cell transplantation. Biol Blood Marrow Transplant. 2014; 20(8):1229-1237. doi: 10.1016/j.bbmt.2014.04.019
11. Gudiol C, Sabe N, Carratala J. Is hospital-acquired pneumonia different in transplant recipients? Clin Microbiol Infect. 2019; 25(10): 1186-1194. doi: 10.1016/j.cmi.2019.04.003
12. Cabello H, Torres A, Celis R, El-Ebiary M, Puig de la Bellacasa J, Xaubet A, González J, et al. Bacterial colonization of distal airways in healthy subjects and chronic lung disease: a bronchoscopic study. Eur Respir J. 1997; 10: 1137-1144. doi: 10.1183/09031936.97.10051137
13. Sarmand N, Gompelmann D, Kontogianni K, Polke M, Herth FJ, Eberhardt R. New bacterial growth in bronchial secretions after bronchoscopic valve implantation. Int J Chron Obstruct Pulmon Dis. 2018;13:565-570. doi: 10.2147/COPD.S148196
14. Dolgov OI, Karpishchenko SA, Utimisheva ES, Grigoryanz DA, Spiridonova AA, Moiseev IS, et al. Aerobic microbiota of nasal cavity in sinusitis following hematopoietic stem cell transplantation. Cell Ther Transplant. 2022; 11(1): 36-42.
    doi: 10.18620/ctt-1866-8836-2022-11-1-36-42
15. Dickson RP, Schultz MJ, van der Pollt, Schouten LR, Falkowski NR, Luth JE, et al. Lung microbiota predict clinical outcomes in critically ill patients. Am J Respir Crit Care Med. 2020; 201(5): 555-563. doi: 10.1164/rccm.201907-1487OC
16. Chukhlovin AB, Pankratova OS. Opportunistic microflora at unusual sites: marker pathogens in severe posttransplant immune deficiency. Cell Ther Transplant. 2017; 6(4): 28-41. doi: 10.18620/ctt-1866-8836-2017-6-4-28-41
17. Hu Y, Jiang Y, Liu S, Shen J, An Y. Phenotypes, lung microbiota and cytokine responses in pneumonia after hematopoietic stem cell transplantation. J Inflammation Res. 2021;14: 6055-606.
18. Chen H, Yin Y, Gao H, et al. Clinical utility of in-house metagenomic next-generation sequencing for the diagnosis of lower respiratory tract infections and analysis of the host immune response. Clin Infect Dis. 2020;71(Suppl 4):S416-S426.
    doi: 10.1093/cid/ciaa1516
19. Qu Y, Ding W, Liu S, Wang X, Wang P, Liu H, et al. Metagenomic next-generation sequencing vs. traditional pathogen detection in the diagnosis of infection after allogeneic hematopoietic stem cell transplantation in children. Front. Microbiol. 2022. 13:868160.
    doi: 10.3389/fmicb.2022.868160

" ["DETAIL_TEXT_TYPE"]=> string(4) "html" ["~DETAIL_TEXT_TYPE"]=> string(4) "html" ["PREVIEW_TEXT"]=> string(0) "" ["~PREVIEW_TEXT"]=> string(0) "" ["PREVIEW_TEXT_TYPE"]=> string(4) "text" ["~PREVIEW_TEXT_TYPE"]=> string(4) "text" ["PREVIEW_PICTURE"]=> NULL ["~PREVIEW_PICTURE"]=> NULL ["LANG_DIR"]=> string(4) "/ru/" ["~LANG_DIR"]=> string(4) "/ru/" ["SORT"]=> string(2) "30" ["~SORT"]=> string(2) "30" ["CODE"]=> string(101) "spektr-bronkhoalveolyarnoy-bakterialnoy-mikrobioty-posle-transplantatsii-gemopoeticheskikh-stvolovykh" ["~CODE"]=> string(101) "spektr-bronkhoalveolyarnoy-bakterialnoy-mikrobioty-posle-transplantatsii-gemopoeticheskikh-stvolovykh" ["EXTERNAL_ID"]=> string(4) "2061" ["~EXTERNAL_ID"]=> string(4) "2061" ["IBLOCK_TYPE_ID"]=> string(7) "journal" ["~IBLOCK_TYPE_ID"]=> string(7) "journal" ["IBLOCK_CODE"]=> string(7) "volumes" ["~IBLOCK_CODE"]=> string(7) "volumes" ["IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["~IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["LID"]=> string(2) "s2" ["~LID"]=> string(2) "s2" ["EDIT_LINK"]=> NULL ["DELETE_LINK"]=> NULL ["DISPLAY_ACTIVE_FROM"]=> string(0) "" ["IPROPERTY_VALUES"]=> array(18) { ["ELEMENT_META_TITLE"]=> string(288) "Спектр бронхоальвеолярной бактериальной микробиоты после трансплантации гемопоэтических стволовых клеток: возрастная зависимость и нарушения микробиоты" ["ELEMENT_META_KEYWORDS"]=> string(0) "" ["ELEMENT_META_DESCRIPTION"]=> string(424) "Спектр бронхоальвеолярной бактериальной микробиоты после трансплантации гемопоэтических стволовых клеток: возрастная зависимость и нарушения микробиотыSpectrum of bronchoalveolar bacterial microbiota following hematopoietic stem cell transplantation: age dependence and microbiota shifts" ["ELEMENT_PREVIEW_PICTURE_FILE_ALT"]=> string(6856) "<p style="text-align: justify;"> Состав микробиоты бронхоальвеолярных отделов у здоровых детей и взрослых в целом коррелирует с составом популяций верхних дыхательных путей. Однако при развитии тяжелых пневмоний, особенно у пациентов с иммунодефицитами, отмечается существенное нарастание количества, частоты выявления и биоразнообразия бактерий в бронхоальвеолярных смывах (БАЛ), наряду с колонизацией бронхов условно патогенными микроорганизмами из других инфицированных сайтов. Так, у многих пациентов с онкологическими заболеваниями на фоне цитостатической терапии развиваются тяжелые пневмонии с полимикробной колонизаций нижних дыхательных путей. Целью нашей работы была сравнительная оценка аэробной и факультативно-анаэробной микробиоты в образцах БАЛ от детей и взрослых пациентов после трансплантации гемопоэтических клеток (ТГСК). </p> <h3>Пациенты и методы</h3> <p style="text-align: justify;"> Проведено обследование 691 пациента, главным образом – с онкогематологическими заболеваниями, леченными цитостатической терапией и ТГСК (алло-ТГСК в 90% случаев). Возраст пациентов составлял от 1 до 71 г. (медиана – 38,5 л.). Применяли миело- или немиелоаблативную кондиционирующую терапию (44% и 56% случаев). Для исследования проводили забор 1123 образцов биоматериала (БАЛ) при диагностической бронхоскопии по соответствующим клиническим показаниями в период от D-100 до D+180 после ТГСК. Культивирование бактерий на селективных средах проводили в аэробных условиях по стандартным методикам, виды бактерий в изолятах идентифицировали с помощью биохимических тестов (BBL Crystal), масс-спектрометрии (MALDI-TOF), чувствительность к антибиотикам – диск-диффузионными тестами. </p> <h3>Результаты</h3> <p style="text-align: justify;"> В целом, частота выявления отдельных бактериальных видов в образцах БАЛ была следующей: <i>K.pneumoniae</i> – 19,1%, <i>P.aeruginosa</i> – 5%, <i>S. epidermidis</i> – 4,2%, <i>S. aureus</i> – 4,5%, <i>Acinetobacter spp.</i> – 3,7%, <i>E.faecium</i> – 7,0%, <i>E.faecalis</i> – 5,3%, <i>E.coli</i> – 2,5%, <i>Enterobacter spp.</i> – 2,3%, <i>Streptococcus pneumoniae</i> – 1,5%, <i>Haemophilus spp.</i> – 0,9% и т.д. Другие микробы <i>Corynebacteria spp., Neisseria spp.</i> и др. встречались реже. Отмечены значительная возрастная динамика состава и частоты различных видов микробиоты в БАЛ после ТГСК. В частности частота высеваемости <i>S.viridans</i> была максимальной у детей младшего возраста (0-5 лет), снижаясь у подростков &gt;15 лет. Та же закономерность, но менее выраженная, отмечена для <i>S.epidermidis</i>. Оба этих микробных вида часто выявляются в нормальной микробиоте. Напротив, частота выявления <i>Klebsiella spp., Pseudomonas spp.</i> и <i>S.aureus</i> в пробах БАЛ после интенсивной терапии и ТГСК повышается с возрастом пациентов, что говорит о большем риске жизнеопасных легочных инфекций после ТГСК, в том числе – резистентными к антибиотикам штаммами из кишечника у взрослых пациентов в период до 180 дней. </p> <h3>Выводы</h3> <p style="text-align: justify;"> У больных с онкогематологическими заболеваниями в течение 6 мес. после ТГСК отмечаются существенные сдвиги бронхоальвеолярной микробиоты. Показана сниженная высеваемость <i>S.viridans</i> и <i> S.epidermidis</i> у детей старше 15 лет и взрослых. Выявлено подавление микробиоты БАЛ в течение 1-го месяца после ТГСК. В более поздние сроки отмечен высокий риск колонизации <i>Klebsiella spp.</i> в связи с селекцией антибиотикорезистентных штаммов. Частота встречаемости <i>K.pneumoniae</i> и ее высокий уровень резистентности показывают актуальность данного патогена в развитии нозокомиальных инфекций у иммунокомпрометированных пациентов. </p> <h2>Ключевые слова</h2> <p style="text-align: justify;"> Трансплантация гемопоэтических клеток, бактериальная микробиота, бронхоальвеолярные смывы, возраст, временной фактор. </p>" ["ELEMENT_PREVIEW_PICTURE_FILE_TITLE"]=> string(288) "Спектр бронхоальвеолярной бактериальной микробиоты после трансплантации гемопоэтических стволовых клеток: возрастная зависимость и нарушения микробиоты" ["ELEMENT_DETAIL_PICTURE_FILE_ALT"]=> string(288) "Спектр бронхоальвеолярной бактериальной микробиоты после трансплантации гемопоэтических стволовых клеток: возрастная зависимость и нарушения микробиоты" ["ELEMENT_DETAIL_PICTURE_FILE_TITLE"]=> string(288) "Спектр бронхоальвеолярной бактериальной микробиоты после трансплантации гемопоэтических стволовых клеток: возрастная зависимость и нарушения микробиоты" ["SECTION_META_TITLE"]=> string(288) "Спектр бронхоальвеолярной бактериальной микробиоты после трансплантации гемопоэтических стволовых клеток: возрастная зависимость и нарушения микробиоты" ["SECTION_META_KEYWORDS"]=> string(288) "Спектр бронхоальвеолярной бактериальной микробиоты после трансплантации гемопоэтических стволовых клеток: возрастная зависимость и нарушения микробиоты" ["SECTION_META_DESCRIPTION"]=> string(288) "Спектр бронхоальвеолярной бактериальной микробиоты после трансплантации гемопоэтических стволовых клеток: возрастная зависимость и нарушения микробиоты" ["SECTION_PICTURE_FILE_ALT"]=> string(288) "Спектр бронхоальвеолярной бактериальной микробиоты после трансплантации гемопоэтических стволовых клеток: возрастная зависимость и нарушения микробиоты" ["SECTION_PICTURE_FILE_TITLE"]=> string(288) "Спектр бронхоальвеолярной бактериальной микробиоты после трансплантации гемопоэтических стволовых клеток: возрастная зависимость и нарушения микробиоты" ["SECTION_PICTURE_FILE_NAME"]=> string(101) "spektr-bronkhoalveolyarnoy-bakterialnoy-mikrobioty-posle-transplantatsii-gemopoeticheskikh-stvolovykh" ["SECTION_DETAIL_PICTURE_FILE_ALT"]=> string(288) "Спектр бронхоальвеолярной бактериальной микробиоты после трансплантации гемопоэтических стволовых клеток: возрастная зависимость и нарушения микробиоты" ["SECTION_DETAIL_PICTURE_FILE_TITLE"]=> string(288) "Спектр бронхоальвеолярной бактериальной микробиоты после трансплантации гемопоэтических стволовых клеток: возрастная зависимость и нарушения микробиоты" ["SECTION_DETAIL_PICTURE_FILE_NAME"]=> string(101) "spektr-bronkhoalveolyarnoy-bakterialnoy-mikrobioty-posle-transplantatsii-gemopoeticheskikh-stvolovykh" ["ELEMENT_PREVIEW_PICTURE_FILE_NAME"]=> string(101) "spektr-bronkhoalveolyarnoy-bakterialnoy-mikrobioty-posle-transplantatsii-gemopoeticheskikh-stvolovykh" ["ELEMENT_DETAIL_PICTURE_FILE_NAME"]=> string(101) "spektr-bronkhoalveolyarnoy-bakterialnoy-mikrobioty-posle-transplantatsii-gemopoeticheskikh-stvolovykh" } ["FIELDS"]=> array(1) { ["IBLOCK_SECTION_ID"]=> string(3) "212" } ["PROPERTIES"]=> array(18) { ["KEYWORDS"]=> array(36) { ["ID"]=> string(2) "19" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:46:01" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(27) "Ключевые слова" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "KEYWORDS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "19" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "4" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "Y" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "Y" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(27) "Ключевые слова" ["~DEFAULT_VALUE"]=> string(0) "" } ["SUBMITTED"]=> array(36) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28638" ["VALUE"]=> string(22) "05/15/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "05/15/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL } ["ACCEPTED"]=> array(36) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28639" ["VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL } ["PUBLISHED"]=> array(36) { ["ID"]=> string(2) "22" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Дата публикации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "PUBLISHED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "22" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Дата публикации" ["~DEFAULT_VALUE"]=> NULL } ["CONTACT"]=> array(36) { ["ID"]=> string(2) "23" ["TIMESTAMP_X"]=> string(19) "2015-09-03 14:43:05" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(14) "Контакт" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "CONTACT" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "23" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(14) "Контакт" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHORS"]=> array(36) { ["ID"]=> string(2) "24" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:45:07" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "AUTHORS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "24" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_RU"]=> array(36) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28640" ["VALUE"]=> array(2) { ["TEXT"]=> string(381) "<p>Анна А. Спиридонова^1,3, Алиса Г. Волкова¹, Алексей Б. Чухловин^1,2, Иван С. Моисеев¹, Людмила С. Зубаровская¹, Александр Д. Кулагин¹</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(297) "

Анна А. Спиридонова^1,3, Алиса Г. Волкова¹, Алексей Б. Чухловин^1,2, Иван С. Моисеев¹, Людмила С. Зубаровская¹, Александр Д. Кулагин¹

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_RU"]=> array(36) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28641" ["VALUE"]=> array(2) { ["TEXT"]=> string(649) "<p>¹ Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия<br> ² Детский научно-клинический центр инфекционных болезней, Санкт-Петербург, Россия<br> ³ Санкт-Петербургский НИИ эпидемиологии и микробиологии им. Пастера, Санкт-Петербург, Россия </p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(589) "

¹ Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия
² Детский научно-клинический центр инфекционных болезней, Санкт-Петербург, Россия
³ Санкт-Петербургский НИИ эпидемиологии и микробиологии им. Пастера, Санкт-Петербург, Россия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_RU"]=> array(36) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28642" ["VALUE"]=> array(2) { ["TEXT"]=> string(6856) "<p style="text-align: justify;"> Состав микробиоты бронхоальвеолярных отделов у здоровых детей и взрослых в целом коррелирует с составом популяций верхних дыхательных путей. Однако при развитии тяжелых пневмоний, особенно у пациентов с иммунодефицитами, отмечается существенное нарастание количества, частоты выявления и биоразнообразия бактерий в бронхоальвеолярных смывах (БАЛ), наряду с колонизацией бронхов условно патогенными микроорганизмами из других инфицированных сайтов. Так, у многих пациентов с онкологическими заболеваниями на фоне цитостатической терапии развиваются тяжелые пневмонии с полимикробной колонизаций нижних дыхательных путей. Целью нашей работы была сравнительная оценка аэробной и факультативно-анаэробной микробиоты в образцах БАЛ от детей и взрослых пациентов после трансплантации гемопоэтических клеток (ТГСК). </p> <h3>Пациенты и методы</h3> <p style="text-align: justify;"> Проведено обследование 691 пациента, главным образом – с онкогематологическими заболеваниями, леченными цитостатической терапией и ТГСК (алло-ТГСК в 90% случаев). Возраст пациентов составлял от 1 до 71 г. (медиана – 38,5 л.). Применяли миело- или немиелоаблативную кондиционирующую терапию (44% и 56% случаев). Для исследования проводили забор 1123 образцов биоматериала (БАЛ) при диагностической бронхоскопии по соответствующим клиническим показаниями в период от D-100 до D+180 после ТГСК. Культивирование бактерий на селективных средах проводили в аэробных условиях по стандартным методикам, виды бактерий в изолятах идентифицировали с помощью биохимических тестов (BBL Crystal), масс-спектрометрии (MALDI-TOF), чувствительность к антибиотикам – диск-диффузионными тестами. </p> <h3>Результаты</h3> <p style="text-align: justify;"> В целом, частота выявления отдельных бактериальных видов в образцах БАЛ была следующей: <i>K.pneumoniae</i> – 19,1%, <i>P.aeruginosa</i> – 5%, <i>S. epidermidis</i> – 4,2%, <i>S. aureus</i> – 4,5%, <i>Acinetobacter spp.</i> – 3,7%, <i>E.faecium</i> – 7,0%, <i>E.faecalis</i> – 5,3%, <i>E.coli</i> – 2,5%, <i>Enterobacter spp.</i> – 2,3%, <i>Streptococcus pneumoniae</i> – 1,5%, <i>Haemophilus spp.</i> – 0,9% и т.д. Другие микробы <i>Corynebacteria spp., Neisseria spp.</i> и др. встречались реже. Отмечены значительная возрастная динамика состава и частоты различных видов микробиоты в БАЛ после ТГСК. В частности частота высеваемости <i>S.viridans</i> была максимальной у детей младшего возраста (0-5 лет), снижаясь у подростков &gt;15 лет. Та же закономерность, но менее выраженная, отмечена для <i>S.epidermidis</i>. Оба этих микробных вида часто выявляются в нормальной микробиоте. Напротив, частота выявления <i>Klebsiella spp., Pseudomonas spp.</i> и <i>S.aureus</i> в пробах БАЛ после интенсивной терапии и ТГСК повышается с возрастом пациентов, что говорит о большем риске жизнеопасных легочных инфекций после ТГСК, в том числе – резистентными к антибиотикам штаммами из кишечника у взрослых пациентов в период до 180 дней. </p> <h3>Выводы</h3> <p style="text-align: justify;"> У больных с онкогематологическими заболеваниями в течение 6 мес. после ТГСК отмечаются существенные сдвиги бронхоальвеолярной микробиоты. Показана сниженная высеваемость <i>S.viridans</i> и <i> S.epidermidis</i> у детей старше 15 лет и взрослых. Выявлено подавление микробиоты БАЛ в течение 1-го месяца после ТГСК. В более поздние сроки отмечен высокий риск колонизации <i>Klebsiella spp.</i> в связи с селекцией антибиотикорезистентных штаммов. Частота встречаемости <i>K.pneumoniae</i> и ее высокий уровень резистентности показывают актуальность данного патогена в развитии нозокомиальных инфекций у иммунокомпрометированных пациентов. </p> <h2>Ключевые слова</h2> <p style="text-align: justify;"> Трансплантация гемопоэтических клеток, бактериальная микробиота, бронхоальвеолярные смывы, возраст, временной фактор. </p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(6454) "

Состав микробиоты бронхоальвеолярных отделов у здоровых детей и взрослых в целом коррелирует с составом популяций верхних дыхательных путей. Однако при развитии тяжелых пневмоний, особенно у пациентов с иммунодефицитами, отмечается существенное нарастание количества, частоты выявления и биоразнообразия бактерий в бронхоальвеолярных смывах (БАЛ), наряду с колонизацией бронхов условно патогенными микроорганизмами из других инфицированных сайтов. Так, у многих пациентов с онкологическими заболеваниями на фоне цитостатической терапии развиваются тяжелые пневмонии с полимикробной колонизаций нижних дыхательных путей. Целью нашей работы была сравнительная оценка аэробной и факультативно-анаэробной микробиоты в образцах БАЛ от детей и взрослых пациентов после трансплантации гемопоэтических клеток (ТГСК).

Пациенты и методы

Проведено обследование 691 пациента, главным образом – с онкогематологическими заболеваниями, леченными цитостатической терапией и ТГСК (алло-ТГСК в 90% случаев). Возраст пациентов составлял от 1 до 71 г. (медиана – 38,5 л.). Применяли миело- или немиелоаблативную кондиционирующую терапию (44% и 56% случаев). Для исследования проводили забор 1123 образцов биоматериала (БАЛ) при диагностической бронхоскопии по соответствующим клиническим показаниями в период от D-100 до D+180 после ТГСК. Культивирование бактерий на селективных средах проводили в аэробных условиях по стандартным методикам, виды бактерий в изолятах идентифицировали с помощью биохимических тестов (BBL Crystal), масс-спектрометрии (MALDI-TOF), чувствительность к антибиотикам – диск-диффузионными тестами.

Результаты

В целом, частота выявления отдельных бактериальных видов в образцах БАЛ была следующей: K.pneumoniae – 19,1%, P.aeruginosa – 5%, S. epidermidis – 4,2%, S. aureus – 4,5%, Acinetobacter spp. – 3,7%, E.faecium – 7,0%, E.faecalis – 5,3%, E.coli – 2,5%, Enterobacter spp. – 2,3%, Streptococcus pneumoniae – 1,5%, Haemophilus spp. – 0,9% и т.д. Другие микробы Corynebacteria spp., Neisseria spp. и др. встречались реже. Отмечены значительная возрастная динамика состава и частоты различных видов микробиоты в БАЛ после ТГСК. В частности частота высеваемости S.viridans была максимальной у детей младшего возраста (0-5 лет), снижаясь у подростков >15 лет. Та же закономерность, но менее выраженная, отмечена для S.epidermidis. Оба этих микробных вида часто выявляются в нормальной микробиоте. Напротив, частота выявления Klebsiella spp., Pseudomonas spp. и S.aureus в пробах БАЛ после интенсивной терапии и ТГСК повышается с возрастом пациентов, что говорит о большем риске жизнеопасных легочных инфекций после ТГСК, в том числе – резистентными к антибиотикам штаммами из кишечника у взрослых пациентов в период до 180 дней.

Выводы

У больных с онкогематологическими заболеваниями в течение 6 мес. после ТГСК отмечаются существенные сдвиги бронхоальвеолярной микробиоты. Показана сниженная высеваемость S.viridans и S.epidermidis у детей старше 15 лет и взрослых. Выявлено подавление микробиоты БАЛ в течение 1-го месяца после ТГСК. В более поздние сроки отмечен высокий риск колонизации Klebsiella spp. в связи с селекцией антибиотикорезистентных штаммов. Частота встречаемости K.pneumoniae и ее высокий уровень резистентности показывают актуальность данного патогена в развитии нозокомиальных инфекций у иммунокомпрометированных пациентов.

Ключевые слова

Трансплантация гемопоэтических клеток, бактериальная микробиота, бронхоальвеолярные смывы, возраст, временной фактор.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["DOI"]=> array(36) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28643" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-45-53" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-45-53" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_EN"]=> array(36) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28646" ["VALUE"]=> array(2) { ["TEXT"]=> string(290) "<p>Anna A. Spiridonova^1,3, Alisa G. Volkova¹, Alexei B. Chukhlovin^1,2, Ivan S. Moiseev¹, Ludmila S. Zubarovskaya¹, Alexander D. Kulagin¹</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(206) "

Anna A. Spiridonova^1,3, Alisa G. Volkova¹, Alexei B. Chukhlovin^1,2, Ivan S. Moiseev¹, Ludmila S. Zubarovskaya¹, Alexander D. Kulagin¹

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_EN"]=> array(36) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28647" ["VALUE"]=> array(2) { ["TEXT"]=> string(872) "<p>¹ Pavlov University, St. Petersburg, Russia<br> ² Pediatric Research Clinical Center of Infectious Diseases, St. Petersburg, Russia<br> ³ St. Petersburg Pasteur Institute, St. Petersburg, Russia</p><br> <p><b>Correspondence:</b><br> Dr. Anna A. Spiridonova, Head, Department of Clinical Microbiology, Pavlov University, 6-8 L.Tolstoy St., 197022, St. Petersburg, Russia<br> Phone: +7 (921) 920-76-40<br> E-mail: annaasbac@mail.ru</p><br> <p><b>Citation:</b> Spiridonova AA, Volkova AG, Chukhlovin AB, et al. Spectrum of bronchoalveolar bacterial microbiota following hematopoietic stem cell transplantation: age dependence and microbiota shifts. Cell Ther Transplant 2022; 11(2): 45-53.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(734) "

¹ Pavlov University, St. Petersburg, Russia
² Pediatric Research Clinical Center of Infectious Diseases, St. Petersburg, Russia
³ St. Petersburg Pasteur Institute, St. Petersburg, Russia

Correspondence:
Dr. Anna A. Spiridonova, Head, Department of Clinical Microbiology, Pavlov University, 6-8 L.Tolstoy St., 197022, St. Petersburg, Russia
Phone: +7 (921) 920-76-40
E-mail: annaasbac@mail.ru

Citation: Spiridonova AA, Volkova AG, Chukhlovin AB, et al. Spectrum of bronchoalveolar bacterial microbiota following hematopoietic stem cell transplantation: age dependence and microbiota shifts. Cell Ther Transplant 2022; 11(2): 45-53.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_EN"]=> array(36) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28648" ["VALUE"]=> array(2) { ["TEXT"]=> string(4500) "<p style="text-align: justify;"> In healthy persons, lung microbiota shows close correlations with microbial landscape of upper respiratory tract. However, pronounced changes of lung microbiota are revealed by analysis of bronchoalveolar lavage (BAL) in severe pneumonias and other pulmonary complications, especially, in immunocompromised patients. E.g., following intensive cytostatic therapy and hematopoietic stem cell transplantation (HSCT), severe impairement of lung microbiota is observed, due to transient cytopenia, immunocompromised state and massive antibiotic prophylaxis. BAL microbiology shows a number of commensal bacteria including potential pathogens from other infectious sites. Hence, the aim of our study was to evaluate the diversity of aerobic and facultative anaerobic microorganisms in BAL samples from the HSCT patients. </p> <h3>Patients and methods</h3> <p style="text-align: justify;"> Our study included 1123 BAL samples from 691 patients subjected to HSCT (1 to 71 years old). The patients were diagnosed, mainly, with myelo- and lymphoproliferative disorders. Myeloablative was carried out in 44% of cases. Stem cells were obtained from bone marrow or peripheral blood (497 <i>vs </i>596 transplants). </p> <p style="text-align: justify;"> The donor types were as follows: related compatible donors (19.2%); related haploidentical donors (21.6%); unrelated compatible donors (49.1%); autologous transplants (10.2%). </p> <p style="text-align: justify;"> Prophylaxis of graft-versus-host disease (GVHD) was mainly performed by the posttransplant cyclophosphamide (PtCy). BAL samples were collected at diagnostic bronchoscopy within D-100 to D+180 post-HSCT, according to appropriate clinical indications. Microbiological cultures and isolation of aerobes and facultative anaerobic bacteria from BAL samples were made by classical bacteriological techniques. Clinical isolates were identified by commercial biochemical test systems, as well as with MALDI-TOF mass spectrometry. The sensitivity of clinical isolates to antibiotics was determined by means of disk diffusion test systems. </p> <h3>Results</h3> <p style="text-align: justify;"> Detection rates of the most common bacteria in BAL were as follows: <i>K.pneumoniae</i>, 19.1%; <i>P.aeruginosa</i>, 5%; <i>S. epidermidis</i>, 4.2%; <i>S. aureus</i>, 4.5%; <i>Acinetobacter spp.</i>, 3.7%; <i>E.faecium</i>, 7.0%; <i>E.faecalis</i>, 5.3%; <i>E.coli</i>, 2.5%; <i>Enterobacter spp.</i>, 2.3%; <i>Streptococcus pneumonia</i>, 1.5%; <i>Haemophilus spp.</i>, 0.9%, etc. The seeding rates for <i>S.viridans</i> and <i>S.epidermidis</i> tended to decrease with age, whereas the rates of <i>Klebsiella</i> detection, proved to be relatively high in all the studied age groups. Total bacterial numbers decreased during 1^st month after HSCT, including those for <i>S.viridans</i>. Interestingly, the incidence of <i>Klebsiella spp.</i> showed sharp increase at 3-4 months posttransplant, due to selection of antibiotic-resistant strains. </p> <h3>Conclusion</h3> <p style="text-align: justify;"> The patients with oncohematological disease subjected to massive allogeneic HSCT exhibit sufficient changes of bronchoalveolar microbiota over first 6 months posttransplant. Decreased seeding levels are shown for <i>S.viridans</i> and <i>S.epidermidis</i> in adolescents over 15 years and adults. A sufficient suppression of BAL microbiota is revealed within 1st month posttransplant. At later terms after HSCT, high risk of <i>Klebsiella spp.</i> colonization is observed, due to selection of antibiotic-resistant strains. Higher incidence of <i>K.pneumoniae</i> and its high resistance rates suggest relevance of this pathogen for development of nosocomial infections in immunocompromised patients and other clinical settings. </p> <h2>Keywords</h2> <p style="text-align: justify;"> Hematopoietic stem cell transplantation, bacterial microbiota, bronchoalveolar lavage, age dependence, time dependence. </p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(4034) "

In healthy persons, lung microbiota shows close correlations with microbial landscape of upper respiratory tract. However, pronounced changes of lung microbiota are revealed by analysis of bronchoalveolar lavage (BAL) in severe pneumonias and other pulmonary complications, especially, in immunocompromised patients. E.g., following intensive cytostatic therapy and hematopoietic stem cell transplantation (HSCT), severe impairement of lung microbiota is observed, due to transient cytopenia, immunocompromised state and massive antibiotic prophylaxis. BAL microbiology shows a number of commensal bacteria including potential pathogens from other infectious sites. Hence, the aim of our study was to evaluate the diversity of aerobic and facultative anaerobic microorganisms in BAL samples from the HSCT patients.

Patients and methods

Our study included 1123 BAL samples from 691 patients subjected to HSCT (1 to 71 years old). The patients were diagnosed, mainly, with myelo- and lymphoproliferative disorders. Myeloablative was carried out in 44% of cases. Stem cells were obtained from bone marrow or peripheral blood (497 vs 596 transplants).

The donor types were as follows: related compatible donors (19.2%); related haploidentical donors (21.6%); unrelated compatible donors (49.1%); autologous transplants (10.2%).

Prophylaxis of graft-versus-host disease (GVHD) was mainly performed by the posttransplant cyclophosphamide (PtCy). BAL samples were collected at diagnostic bronchoscopy within D-100 to D+180 post-HSCT, according to appropriate clinical indications. Microbiological cultures and isolation of aerobes and facultative anaerobic bacteria from BAL samples were made by classical bacteriological techniques. Clinical isolates were identified by commercial biochemical test systems, as well as with MALDI-TOF mass spectrometry. The sensitivity of clinical isolates to antibiotics was determined by means of disk diffusion test systems.

Results

Detection rates of the most common bacteria in BAL were as follows: K.pneumoniae, 19.1%; P.aeruginosa, 5%; S. epidermidis, 4.2%; S. aureus, 4.5%; Acinetobacter spp., 3.7%; E.faecium, 7.0%; E.faecalis, 5.3%; E.coli, 2.5%; Enterobacter spp., 2.3%; Streptococcus pneumonia, 1.5%; Haemophilus spp., 0.9%, etc. The seeding rates for S.viridans and S.epidermidis tended to decrease with age, whereas the rates of Klebsiella detection, proved to be relatively high in all the studied age groups. Total bacterial numbers decreased during 1^st month after HSCT, including those for S.viridans. Interestingly, the incidence of Klebsiella spp. showed sharp increase at 3-4 months posttransplant, due to selection of antibiotic-resistant strains.

Conclusion

The patients with oncohematological disease subjected to massive allogeneic HSCT exhibit sufficient changes of bronchoalveolar microbiota over first 6 months posttransplant. Decreased seeding levels are shown for S.viridans and S.epidermidis in adolescents over 15 years and adults. A sufficient suppression of BAL microbiota is revealed within 1st month posttransplant. At later terms after HSCT, high risk of Klebsiella spp. colonization is observed, due to selection of antibiotic-resistant strains. Higher incidence of K.pneumoniae and its high resistance rates suggest relevance of this pathogen for development of nosocomial infections in immunocompromised patients and other clinical settings.

Keywords

Hematopoietic stem cell transplantation, bacterial microbiota, bronchoalveolar lavage, age dependence, time dependence.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["NAME_EN"]=> array(36) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28644" ["VALUE"]=> string(136) "Spectrum of bronchoalveolar bacterial microbiota following hematopoietic stem cell transplantation: age dependence and microbiota shifts" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(136) "Spectrum of bronchoalveolar bacterial microbiota following hematopoietic stem cell transplantation: age dependence and microbiota shifts" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" } ["FULL_TEXT_RU"]=> array(36) { ["ID"]=> string(2) "42" ["TIMESTAMP_X"]=> string(19) "2015-09-07 20:29:18" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(23) "Полный текст" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(12) "FULL_TEXT_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "42" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(23) "Полный текст" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["PDF_RU"]=> array(36) { ["ID"]=> string(2) "43" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF RUS" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_RU" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "43" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28645" ["VALUE"]=> string(4) "2853" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2853" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF RUS" ["~DEFAULT_VALUE"]=> string(0) "" } ["PDF_EN"]=> array(36) { ["ID"]=> string(2) "44" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF ENG" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "44" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28649" ["VALUE"]=> string(4) "2852" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2852" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF ENG" ["~DEFAULT_VALUE"]=> string(0) "" } ["NAME_LONG"]=> array(36) { ["ID"]=> string(2) "45" ["TIMESTAMP_X"]=> string(19) "2023-04-13 00:55:00" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(72) "Название (для очень длинных заголовков)" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "NAME_LONG" ["DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "45" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(80) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(72) "Название (для очень длинных заголовков)" ["~DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } } } ["DISPLAY_PROPERTIES"]=> array(10) { ["AUTHOR_EN"]=> array(37) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28646" ["VALUE"]=> array(2) { ["TEXT"]=> string(290) "<p>Anna A. Spiridonova^1,3, Alisa G. Volkova¹, Alexei B. Chukhlovin^1,2, Ivan S. Moiseev¹, Ludmila S. Zubarovskaya¹, Alexander D. Kulagin¹</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(206) "

Anna A. Spiridonova^1,3, Alisa G. Volkova¹, Alexei B. Chukhlovin^1,2, Ivan S. Moiseev¹, Ludmila S. Zubarovskaya¹, Alexander D. Kulagin¹

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(206) "

Anna A. Spiridonova^1,3, Alisa G. Volkova¹, Alexei B. Chukhlovin^1,2, Ivan S. Moiseev¹, Ludmila S. Zubarovskaya¹, Alexander D. Kulagin¹

" } ["SUMMARY_EN"]=> array(37) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28648" ["VALUE"]=> array(2) { ["TEXT"]=> string(4500) "<p style="text-align: justify;"> In healthy persons, lung microbiota shows close correlations with microbial landscape of upper respiratory tract. However, pronounced changes of lung microbiota are revealed by analysis of bronchoalveolar lavage (BAL) in severe pneumonias and other pulmonary complications, especially, in immunocompromised patients. E.g., following intensive cytostatic therapy and hematopoietic stem cell transplantation (HSCT), severe impairement of lung microbiota is observed, due to transient cytopenia, immunocompromised state and massive antibiotic prophylaxis. BAL microbiology shows a number of commensal bacteria including potential pathogens from other infectious sites. Hence, the aim of our study was to evaluate the diversity of aerobic and facultative anaerobic microorganisms in BAL samples from the HSCT patients. </p> <h3>Patients and methods</h3> <p style="text-align: justify;"> Our study included 1123 BAL samples from 691 patients subjected to HSCT (1 to 71 years old). The patients were diagnosed, mainly, with myelo- and lymphoproliferative disorders. Myeloablative was carried out in 44% of cases. Stem cells were obtained from bone marrow or peripheral blood (497 <i>vs </i>596 transplants). </p> <p style="text-align: justify;"> The donor types were as follows: related compatible donors (19.2%); related haploidentical donors (21.6%); unrelated compatible donors (49.1%); autologous transplants (10.2%). </p> <p style="text-align: justify;"> Prophylaxis of graft-versus-host disease (GVHD) was mainly performed by the posttransplant cyclophosphamide (PtCy). BAL samples were collected at diagnostic bronchoscopy within D-100 to D+180 post-HSCT, according to appropriate clinical indications. Microbiological cultures and isolation of aerobes and facultative anaerobic bacteria from BAL samples were made by classical bacteriological techniques. Clinical isolates were identified by commercial biochemical test systems, as well as with MALDI-TOF mass spectrometry. The sensitivity of clinical isolates to antibiotics was determined by means of disk diffusion test systems. </p> <h3>Results</h3> <p style="text-align: justify;"> Detection rates of the most common bacteria in BAL were as follows: <i>K.pneumoniae</i>, 19.1%; <i>P.aeruginosa</i>, 5%; <i>S. epidermidis</i>, 4.2%; <i>S. aureus</i>, 4.5%; <i>Acinetobacter spp.</i>, 3.7%; <i>E.faecium</i>, 7.0%; <i>E.faecalis</i>, 5.3%; <i>E.coli</i>, 2.5%; <i>Enterobacter spp.</i>, 2.3%; <i>Streptococcus pneumonia</i>, 1.5%; <i>Haemophilus spp.</i>, 0.9%, etc. The seeding rates for <i>S.viridans</i> and <i>S.epidermidis</i> tended to decrease with age, whereas the rates of <i>Klebsiella</i> detection, proved to be relatively high in all the studied age groups. Total bacterial numbers decreased during 1^st month after HSCT, including those for <i>S.viridans</i>. Interestingly, the incidence of <i>Klebsiella spp.</i> showed sharp increase at 3-4 months posttransplant, due to selection of antibiotic-resistant strains. </p> <h3>Conclusion</h3> <p style="text-align: justify;"> The patients with oncohematological disease subjected to massive allogeneic HSCT exhibit sufficient changes of bronchoalveolar microbiota over first 6 months posttransplant. Decreased seeding levels are shown for <i>S.viridans</i> and <i>S.epidermidis</i> in adolescents over 15 years and adults. A sufficient suppression of BAL microbiota is revealed within 1st month posttransplant. At later terms after HSCT, high risk of <i>Klebsiella spp.</i> colonization is observed, due to selection of antibiotic-resistant strains. Higher incidence of <i>K.pneumoniae</i> and its high resistance rates suggest relevance of this pathogen for development of nosocomial infections in immunocompromised patients and other clinical settings. </p> <h2>Keywords</h2> <p style="text-align: justify;"> Hematopoietic stem cell transplantation, bacterial microbiota, bronchoalveolar lavage, age dependence, time dependence. </p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(4034) "

In healthy persons, lung microbiota shows close correlations with microbial landscape of upper respiratory tract. However, pronounced changes of lung microbiota are revealed by analysis of bronchoalveolar lavage (BAL) in severe pneumonias and other pulmonary complications, especially, in immunocompromised patients. E.g., following intensive cytostatic therapy and hematopoietic stem cell transplantation (HSCT), severe impairement of lung microbiota is observed, due to transient cytopenia, immunocompromised state and massive antibiotic prophylaxis. BAL microbiology shows a number of commensal bacteria including potential pathogens from other infectious sites. Hence, the aim of our study was to evaluate the diversity of aerobic and facultative anaerobic microorganisms in BAL samples from the HSCT patients.

Patients and methods

Our study included 1123 BAL samples from 691 patients subjected to HSCT (1 to 71 years old). The patients were diagnosed, mainly, with myelo- and lymphoproliferative disorders. Myeloablative was carried out in 44% of cases. Stem cells were obtained from bone marrow or peripheral blood (497 vs 596 transplants).

The donor types were as follows: related compatible donors (19.2%); related haploidentical donors (21.6%); unrelated compatible donors (49.1%); autologous transplants (10.2%).

Prophylaxis of graft-versus-host disease (GVHD) was mainly performed by the posttransplant cyclophosphamide (PtCy). BAL samples were collected at diagnostic bronchoscopy within D-100 to D+180 post-HSCT, according to appropriate clinical indications. Microbiological cultures and isolation of aerobes and facultative anaerobic bacteria from BAL samples were made by classical bacteriological techniques. Clinical isolates were identified by commercial biochemical test systems, as well as with MALDI-TOF mass spectrometry. The sensitivity of clinical isolates to antibiotics was determined by means of disk diffusion test systems.

Results

Detection rates of the most common bacteria in BAL were as follows: K.pneumoniae, 19.1%; P.aeruginosa, 5%; S. epidermidis, 4.2%; S. aureus, 4.5%; Acinetobacter spp., 3.7%; E.faecium, 7.0%; E.faecalis, 5.3%; E.coli, 2.5%; Enterobacter spp., 2.3%; Streptococcus pneumonia, 1.5%; Haemophilus spp., 0.9%, etc. The seeding rates for S.viridans and S.epidermidis tended to decrease with age, whereas the rates of Klebsiella detection, proved to be relatively high in all the studied age groups. Total bacterial numbers decreased during 1^st month after HSCT, including those for S.viridans. Interestingly, the incidence of Klebsiella spp. showed sharp increase at 3-4 months posttransplant, due to selection of antibiotic-resistant strains.

Conclusion

The patients with oncohematological disease subjected to massive allogeneic HSCT exhibit sufficient changes of bronchoalveolar microbiota over first 6 months posttransplant. Decreased seeding levels are shown for S.viridans and S.epidermidis in adolescents over 15 years and adults. A sufficient suppression of BAL microbiota is revealed within 1st month posttransplant. At later terms after HSCT, high risk of Klebsiella spp. colonization is observed, due to selection of antibiotic-resistant strains. Higher incidence of K.pneumoniae and its high resistance rates suggest relevance of this pathogen for development of nosocomial infections in immunocompromised patients and other clinical settings.

Keywords

Hematopoietic stem cell transplantation, bacterial microbiota, bronchoalveolar lavage, age dependence, time dependence.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(4034) "

In healthy persons, lung microbiota shows close correlations with microbial landscape of upper respiratory tract. However, pronounced changes of lung microbiota are revealed by analysis of bronchoalveolar lavage (BAL) in severe pneumonias and other pulmonary complications, especially, in immunocompromised patients. E.g., following intensive cytostatic therapy and hematopoietic stem cell transplantation (HSCT), severe impairement of lung microbiota is observed, due to transient cytopenia, immunocompromised state and massive antibiotic prophylaxis. BAL microbiology shows a number of commensal bacteria including potential pathogens from other infectious sites. Hence, the aim of our study was to evaluate the diversity of aerobic and facultative anaerobic microorganisms in BAL samples from the HSCT patients.

Patients and methods

Our study included 1123 BAL samples from 691 patients subjected to HSCT (1 to 71 years old). The patients were diagnosed, mainly, with myelo- and lymphoproliferative disorders. Myeloablative was carried out in 44% of cases. Stem cells were obtained from bone marrow or peripheral blood (497 vs 596 transplants).

The donor types were as follows: related compatible donors (19.2%); related haploidentical donors (21.6%); unrelated compatible donors (49.1%); autologous transplants (10.2%).

Prophylaxis of graft-versus-host disease (GVHD) was mainly performed by the posttransplant cyclophosphamide (PtCy). BAL samples were collected at diagnostic bronchoscopy within D-100 to D+180 post-HSCT, according to appropriate clinical indications. Microbiological cultures and isolation of aerobes and facultative anaerobic bacteria from BAL samples were made by classical bacteriological techniques. Clinical isolates were identified by commercial biochemical test systems, as well as with MALDI-TOF mass spectrometry. The sensitivity of clinical isolates to antibiotics was determined by means of disk diffusion test systems.

Results

Detection rates of the most common bacteria in BAL were as follows: K.pneumoniae, 19.1%; P.aeruginosa, 5%; S. epidermidis, 4.2%; S. aureus, 4.5%; Acinetobacter spp., 3.7%; E.faecium, 7.0%; E.faecalis, 5.3%; E.coli, 2.5%; Enterobacter spp., 2.3%; Streptococcus pneumonia, 1.5%; Haemophilus spp., 0.9%, etc. The seeding rates for S.viridans and S.epidermidis tended to decrease with age, whereas the rates of Klebsiella detection, proved to be relatively high in all the studied age groups. Total bacterial numbers decreased during 1^st month after HSCT, including those for S.viridans. Interestingly, the incidence of Klebsiella spp. showed sharp increase at 3-4 months posttransplant, due to selection of antibiotic-resistant strains.

Conclusion

The patients with oncohematological disease subjected to massive allogeneic HSCT exhibit sufficient changes of bronchoalveolar microbiota over first 6 months posttransplant. Decreased seeding levels are shown for S.viridans and S.epidermidis in adolescents over 15 years and adults. A sufficient suppression of BAL microbiota is revealed within 1st month posttransplant. At later terms after HSCT, high risk of Klebsiella spp. colonization is observed, due to selection of antibiotic-resistant strains. Higher incidence of K.pneumoniae and its high resistance rates suggest relevance of this pathogen for development of nosocomial infections in immunocompromised patients and other clinical settings.

Keywords

Hematopoietic stem cell transplantation, bacterial microbiota, bronchoalveolar lavage, age dependence, time dependence.

" } ["DOI"]=> array(37) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28643" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-45-53" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-45-53" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-45-53" } ["NAME_EN"]=> array(37) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28644" ["VALUE"]=> string(136) "Spectrum of bronchoalveolar bacterial microbiota following hematopoietic stem cell transplantation: age dependence and microbiota shifts" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(136) "Spectrum of bronchoalveolar bacterial microbiota following hematopoietic stem cell transplantation: age dependence and microbiota shifts" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(136) "Spectrum of bronchoalveolar bacterial microbiota following hematopoietic stem cell transplantation: age dependence and microbiota shifts" } ["ORGANIZATION_EN"]=> array(37) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28647" ["VALUE"]=> array(2) { ["TEXT"]=> string(872) "<p>¹ Pavlov University, St. Petersburg, Russia<br> ² Pediatric Research Clinical Center of Infectious Diseases, St. Petersburg, Russia<br> ³ St. Petersburg Pasteur Institute, St. Petersburg, Russia</p><br> <p><b>Correspondence:</b><br> Dr. Anna A. Spiridonova, Head, Department of Clinical Microbiology, Pavlov University, 6-8 L.Tolstoy St., 197022, St. Petersburg, Russia<br> Phone: +7 (921) 920-76-40<br> E-mail: annaasbac@mail.ru</p><br> <p><b>Citation:</b> Spiridonova AA, Volkova AG, Chukhlovin AB, et al. Spectrum of bronchoalveolar bacterial microbiota following hematopoietic stem cell transplantation: age dependence and microbiota shifts. Cell Ther Transplant 2022; 11(2): 45-53.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(734) "

¹ Pavlov University, St. Petersburg, Russia
² Pediatric Research Clinical Center of Infectious Diseases, St. Petersburg, Russia
³ St. Petersburg Pasteur Institute, St. Petersburg, Russia

Correspondence:
Dr. Anna A. Spiridonova, Head, Department of Clinical Microbiology, Pavlov University, 6-8 L.Tolstoy St., 197022, St. Petersburg, Russia
Phone: +7 (921) 920-76-40
E-mail: annaasbac@mail.ru

Citation: Spiridonova AA, Volkova AG, Chukhlovin AB, et al. Spectrum of bronchoalveolar bacterial microbiota following hematopoietic stem cell transplantation: age dependence and microbiota shifts. Cell Ther Transplant 2022; 11(2): 45-53.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(734) "

¹ Pavlov University, St. Petersburg, Russia
² Pediatric Research Clinical Center of Infectious Diseases, St. Petersburg, Russia
³ St. Petersburg Pasteur Institute, St. Petersburg, Russia

Correspondence:
Dr. Anna A. Spiridonova, Head, Department of Clinical Microbiology, Pavlov University, 6-8 L.Tolstoy St., 197022, St. Petersburg, Russia
Phone: +7 (921) 920-76-40
E-mail: annaasbac@mail.ru

Citation: Spiridonova AA, Volkova AG, Chukhlovin AB, et al. Spectrum of bronchoalveolar bacterial microbiota following hematopoietic stem cell transplantation: age dependence and microbiota shifts. Cell Ther Transplant 2022; 11(2): 45-53.

" } ["AUTHOR_RU"]=> array(37) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28640" ["VALUE"]=> array(2) { ["TEXT"]=> string(381) "<p>Анна А. Спиридонова^1,3, Алиса Г. Волкова¹, Алексей Б. Чухловин^1,2, Иван С. Моисеев¹, Людмила С. Зубаровская¹, Александр Д. Кулагин¹</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(297) "

Анна А. Спиридонова^1,3, Алиса Г. Волкова¹, Алексей Б. Чухловин^1,2, Иван С. Моисеев¹, Людмила С. Зубаровская¹, Александр Д. Кулагин¹

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(297) "

Анна А. Спиридонова^1,3, Алиса Г. Волкова¹, Алексей Б. Чухловин^1,2, Иван С. Моисеев¹, Людмила С. Зубаровская¹, Александр Д. Кулагин¹

" } ["SUBMITTED"]=> array(37) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28638" ["VALUE"]=> string(22) "05/15/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "05/15/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "05/15/2022 12:00:00 am" } ["ACCEPTED"]=> array(37) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28639" ["VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "06/24/2022 12:00:00 am" } ["SUMMARY_RU"]=> array(37) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28642" ["VALUE"]=> array(2) { ["TEXT"]=> string(6856) "<p style="text-align: justify;"> Состав микробиоты бронхоальвеолярных отделов у здоровых детей и взрослых в целом коррелирует с составом популяций верхних дыхательных путей. Однако при развитии тяжелых пневмоний, особенно у пациентов с иммунодефицитами, отмечается существенное нарастание количества, частоты выявления и биоразнообразия бактерий в бронхоальвеолярных смывах (БАЛ), наряду с колонизацией бронхов условно патогенными микроорганизмами из других инфицированных сайтов. Так, у многих пациентов с онкологическими заболеваниями на фоне цитостатической терапии развиваются тяжелые пневмонии с полимикробной колонизаций нижних дыхательных путей. Целью нашей работы была сравнительная оценка аэробной и факультативно-анаэробной микробиоты в образцах БАЛ от детей и взрослых пациентов после трансплантации гемопоэтических клеток (ТГСК). </p> <h3>Пациенты и методы</h3> <p style="text-align: justify;"> Проведено обследование 691 пациента, главным образом – с онкогематологическими заболеваниями, леченными цитостатической терапией и ТГСК (алло-ТГСК в 90% случаев). Возраст пациентов составлял от 1 до 71 г. (медиана – 38,5 л.). Применяли миело- или немиелоаблативную кондиционирующую терапию (44% и 56% случаев). Для исследования проводили забор 1123 образцов биоматериала (БАЛ) при диагностической бронхоскопии по соответствующим клиническим показаниями в период от D-100 до D+180 после ТГСК. Культивирование бактерий на селективных средах проводили в аэробных условиях по стандартным методикам, виды бактерий в изолятах идентифицировали с помощью биохимических тестов (BBL Crystal), масс-спектрометрии (MALDI-TOF), чувствительность к антибиотикам – диск-диффузионными тестами. </p> <h3>Результаты</h3> <p style="text-align: justify;"> В целом, частота выявления отдельных бактериальных видов в образцах БАЛ была следующей: <i>K.pneumoniae</i> – 19,1%, <i>P.aeruginosa</i> – 5%, <i>S. epidermidis</i> – 4,2%, <i>S. aureus</i> – 4,5%, <i>Acinetobacter spp.</i> – 3,7%, <i>E.faecium</i> – 7,0%, <i>E.faecalis</i> – 5,3%, <i>E.coli</i> – 2,5%, <i>Enterobacter spp.</i> – 2,3%, <i>Streptococcus pneumoniae</i> – 1,5%, <i>Haemophilus spp.</i> – 0,9% и т.д. Другие микробы <i>Corynebacteria spp., Neisseria spp.</i> и др. встречались реже. Отмечены значительная возрастная динамика состава и частоты различных видов микробиоты в БАЛ после ТГСК. В частности частота высеваемости <i>S.viridans</i> была максимальной у детей младшего возраста (0-5 лет), снижаясь у подростков &gt;15 лет. Та же закономерность, но менее выраженная, отмечена для <i>S.epidermidis</i>. Оба этих микробных вида часто выявляются в нормальной микробиоте. Напротив, частота выявления <i>Klebsiella spp., Pseudomonas spp.</i> и <i>S.aureus</i> в пробах БАЛ после интенсивной терапии и ТГСК повышается с возрастом пациентов, что говорит о большем риске жизнеопасных легочных инфекций после ТГСК, в том числе – резистентными к антибиотикам штаммами из кишечника у взрослых пациентов в период до 180 дней. </p> <h3>Выводы</h3> <p style="text-align: justify;"> У больных с онкогематологическими заболеваниями в течение 6 мес. после ТГСК отмечаются существенные сдвиги бронхоальвеолярной микробиоты. Показана сниженная высеваемость <i>S.viridans</i> и <i> S.epidermidis</i> у детей старше 15 лет и взрослых. Выявлено подавление микробиоты БАЛ в течение 1-го месяца после ТГСК. В более поздние сроки отмечен высокий риск колонизации <i>Klebsiella spp.</i> в связи с селекцией антибиотикорезистентных штаммов. Частота встречаемости <i>K.pneumoniae</i> и ее высокий уровень резистентности показывают актуальность данного патогена в развитии нозокомиальных инфекций у иммунокомпрометированных пациентов. </p> <h2>Ключевые слова</h2> <p style="text-align: justify;"> Трансплантация гемопоэтических клеток, бактериальная микробиота, бронхоальвеолярные смывы, возраст, временной фактор. </p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(6454) "

Состав микробиоты бронхоальвеолярных отделов у здоровых детей и взрослых в целом коррелирует с составом популяций верхних дыхательных путей. Однако при развитии тяжелых пневмоний, особенно у пациентов с иммунодефицитами, отмечается существенное нарастание количества, частоты выявления и биоразнообразия бактерий в бронхоальвеолярных смывах (БАЛ), наряду с колонизацией бронхов условно патогенными микроорганизмами из других инфицированных сайтов. Так, у многих пациентов с онкологическими заболеваниями на фоне цитостатической терапии развиваются тяжелые пневмонии с полимикробной колонизаций нижних дыхательных путей. Целью нашей работы была сравнительная оценка аэробной и факультативно-анаэробной микробиоты в образцах БАЛ от детей и взрослых пациентов после трансплантации гемопоэтических клеток (ТГСК).

Пациенты и методы

Проведено обследование 691 пациента, главным образом – с онкогематологическими заболеваниями, леченными цитостатической терапией и ТГСК (алло-ТГСК в 90% случаев). Возраст пациентов составлял от 1 до 71 г. (медиана – 38,5 л.). Применяли миело- или немиелоаблативную кондиционирующую терапию (44% и 56% случаев). Для исследования проводили забор 1123 образцов биоматериала (БАЛ) при диагностической бронхоскопии по соответствующим клиническим показаниями в период от D-100 до D+180 после ТГСК. Культивирование бактерий на селективных средах проводили в аэробных условиях по стандартным методикам, виды бактерий в изолятах идентифицировали с помощью биохимических тестов (BBL Crystal), масс-спектрометрии (MALDI-TOF), чувствительность к антибиотикам – диск-диффузионными тестами.

Результаты

В целом, частота выявления отдельных бактериальных видов в образцах БАЛ была следующей: K.pneumoniae – 19,1%, P.aeruginosa – 5%, S. epidermidis – 4,2%, S. aureus – 4,5%, Acinetobacter spp. – 3,7%, E.faecium – 7,0%, E.faecalis – 5,3%, E.coli – 2,5%, Enterobacter spp. – 2,3%, Streptococcus pneumoniae – 1,5%, Haemophilus spp. – 0,9% и т.д. Другие микробы Corynebacteria spp., Neisseria spp. и др. встречались реже. Отмечены значительная возрастная динамика состава и частоты различных видов микробиоты в БАЛ после ТГСК. В частности частота высеваемости S.viridans была максимальной у детей младшего возраста (0-5 лет), снижаясь у подростков >15 лет. Та же закономерность, но менее выраженная, отмечена для S.epidermidis. Оба этих микробных вида часто выявляются в нормальной микробиоте. Напротив, частота выявления Klebsiella spp., Pseudomonas spp. и S.aureus в пробах БАЛ после интенсивной терапии и ТГСК повышается с возрастом пациентов, что говорит о большем риске жизнеопасных легочных инфекций после ТГСК, в том числе – резистентными к антибиотикам штаммами из кишечника у взрослых пациентов в период до 180 дней.

Выводы

У больных с онкогематологическими заболеваниями в течение 6 мес. после ТГСК отмечаются существенные сдвиги бронхоальвеолярной микробиоты. Показана сниженная высеваемость S.viridans и S.epidermidis у детей старше 15 лет и взрослых. Выявлено подавление микробиоты БАЛ в течение 1-го месяца после ТГСК. В более поздние сроки отмечен высокий риск колонизации Klebsiella spp. в связи с селекцией антибиотикорезистентных штаммов. Частота встречаемости K.pneumoniae и ее высокий уровень резистентности показывают актуальность данного патогена в развитии нозокомиальных инфекций у иммунокомпрометированных пациентов.

Ключевые слова

Трансплантация гемопоэтических клеток, бактериальная микробиота, бронхоальвеолярные смывы, возраст, временной фактор.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(6454) "

Состав микробиоты бронхоальвеолярных отделов у здоровых детей и взрослых в целом коррелирует с составом популяций верхних дыхательных путей. Однако при развитии тяжелых пневмоний, особенно у пациентов с иммунодефицитами, отмечается существенное нарастание количества, частоты выявления и биоразнообразия бактерий в бронхоальвеолярных смывах (БАЛ), наряду с колонизацией бронхов условно патогенными микроорганизмами из других инфицированных сайтов. Так, у многих пациентов с онкологическими заболеваниями на фоне цитостатической терапии развиваются тяжелые пневмонии с полимикробной колонизаций нижних дыхательных путей. Целью нашей работы была сравнительная оценка аэробной и факультативно-анаэробной микробиоты в образцах БАЛ от детей и взрослых пациентов после трансплантации гемопоэтических клеток (ТГСК).

Пациенты и методы

Проведено обследование 691 пациента, главным образом – с онкогематологическими заболеваниями, леченными цитостатической терапией и ТГСК (алло-ТГСК в 90% случаев). Возраст пациентов составлял от 1 до 71 г. (медиана – 38,5 л.). Применяли миело- или немиелоаблативную кондиционирующую терапию (44% и 56% случаев). Для исследования проводили забор 1123 образцов биоматериала (БАЛ) при диагностической бронхоскопии по соответствующим клиническим показаниями в период от D-100 до D+180 после ТГСК. Культивирование бактерий на селективных средах проводили в аэробных условиях по стандартным методикам, виды бактерий в изолятах идентифицировали с помощью биохимических тестов (BBL Crystal), масс-спектрометрии (MALDI-TOF), чувствительность к антибиотикам – диск-диффузионными тестами.

Результаты

В целом, частота выявления отдельных бактериальных видов в образцах БАЛ была следующей: K.pneumoniae – 19,1%, P.aeruginosa – 5%, S. epidermidis – 4,2%, S. aureus – 4,5%, Acinetobacter spp. – 3,7%, E.faecium – 7,0%, E.faecalis – 5,3%, E.coli – 2,5%, Enterobacter spp. – 2,3%, Streptococcus pneumoniae – 1,5%, Haemophilus spp. – 0,9% и т.д. Другие микробы Corynebacteria spp., Neisseria spp. и др. встречались реже. Отмечены значительная возрастная динамика состава и частоты различных видов микробиоты в БАЛ после ТГСК. В частности частота высеваемости S.viridans была максимальной у детей младшего возраста (0-5 лет), снижаясь у подростков >15 лет. Та же закономерность, но менее выраженная, отмечена для S.epidermidis. Оба этих микробных вида часто выявляются в нормальной микробиоте. Напротив, частота выявления Klebsiella spp., Pseudomonas spp. и S.aureus в пробах БАЛ после интенсивной терапии и ТГСК повышается с возрастом пациентов, что говорит о большем риске жизнеопасных легочных инфекций после ТГСК, в том числе – резистентными к антибиотикам штаммами из кишечника у взрослых пациентов в период до 180 дней.

Выводы

У больных с онкогематологическими заболеваниями в течение 6 мес. после ТГСК отмечаются существенные сдвиги бронхоальвеолярной микробиоты. Показана сниженная высеваемость S.viridans и S.epidermidis у детей старше 15 лет и взрослых. Выявлено подавление микробиоты БАЛ в течение 1-го месяца после ТГСК. В более поздние сроки отмечен высокий риск колонизации Klebsiella spp. в связи с селекцией антибиотикорезистентных штаммов. Частота встречаемости K.pneumoniae и ее высокий уровень резистентности показывают актуальность данного патогена в развитии нозокомиальных инфекций у иммунокомпрометированных пациентов.

Ключевые слова

Трансплантация гемопоэтических клеток, бактериальная микробиота, бронхоальвеолярные смывы, возраст, временной фактор.

" } ["ORGANIZATION_RU"]=> array(37) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28641" ["VALUE"]=> array(2) { ["TEXT"]=> string(649) "<p>¹ Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия<br> ² Детский научно-клинический центр инфекционных болезней, Санкт-Петербург, Россия<br> ³ Санкт-Петербургский НИИ эпидемиологии и микробиологии им. Пастера, Санкт-Петербург, Россия </p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(589) "

¹ Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия
² Детский научно-клинический центр инфекционных болезней, Санкт-Петербург, Россия
³ Санкт-Петербургский НИИ эпидемиологии и микробиологии им. Пастера, Санкт-Петербург, Россия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(589) "

¹ Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия
² Детский научно-клинический центр инфекционных болезней, Санкт-Петербург, Россия
³ Санкт-Петербургский НИИ эпидемиологии и микробиологии им. Пастера, Санкт-Петербург, Россия

" } } } [4]=> array(49) { ["IBLOCK_SECTION_ID"]=> string(3) "212" ["~IBLOCK_SECTION_ID"]=> string(3) "212" ["ID"]=> string(4) "2060" ["~ID"]=> string(4) "2060" ["IBLOCK_ID"]=> string(1) "2" ["~IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(203) "Рецидивы гепатоцеллюлярной карциномы после трансплантации печени: клинические особенности, лечение и исходы " ["~NAME"]=> string(203) "Рецидивы гепатоцеллюлярной карциномы после трансплантации печени: клинические особенности, лечение и исходы " ["ACTIVE_FROM"]=> NULL ["~ACTIVE_FROM"]=> NULL ["TIMESTAMP_X"]=> string(22) "08/09/2022 12:14:35 pm" ["~TIMESTAMP_X"]=> string(22) "08/09/2022 12:14:35 pm" ["DETAIL_PAGE_URL"]=> string(149) "/en/archive/tom-11-nomer-2/klinicheskie-raboty/retsidivy-gepatotsellyulyarnoy-kartsinomy-posle-transplantatsii-pecheni-klinicheskie-osobennosti-lech/" ["~DETAIL_PAGE_URL"]=> string(149) "/en/archive/tom-11-nomer-2/klinicheskie-raboty/retsidivy-gepatotsellyulyarnoy-kartsinomy-posle-transplantatsii-pecheni-klinicheskie-osobennosti-lech/" ["LIST_PAGE_URL"]=> string(12) "/en/archive/" ["~LIST_PAGE_URL"]=> string(12) "/en/archive/" ["DETAIL_TEXT"]=> string(22000) "

Introduction

Since introduction of Milan criteria, an excellent outcomes of liver transplantation (LT) for hepatocellular carcinoma (HCC) were validated [1-3]. Unfortunately, this favorable outcome is not always achievable. The risk for recurrent HCC (rHCC) is still reported in approximately one-fifth of patients transplanted for presence of HCC. The occurrence of rHCC is a significant setback in the clinical course of affected patients with dismal prognosis reported in most instances [4-9].

Furthermore, the incidence of rHCC poses significant ethical concerns about current allocation system which favors transplantation of more HCC patients. The number of transplanted HCC patients has been reported to be steadily increasing over last two decades. The transplantation activity causes increased burden of already limited deceased donor pool, or provokes a debate over the living donation outcomes [10, 11].

It is therefore crucial to report the cases of rHCC following liver transplantation, to identify their clinical patterns, and to promote development of screening protocols for their early detection and treatment. Moreover, a comprehensive analysis should be made for identifying the risk factors associated with HCC recurrence.

This study aims primarily at reporting of the incidence of recurrent HCC following liver transplantation, to describe their clinical patterns, current therapeutic modalities at our center. It also addresses potential risk factors of HCC recurrence, by comparing them to the data reported elsewhere.

Materials and methods

A total of 178 patients diagnosed for having HCC approved the research consent and were subsequently included in the study. The clinical charts for those patients considered for liver transplant at our center were retrospectively reviewed. HCC at our center is diagnosed by contrast-enhanced computed tomography (CT) and/or abdominal magnetic resonance imaging (MRI). Staging was based on chest CT, cranial CT, and technetium-99m bone scintigraphy, to exclude extra-hepatic disease.

Current study was approved by our institutional Research Ethical Committee under the 8/11/09/02/2020 code. The ethical approval was obtained before conduction of this study. Patients were consented to use medical charts to obtain pertinent medical information for research purposes only. Extensive efforts to protect patients’ identity were also ensured. In accordance with Declaration of Helsinki, all the patients were consented about their clinical management and were also informed that their decision to approve or disapprove the research consent will not influence their clinical management.

Our center currently adopts Milan Criteria (MC) as the standard criteria for LT for HCC. Any patient who is beyond MC is usually considered for a downstaging protocol using one or more locoregional therapies to downstage the tumor to within MC. LT for the down-staged patients is considered after further confirmation of the absence of extrahepatic disease. Pretransplant locoregional therapies included radiofrequency ablation (RFA), trans-arterial chemotherapy (TACE) and/or trans-arterial radiotherapy (TARE). Cases which were found unfit for liver transplantation were excluded from the study.

LT was performed using either deceased donor liver transplants (DDLT), or liver transplantation from a living donor (LDLT). The LDLT donors were first- and second-degree relatives of respective patients. Cases of pediatric LT or liver re-transplantation were excluded from this study.

The liver explants were studied for presence of HCC lesions. Size, number, tumor grade, and lymph vascular invasion were reported by an experienced liver transplant pathologist. Triple immunosuppression protocol was utilized for LT recipients including calcineurin inhibitors (CNI) corticosteroids and mycophenolate mofetil.

İn addition to routine liver transplant follow-up protocol, the patients transplanted for HCC were followed up by liver ultrasound, α-fetoprotein (AFP), and liver function tests at six-month intervals for the rest of their lives. The cases with new focal liver lesion were further diagnosed by contrast-enhanced dynamic study to characterize this lesions, and liver biopsy was also taken to diagnose uncertain cases. The recurrent HCC (rHCC) cases were identified, and their clinical data were comprehensively collected.

Demographic data, pretransplant variables, transplant-related variables as well as characteristics of malignancies (number of lesions, tumor size and grade, lymph vascular invasion) were retrieved from the patient charts. Additionally, risk estimation of tumor recurrence after transplant (RETREAT score) was calculated [12], and these data were correlated with HCC recurrence. The data were analyzed by means of t-test and chi-square test. P-value of <0.05 was considered statistically significant. Kaplan-Meier curves were used to express survival outcomes and its significance was determined by log-rank test.

Results

A total of 178 patients presenting with HCC agreed to participate in the study. Fig. 1 shows their distribution as regards liver transplant, downstaging locoregional therapy (LRT) and incidence of recurrent HCC.

Figure 1. Distribution of HCC patients according to LT, LRT, and incidence of rHCC

148 adult patients underwent LT due to presence of HCC at our institution between August 2006 and December 2020. They included 93 males (62.8%) and 55 females (37.2%), ninety-six of them were within Milan criteria. The mean post-transplant follow-up for the studied patients was 53±34.8 months, range from 24.3 to 160.1 months. The overall 5-year survival of patients, grafts, and tumor-free survival were 72.7%, 90.8% and 87.7%, respectively (Fig. 2).

Figure 2. Overall patient, graft and tumor-free survival following LT for HCC patients

A total of 16 patients had HCC recurrence during the follow-up period (8.9% of transplanted HCC patients). Of them, eleven rHCC cases were registered in males. Nevertheless, gender factor did not differ significantly between patients with HCC recurrence compared to those with no rHCC (P=0.6). The mean age at HCC recurrence was 60.8±4.1 years. The current study demonstrated that most HCC recurrencies (68.8%) were observed within two years from liver transplant. Moreover, elevated AFP and distant metastases (mainly, lung lesions) dominated in clinical pattern in 87.5% and 56.3% of rHCC patients, respectively (Table 1).

Vascular invasion, poor tumor differentiation and RETREAT score differed significantly between the patients with rHCC and patients with no HCC recurrence. On the other hand, transplant criteria, type of transplant and total tumor volume (TTV)>115 cm³ showed no significant difference (Table 2). Correlation between RETREAT score, transplant criteria, and HCC recurrence is shown in Table 3.

Unfortunately, all rHCC cases in the current study were beyond surgical or locoregional therapy. Sorafenib was administered to these patients as a supportive measure. None of these patients were alive at the time of current report, their median survival following rHCC diagnosis was 135±11.5 days.

Table 2. Transplant and tumor-related variables for rHCC following liver transplantation

Table 3. Correlation between RETREAT score, transplant criteria and HCC recurrence

Discussion

The results of current study compare well with medical literature as regards the overall excellent outcome for transplanted HCC patients and the overall rate of rHCC [2, 3]. Filgueira et al., reported rHCC in 15-20% of transplanted HCC patients within a median of 12-16 months form liver transplant with around 75% occurring in the first two years. Timing of HCC recurrence in the current study was within two years following liver transplant in 68.8% of patients.

Filgueira et al. reported a poor prognosis for rHCC patients with median survival of 7-16 months from diagnosis of recurrence. They also claimed that HCC recurrence should be considered a systemic disease as only 30% of patients show isolated hepatic recurrence [4]. Chagas et al., reported 8% HCC recurrence rate and isolated hepatic recurrence in more than one-quarter of patients. Post-recurrence survival rates were 34% at 1 year compared to 0% in the current study [5].

Filgueira et al., reported that curative therapeutic modalities including reaction and ablative techniques are of value specially in cases where a smaller number and size of lesions is detected provided the disease is strictly confined to the liver. They quoted significantly longer median survival (22 months compared to 9 months in those with palliative treatment only) [5].

In the current study, it was noted that rHCC presentation is of the very late pattern, where there are limited options for therapeutic options and only palliation is possible. This might indicate vulnerability in screening protocol for rHCC and immunosuppression in the current study. It calls for more tailored approach for patients with high risk for HCC recurrence.

The use of rapamycin in patient transplanted for HCC was suggested and practiced in many transplant center [13-15]. It was hypothesized that rapamycin will improve recurrence free survival in these vulnerable patients. Nevertheless; (SiLVER trial) failed to show such effect [16].

Risk factors for HCC recurrence were traditionally reported to include male gender, those beyond Milan criteria, or those with partial response to LRT, AFP >400 ng/dL, those microvascular invasion, poor differentiation, TTV>115 cm³, and LDLT [6-9].

Only vascular invasion and poor tumor differentiation were shown to significantly related to HCC recurrence in the current study. Conversely, transplant criteria, TTV and type of transplant did not show significant relation.

As regards HCC outcome, much emphasis was always credited to the classical volume related tumor criteria e.g., number of HCC lesions, size of the HCC lesions, TTV, etc. the results of current study confirm that volume related criteria are at least insufficient to predict high risk patients for HCC recurrence [17-21]. More factors should be included in this regards namely, the biology-related tumor criteria e.g., poor differentiation, and vascular invasion. It is thus feasible to apply risk stratification scores for HCC recurrence which encompass various radiological, pathological and laboratory variables like RETREAT score [12, 22, 23].

In the current study, HCC recurrence was entirely reported in patients with 3 or more points on the RETREAT score, the incidence of rHCC incidence increased from nil in those of ≤2 points to around one third of those with 3-5 points and up to 70 % of those with more than 5 points. RETREAT score predicted the occurrence of rHCC in our patients and correlated significantly with its occurrence, P=0.00.

Conclusion

HCC recurrence is still a significant medical concern for transplanted HCC patients. Early detection is imperative for the use of more curative options for the management of rHCC.

Volume related criteria are insufficient to predict high risk patients for HCC recurrence. More factors should be included in this regard, namely poor differentiation, and vascular invasion. Risk stratification models for HCC recurrence should be employed to identify high risk patients for HCC recurrence. RETRAET score is a valid and feasible option in this regards.

Screening protocols should be tailored to the risk of HCC recurrence. Closer follow up, and more liberal use of dynamic imaging should be employed in those with high risk for HCC recurrence.

Conflict of interest

This research received no external funding. The authors declare no conflict of interest.

References

1. Mazzaferro V, Regalia E, Doci R, Andreola S, Pulvirenti A, Bozzetti F, et al. Liver transplantation for the treatment of small hepatocellular carcinomas in patients with cirrhosis. N Engl J Med. 1996; 334(11):693-699. doi: 10.1056/NEJM199603143341104
2. Pomfret EA, Washburn K, Wald C, Nalesnik MA, Douglas D, Russo M, et al. Report of a national conference on liver allocation in patients with hepatocellular carcinoma in the United States. Liver Transpl. 2010; 16(3):262-278. doi: 10.1002/lt.21999
3. Clavien PA, Lesurtel M, Bossuyt PM, Gores GJ, Langer B, Perrier A; OLT for HCC Consensus Group. Recommendations for liver transplantation for hepatocellular carcinoma: an international consensus conference report. Lancet Oncol. 2012; 13(1):e11-22.
   doi: 10.1016/S1470-2045(11)70175-9
4. Filgueira NA. Hepatocellular carcinoma recurrence after liver transplantation: Risk factors, screening and clinical presentation. World J Hepatol. 2019 Mar 27;11(3):261-272. doi: 10.4254/wjh.v11.i3.261
5. Chagas AL, Felga GEG, Diniz MA, Silva RF, Mattos AA, Silva RCMA, et al. Hepatocellular carcinoma recurrence after liver transplantation in a Brazilian multicenter study: clinical profile and prognostic factors of survival. Eur J Gastroenterol Hepatol. 2019; 31(9):1148-1156. doi: 10.1097/MEG.0000000000001448
6. Nissen NN, Menon V, Bresee C, Tran TT, Annamalai A, Poordad F, Fair JH, Klein AS, Boland B, Colquhoun SD. Recurrent hepatocellular carcinoma after liver transplant: identifying the high-risk patient. HPB (Oxford). 2011;13(9):626-632. doi: 10.1111/j.1477-2574.2011.00342.x
7. Toniutto P, Fornasiere E, Fumolo E, Bitetto D. Risk factors for hepatocellular carcinoma recurrence after liver transplantation. Hepatoma Res 2020; 6:50. doi: 10.20517/2394-5079.2020.40
8. Zimmerman MA, Ghobrial RM, Tong MJ, Hiatt JR, Cameron AM, Hong J. Recurrence of hepatocellular carcinoma following liver transplantation: a review of preoperative and postoperative prognostic indicators. Arch Surg. 2008; 143(2):182-188; discussion 188. doi: 10.1001/archsurg.2007.39
9. Fisher RA, Kulik LM, Freise CE, Lok AS, Shearon TH, Brown RS Jr, et al. Hepatocellular carcinoma recurrence and death following living and deceased donor liver transplantation. Am J Transplant. 2007; 7(6):1601-1608. doi: 10.1111/j.1600-6143.2007.01802.x
10. Ioannou GN, Perkins JD, Carithers RL Jr. Liver transplantation for hepatocellular carcinoma: impact of the MELD allocation system and predictors of survival. Gastroenterology. 2008; 134(5):1342-1351. doi: 10.1053/j.gastro.2008.02.013
11. Massie AB, Caffo B, Gentry SE, Hall EC, Axelrod DA, Lentine KL, et al. MELD Exceptions and Rates of Waiting List Outcomes. Am J Transplant. 2011; 11(11):2362-2371. doi: 10.1111/j.1600-6143.2011.03735.x
12. Mehta N, Heimbach J, Harnois DM, Sapisochin G, Dodge JL, Lee D, et al. Validation of a Risk Estimation of Tumor Recurrence After Transplant (RETREAT) Score for Hepatocellular Carcinoma Recurrence After Liver Transplant. JAMA Oncol. 2017;3(4): 493-500.
    doi: 10.1001/jamaoncol.2016.5116
13. Rodríguez-Perálvarez M, Tsochatzis E, Naveas MC, Pieri G, García-Caparrós C, O'Beirne J, et al. Reduced exposure to calcineurin inhibitors early after liver transplantation prevents recurrence of hepatocellular carcinoma. J Hepatol. 2013; 59(6):1193-1199.
    doi: 10.1016/j.jhep.2013.07.012
14. Chen K, Man K, Metselaar HJ, Janssen HL, Peppelenbosch MP, Pan Q. Rationale of personalized immunosuppressive medication for hepatocellular carcinoma patients after liver transplantation. Liver Transpl. 2014; 20(3):261-269. doi: 10.1002/lt.23806
15. Matter MS, Decaens T, Andersen JB, Thorgeirsson SS. Targeting the mTOR pathway in hepatocellular carcinoma: current state and future trends. J Hepatol. 2014; 60(4):855-65. doi: 10.1016/j.jhep.2013.11.031
16. Geissler EK, Schnitzbauer AA, Zülke C, Lamby PE, Proneth A, Duvoux C, et al. Sirolimus use in liver transplant recipients with hepatocellular carcinoma: A randomized, multicenter, open-label phase 3 trial. Transplantation. 2016; 100(1):116-125.
    doi: 10.1097/TP.0000000000000965
17. Yao FY, Ferrell L, Bass NM, Watson JJ, Bacchetti P, Venook A, et al. Liver transplantation for hepatocellular carcinoma: expansion of the tumor size limits does not adversely impact survival. Hepatology. 2001; 33(6):1394-1403. doi: 10.1053/jhep.2001.24563
18. Mehta N, Yao FY. Moving past "One size (and number) fits all" in the selection of candidates with hepatocellular carcinoma for liver transplantation. Liver Transpl. 2013; 19(10): 1055-1058. doi: 10.1002/lt.23730
19. Jonas S, Bechstein WO, Steinmüller T, Herrmann M, Radke C, Berg T, et al. Vascular invasion and histopathologic grading determine outcome after liver transplantation for hepatocellular carcinoma in cirrhosis. Hepatology. 2001 ;33(5):1080-1086.
    doi: 10.1053/jhep.2001.23561
20. Marsh JW, Finkelstein SD, Demetris AJ, Swalsky PA, Sasatomi E, Bandos A, et al. Genotyping of hepatocellular carcinoma in liver transplant recipients adds predictive power for determining recurrence-free survival. Liver Transpl. 2003; 9(7): 664-671.
    doi: 10.1053/jlts.2003.50144
21. Abdelfattah MR, Elsiesy H, Al-Manea H, Broering DC. Liver transplantation for hepatocellular carcinoma within the Milan criteria versus the University of California San Francisco criteria: a comparative study. Eur J Gastroenterol Hepatol. 2018; 30(4):398-403.
    doi: 10.1097/MEG.0000000000001044
22. Parfitt JR, Marotta P, Alghamdi M, Wall W, Khakhar A, Suskin NG, et al. Recurrent hepatocellular carcinoma after transplantation: use of a pathological score on explanted livers to predict recurrence. Liver Transpl. 2007; 13(4):543-551. doi: 10.1002/lt.21078
23. Agopian VG, Harlander-Locke M, Zarrinpar A, Kaldas FM, Farmer DG, Yersiz H, et al. A novel prognostic nomogram accurately predicts hepatocellular carcinoma recurrence after liver transplantation: analysis of 865 consecutive liver transplant recipients. J Am Coll Surg. 2015; 220(4):416-427. doi: 10.1016/j.jamcollsurg.2014.12.025

" ["~DETAIL_TEXT"]=> string(22000) "

Introduction

Since introduction of Milan criteria, an excellent outcomes of liver transplantation (LT) for hepatocellular carcinoma (HCC) were validated [1-3]. Unfortunately, this favorable outcome is not always achievable. The risk for recurrent HCC (rHCC) is still reported in approximately one-fifth of patients transplanted for presence of HCC. The occurrence of rHCC is a significant setback in the clinical course of affected patients with dismal prognosis reported in most instances [4-9].

Furthermore, the incidence of rHCC poses significant ethical concerns about current allocation system which favors transplantation of more HCC patients. The number of transplanted HCC patients has been reported to be steadily increasing over last two decades. The transplantation activity causes increased burden of already limited deceased donor pool, or provokes a debate over the living donation outcomes [10, 11].

It is therefore crucial to report the cases of rHCC following liver transplantation, to identify their clinical patterns, and to promote development of screening protocols for their early detection and treatment. Moreover, a comprehensive analysis should be made for identifying the risk factors associated with HCC recurrence.

This study aims primarily at reporting of the incidence of recurrent HCC following liver transplantation, to describe their clinical patterns, current therapeutic modalities at our center. It also addresses potential risk factors of HCC recurrence, by comparing them to the data reported elsewhere.

Materials and methods

A total of 178 patients diagnosed for having HCC approved the research consent and were subsequently included in the study. The clinical charts for those patients considered for liver transplant at our center were retrospectively reviewed. HCC at our center is diagnosed by contrast-enhanced computed tomography (CT) and/or abdominal magnetic resonance imaging (MRI). Staging was based on chest CT, cranial CT, and technetium-99m bone scintigraphy, to exclude extra-hepatic disease.

Current study was approved by our institutional Research Ethical Committee under the 8/11/09/02/2020 code. The ethical approval was obtained before conduction of this study. Patients were consented to use medical charts to obtain pertinent medical information for research purposes only. Extensive efforts to protect patients’ identity were also ensured. In accordance with Declaration of Helsinki, all the patients were consented about their clinical management and were also informed that their decision to approve or disapprove the research consent will not influence their clinical management.

Our center currently adopts Milan Criteria (MC) as the standard criteria for LT for HCC. Any patient who is beyond MC is usually considered for a downstaging protocol using one or more locoregional therapies to downstage the tumor to within MC. LT for the down-staged patients is considered after further confirmation of the absence of extrahepatic disease. Pretransplant locoregional therapies included radiofrequency ablation (RFA), trans-arterial chemotherapy (TACE) and/or trans-arterial radiotherapy (TARE). Cases which were found unfit for liver transplantation were excluded from the study.

LT was performed using either deceased donor liver transplants (DDLT), or liver transplantation from a living donor (LDLT). The LDLT donors were first- and second-degree relatives of respective patients. Cases of pediatric LT or liver re-transplantation were excluded from this study.

The liver explants were studied for presence of HCC lesions. Size, number, tumor grade, and lymph vascular invasion were reported by an experienced liver transplant pathologist. Triple immunosuppression protocol was utilized for LT recipients including calcineurin inhibitors (CNI) corticosteroids and mycophenolate mofetil.

İn addition to routine liver transplant follow-up protocol, the patients transplanted for HCC were followed up by liver ultrasound, α-fetoprotein (AFP), and liver function tests at six-month intervals for the rest of their lives. The cases with new focal liver lesion were further diagnosed by contrast-enhanced dynamic study to characterize this lesions, and liver biopsy was also taken to diagnose uncertain cases. The recurrent HCC (rHCC) cases were identified, and their clinical data were comprehensively collected.

Demographic data, pretransplant variables, transplant-related variables as well as characteristics of malignancies (number of lesions, tumor size and grade, lymph vascular invasion) were retrieved from the patient charts. Additionally, risk estimation of tumor recurrence after transplant (RETREAT score) was calculated [12], and these data were correlated with HCC recurrence. The data were analyzed by means of t-test and chi-square test. P-value of <0.05 was considered statistically significant. Kaplan-Meier curves were used to express survival outcomes and its significance was determined by log-rank test.

Results

A total of 178 patients presenting with HCC agreed to participate in the study. Fig. 1 shows their distribution as regards liver transplant, downstaging locoregional therapy (LRT) and incidence of recurrent HCC.

Figure 1. Distribution of HCC patients according to LT, LRT, and incidence of rHCC

148 adult patients underwent LT due to presence of HCC at our institution between August 2006 and December 2020. They included 93 males (62.8%) and 55 females (37.2%), ninety-six of them were within Milan criteria. The mean post-transplant follow-up for the studied patients was 53±34.8 months, range from 24.3 to 160.1 months. The overall 5-year survival of patients, grafts, and tumor-free survival were 72.7%, 90.8% and 87.7%, respectively (Fig. 2).

Figure 2. Overall patient, graft and tumor-free survival following LT for HCC patients

A total of 16 patients had HCC recurrence during the follow-up period (8.9% of transplanted HCC patients). Of them, eleven rHCC cases were registered in males. Nevertheless, gender factor did not differ significantly between patients with HCC recurrence compared to those with no rHCC (P=0.6). The mean age at HCC recurrence was 60.8±4.1 years. The current study demonstrated that most HCC recurrencies (68.8%) were observed within two years from liver transplant. Moreover, elevated AFP and distant metastases (mainly, lung lesions) dominated in clinical pattern in 87.5% and 56.3% of rHCC patients, respectively (Table 1).

Vascular invasion, poor tumor differentiation and RETREAT score differed significantly between the patients with rHCC and patients with no HCC recurrence. On the other hand, transplant criteria, type of transplant and total tumor volume (TTV)>115 cm³ showed no significant difference (Table 2). Correlation between RETREAT score, transplant criteria, and HCC recurrence is shown in Table 3.

Unfortunately, all rHCC cases in the current study were beyond surgical or locoregional therapy. Sorafenib was administered to these patients as a supportive measure. None of these patients were alive at the time of current report, their median survival following rHCC diagnosis was 135±11.5 days.

Table 2. Transplant and tumor-related variables for rHCC following liver transplantation

Table 3. Correlation between RETREAT score, transplant criteria and HCC recurrence

Discussion

The results of current study compare well with medical literature as regards the overall excellent outcome for transplanted HCC patients and the overall rate of rHCC [2, 3]. Filgueira et al., reported rHCC in 15-20% of transplanted HCC patients within a median of 12-16 months form liver transplant with around 75% occurring in the first two years. Timing of HCC recurrence in the current study was within two years following liver transplant in 68.8% of patients.

Filgueira et al. reported a poor prognosis for rHCC patients with median survival of 7-16 months from diagnosis of recurrence. They also claimed that HCC recurrence should be considered a systemic disease as only 30% of patients show isolated hepatic recurrence [4]. Chagas et al., reported 8% HCC recurrence rate and isolated hepatic recurrence in more than one-quarter of patients. Post-recurrence survival rates were 34% at 1 year compared to 0% in the current study [5].

Filgueira et al., reported that curative therapeutic modalities including reaction and ablative techniques are of value specially in cases where a smaller number and size of lesions is detected provided the disease is strictly confined to the liver. They quoted significantly longer median survival (22 months compared to 9 months in those with palliative treatment only) [5].

In the current study, it was noted that rHCC presentation is of the very late pattern, where there are limited options for therapeutic options and only palliation is possible. This might indicate vulnerability in screening protocol for rHCC and immunosuppression in the current study. It calls for more tailored approach for patients with high risk for HCC recurrence.

The use of rapamycin in patient transplanted for HCC was suggested and practiced in many transplant center [13-15]. It was hypothesized that rapamycin will improve recurrence free survival in these vulnerable patients. Nevertheless; (SiLVER trial) failed to show such effect [16].

Risk factors for HCC recurrence were traditionally reported to include male gender, those beyond Milan criteria, or those with partial response to LRT, AFP >400 ng/dL, those microvascular invasion, poor differentiation, TTV>115 cm³, and LDLT [6-9].

Only vascular invasion and poor tumor differentiation were shown to significantly related to HCC recurrence in the current study. Conversely, transplant criteria, TTV and type of transplant did not show significant relation.

As regards HCC outcome, much emphasis was always credited to the classical volume related tumor criteria e.g., number of HCC lesions, size of the HCC lesions, TTV, etc. the results of current study confirm that volume related criteria are at least insufficient to predict high risk patients for HCC recurrence [17-21]. More factors should be included in this regards namely, the biology-related tumor criteria e.g., poor differentiation, and vascular invasion. It is thus feasible to apply risk stratification scores for HCC recurrence which encompass various radiological, pathological and laboratory variables like RETREAT score [12, 22, 23].

In the current study, HCC recurrence was entirely reported in patients with 3 or more points on the RETREAT score, the incidence of rHCC incidence increased from nil in those of ≤2 points to around one third of those with 3-5 points and up to 70 % of those with more than 5 points. RETREAT score predicted the occurrence of rHCC in our patients and correlated significantly with its occurrence, P=0.00.

Conclusion

HCC recurrence is still a significant medical concern for transplanted HCC patients. Early detection is imperative for the use of more curative options for the management of rHCC.

Volume related criteria are insufficient to predict high risk patients for HCC recurrence. More factors should be included in this regard, namely poor differentiation, and vascular invasion. Risk stratification models for HCC recurrence should be employed to identify high risk patients for HCC recurrence. RETRAET score is a valid and feasible option in this regards.

Screening protocols should be tailored to the risk of HCC recurrence. Closer follow up, and more liberal use of dynamic imaging should be employed in those with high risk for HCC recurrence.

Conflict of interest

This research received no external funding. The authors declare no conflict of interest.

References

1. Mazzaferro V, Regalia E, Doci R, Andreola S, Pulvirenti A, Bozzetti F, et al. Liver transplantation for the treatment of small hepatocellular carcinomas in patients with cirrhosis. N Engl J Med. 1996; 334(11):693-699. doi: 10.1056/NEJM199603143341104
2. Pomfret EA, Washburn K, Wald C, Nalesnik MA, Douglas D, Russo M, et al. Report of a national conference on liver allocation in patients with hepatocellular carcinoma in the United States. Liver Transpl. 2010; 16(3):262-278. doi: 10.1002/lt.21999
3. Clavien PA, Lesurtel M, Bossuyt PM, Gores GJ, Langer B, Perrier A; OLT for HCC Consensus Group. Recommendations for liver transplantation for hepatocellular carcinoma: an international consensus conference report. Lancet Oncol. 2012; 13(1):e11-22.
   doi: 10.1016/S1470-2045(11)70175-9
4. Filgueira NA. Hepatocellular carcinoma recurrence after liver transplantation: Risk factors, screening and clinical presentation. World J Hepatol. 2019 Mar 27;11(3):261-272. doi: 10.4254/wjh.v11.i3.261
5. Chagas AL, Felga GEG, Diniz MA, Silva RF, Mattos AA, Silva RCMA, et al. Hepatocellular carcinoma recurrence after liver transplantation in a Brazilian multicenter study: clinical profile and prognostic factors of survival. Eur J Gastroenterol Hepatol. 2019; 31(9):1148-1156. doi: 10.1097/MEG.0000000000001448
6. Nissen NN, Menon V, Bresee C, Tran TT, Annamalai A, Poordad F, Fair JH, Klein AS, Boland B, Colquhoun SD. Recurrent hepatocellular carcinoma after liver transplant: identifying the high-risk patient. HPB (Oxford). 2011;13(9):626-632. doi: 10.1111/j.1477-2574.2011.00342.x
7. Toniutto P, Fornasiere E, Fumolo E, Bitetto D. Risk factors for hepatocellular carcinoma recurrence after liver transplantation. Hepatoma Res 2020; 6:50. doi: 10.20517/2394-5079.2020.40
8. Zimmerman MA, Ghobrial RM, Tong MJ, Hiatt JR, Cameron AM, Hong J. Recurrence of hepatocellular carcinoma following liver transplantation: a review of preoperative and postoperative prognostic indicators. Arch Surg. 2008; 143(2):182-188; discussion 188. doi: 10.1001/archsurg.2007.39
9. Fisher RA, Kulik LM, Freise CE, Lok AS, Shearon TH, Brown RS Jr, et al. Hepatocellular carcinoma recurrence and death following living and deceased donor liver transplantation. Am J Transplant. 2007; 7(6):1601-1608. doi: 10.1111/j.1600-6143.2007.01802.x
10. Ioannou GN, Perkins JD, Carithers RL Jr. Liver transplantation for hepatocellular carcinoma: impact of the MELD allocation system and predictors of survival. Gastroenterology. 2008; 134(5):1342-1351. doi: 10.1053/j.gastro.2008.02.013
11. Massie AB, Caffo B, Gentry SE, Hall EC, Axelrod DA, Lentine KL, et al. MELD Exceptions and Rates of Waiting List Outcomes. Am J Transplant. 2011; 11(11):2362-2371. doi: 10.1111/j.1600-6143.2011.03735.x
12. Mehta N, Heimbach J, Harnois DM, Sapisochin G, Dodge JL, Lee D, et al. Validation of a Risk Estimation of Tumor Recurrence After Transplant (RETREAT) Score for Hepatocellular Carcinoma Recurrence After Liver Transplant. JAMA Oncol. 2017;3(4): 493-500.
    doi: 10.1001/jamaoncol.2016.5116
13. Rodríguez-Perálvarez M, Tsochatzis E, Naveas MC, Pieri G, García-Caparrós C, O'Beirne J, et al. Reduced exposure to calcineurin inhibitors early after liver transplantation prevents recurrence of hepatocellular carcinoma. J Hepatol. 2013; 59(6):1193-1199.
    doi: 10.1016/j.jhep.2013.07.012
14. Chen K, Man K, Metselaar HJ, Janssen HL, Peppelenbosch MP, Pan Q. Rationale of personalized immunosuppressive medication for hepatocellular carcinoma patients after liver transplantation. Liver Transpl. 2014; 20(3):261-269. doi: 10.1002/lt.23806
15. Matter MS, Decaens T, Andersen JB, Thorgeirsson SS. Targeting the mTOR pathway in hepatocellular carcinoma: current state and future trends. J Hepatol. 2014; 60(4):855-65. doi: 10.1016/j.jhep.2013.11.031
16. Geissler EK, Schnitzbauer AA, Zülke C, Lamby PE, Proneth A, Duvoux C, et al. Sirolimus use in liver transplant recipients with hepatocellular carcinoma: A randomized, multicenter, open-label phase 3 trial. Transplantation. 2016; 100(1):116-125.
    doi: 10.1097/TP.0000000000000965
17. Yao FY, Ferrell L, Bass NM, Watson JJ, Bacchetti P, Venook A, et al. Liver transplantation for hepatocellular carcinoma: expansion of the tumor size limits does not adversely impact survival. Hepatology. 2001; 33(6):1394-1403. doi: 10.1053/jhep.2001.24563
18. Mehta N, Yao FY. Moving past "One size (and number) fits all" in the selection of candidates with hepatocellular carcinoma for liver transplantation. Liver Transpl. 2013; 19(10): 1055-1058. doi: 10.1002/lt.23730
19. Jonas S, Bechstein WO, Steinmüller T, Herrmann M, Radke C, Berg T, et al. Vascular invasion and histopathologic grading determine outcome after liver transplantation for hepatocellular carcinoma in cirrhosis. Hepatology. 2001 ;33(5):1080-1086.
    doi: 10.1053/jhep.2001.23561
20. Marsh JW, Finkelstein SD, Demetris AJ, Swalsky PA, Sasatomi E, Bandos A, et al. Genotyping of hepatocellular carcinoma in liver transplant recipients adds predictive power for determining recurrence-free survival. Liver Transpl. 2003; 9(7): 664-671.
    doi: 10.1053/jlts.2003.50144
21. Abdelfattah MR, Elsiesy H, Al-Manea H, Broering DC. Liver transplantation for hepatocellular carcinoma within the Milan criteria versus the University of California San Francisco criteria: a comparative study. Eur J Gastroenterol Hepatol. 2018; 30(4):398-403.
    doi: 10.1097/MEG.0000000000001044
22. Parfitt JR, Marotta P, Alghamdi M, Wall W, Khakhar A, Suskin NG, et al. Recurrent hepatocellular carcinoma after transplantation: use of a pathological score on explanted livers to predict recurrence. Liver Transpl. 2007; 13(4):543-551. doi: 10.1002/lt.21078
23. Agopian VG, Harlander-Locke M, Zarrinpar A, Kaldas FM, Farmer DG, Yersiz H, et al. A novel prognostic nomogram accurately predicts hepatocellular carcinoma recurrence after liver transplantation: analysis of 865 consecutive liver transplant recipients. J Am Coll Surg. 2015; 220(4):416-427. doi: 10.1016/j.jamcollsurg.2014.12.025

" ["DETAIL_TEXT_TYPE"]=> string(4) "html" ["~DETAIL_TEXT_TYPE"]=> string(4) "html" ["PREVIEW_TEXT"]=> string(0) "" ["~PREVIEW_TEXT"]=> string(0) "" ["PREVIEW_TEXT_TYPE"]=> string(4) "text" ["~PREVIEW_TEXT_TYPE"]=> string(4) "text" ["PREVIEW_PICTURE"]=> NULL ["~PREVIEW_PICTURE"]=> NULL ["LANG_DIR"]=> string(4) "/ru/" ["~LANG_DIR"]=> string(4) "/ru/" ["SORT"]=> string(2) "20" ["~SORT"]=> string(2) "20" ["CODE"]=> string(101) "retsidivy-gepatotsellyulyarnoy-kartsinomy-posle-transplantatsii-pecheni-klinicheskie-osobennosti-lech" ["~CODE"]=> string(101) "retsidivy-gepatotsellyulyarnoy-kartsinomy-posle-transplantatsii-pecheni-klinicheskie-osobennosti-lech" ["EXTERNAL_ID"]=> string(4) "2060" ["~EXTERNAL_ID"]=> string(4) "2060" ["IBLOCK_TYPE_ID"]=> string(7) "journal" ["~IBLOCK_TYPE_ID"]=> string(7) "journal" ["IBLOCK_CODE"]=> string(7) "volumes" ["~IBLOCK_CODE"]=> string(7) "volumes" ["IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["~IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["LID"]=> string(2) "s2" ["~LID"]=> string(2) "s2" ["EDIT_LINK"]=> NULL ["DELETE_LINK"]=> NULL ["DISPLAY_ACTIVE_FROM"]=> string(0) "" ["IPROPERTY_VALUES"]=> array(18) { ["ELEMENT_META_TITLE"]=> string(203) "Рецидивы гепатоцеллюлярной карциномы после трансплантации печени: клинические особенности, лечение и исходы " ["ELEMENT_META_KEYWORDS"]=> string(0) "" ["ELEMENT_META_DESCRIPTION"]=> string(274) "Рецидивы гепатоцеллюлярной карциномы после трансплантации печени: клинические особенности, лечение и исходы Post-liver transplant HCC recurrence: patterns, treatment, and outcome " ["ELEMENT_PREVIEW_PICTURE_FILE_ALT"]=> string(2946) "<p style="text-align: justify;">Риск рецидивов гепатоцеллюлярной карциномы (рГЦК) значителен, и их общий прогноз все еще неблагоприятен. Целью исследования является обобщение данных о частоте рецидивов ГЦК после трансплантации печени (ТП), рассмотрение их клинических особенностей и существующих вариантов терапии в нашем центре. Мы также рассматриваем потенциальные факторы риска рецидивирования ГЦК.</p> <h3>Материалы и методы</h3> <p style="text-align: justify;">Трансплантация печени была выполнена 148 пациентам в сроки с августа 2006 по декабрь 2020 г. в нашем центре. Выявлены случаи рецидивов ГЦК и систематизированы их клинические характеристики.</p> <h3>Результаты</h3> <p style="text-align: justify;">Средние сроки наблюдения после ТП составляли 53±34,8 мес. Рецидивы ГЦК были обнаружены у 16 пациентов (8,9%). Большинство этих больных (68,8%) наблюдали в течение первых двух лет после ТП. Инвазия в лимфатические сосуды, низкая степень дифференцировки опухоли и оценки по шкале RETREAT были достоверно связаны с рецидивами ГЦК.</p> <h3>Выводы</h3> <p style="text-align: justify;">Раннее выявление рецидивов необходимо для применения более эффективных способов контроля рГЦК. Критерии, основанные на оценке объема опухоли, не достаточны для прогнозирования случаев рецидивов ГЦК высокого риска. Следует использовать модели стратификации риска для выявления пациентов с плохим прогнозом при рГЦК. Протоколы их обследования должны быть адаптированы с риском рецидивирования ГЦК. </p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Гепатоцеллюлярная карцинома, трансплантация печени, рецидив опухоли.</p>" ["ELEMENT_PREVIEW_PICTURE_FILE_TITLE"]=> string(203) "Рецидивы гепатоцеллюлярной карциномы после трансплантации печени: клинические особенности, лечение и исходы " ["ELEMENT_DETAIL_PICTURE_FILE_ALT"]=> string(203) "Рецидивы гепатоцеллюлярной карциномы после трансплантации печени: клинические особенности, лечение и исходы " ["ELEMENT_DETAIL_PICTURE_FILE_TITLE"]=> string(203) "Рецидивы гепатоцеллюлярной карциномы после трансплантации печени: клинические особенности, лечение и исходы " ["SECTION_META_TITLE"]=> string(203) "Рецидивы гепатоцеллюлярной карциномы после трансплантации печени: клинические особенности, лечение и исходы " ["SECTION_META_KEYWORDS"]=> string(203) "Рецидивы гепатоцеллюлярной карциномы после трансплантации печени: клинические особенности, лечение и исходы " ["SECTION_META_DESCRIPTION"]=> string(203) "Рецидивы гепатоцеллюлярной карциномы после трансплантации печени: клинические особенности, лечение и исходы " ["SECTION_PICTURE_FILE_ALT"]=> string(203) "Рецидивы гепатоцеллюлярной карциномы после трансплантации печени: клинические особенности, лечение и исходы " ["SECTION_PICTURE_FILE_TITLE"]=> string(203) "Рецидивы гепатоцеллюлярной карциномы после трансплантации печени: клинические особенности, лечение и исходы " ["SECTION_PICTURE_FILE_NAME"]=> string(101) "retsidivy-gepatotsellyulyarnoy-kartsinomy-posle-transplantatsii-pecheni-klinicheskie-osobennosti-lech" ["SECTION_DETAIL_PICTURE_FILE_ALT"]=> string(203) "Рецидивы гепатоцеллюлярной карциномы после трансплантации печени: клинические особенности, лечение и исходы " ["SECTION_DETAIL_PICTURE_FILE_TITLE"]=> string(203) "Рецидивы гепатоцеллюлярной карциномы после трансплантации печени: клинические особенности, лечение и исходы " ["SECTION_DETAIL_PICTURE_FILE_NAME"]=> string(101) "retsidivy-gepatotsellyulyarnoy-kartsinomy-posle-transplantatsii-pecheni-klinicheskie-osobennosti-lech" ["ELEMENT_PREVIEW_PICTURE_FILE_NAME"]=> string(101) "retsidivy-gepatotsellyulyarnoy-kartsinomy-posle-transplantatsii-pecheni-klinicheskie-osobennosti-lech" ["ELEMENT_DETAIL_PICTURE_FILE_NAME"]=> string(101) "retsidivy-gepatotsellyulyarnoy-kartsinomy-posle-transplantatsii-pecheni-klinicheskie-osobennosti-lech" } ["FIELDS"]=> array(1) { ["IBLOCK_SECTION_ID"]=> string(3) "212" } ["PROPERTIES"]=> array(18) { ["KEYWORDS"]=> array(36) { ["ID"]=> string(2) "19" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:46:01" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(27) "Ключевые слова" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "KEYWORDS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "19" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "4" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "Y" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "Y" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(27) "Ключевые слова" ["~DEFAULT_VALUE"]=> string(0) "" } ["SUBMITTED"]=> array(36) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28626" ["VALUE"]=> string(22) "11/12/2021 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "11/12/2021 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL } ["ACCEPTED"]=> array(36) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28627" ["VALUE"]=> string(22) "12/15/2021 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "12/15/2021 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL } ["PUBLISHED"]=> array(36) { ["ID"]=> string(2) "22" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Дата публикации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "PUBLISHED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "22" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Дата публикации" ["~DEFAULT_VALUE"]=> NULL } ["CONTACT"]=> array(36) { ["ID"]=> string(2) "23" ["TIMESTAMP_X"]=> string(19) "2015-09-03 14:43:05" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(14) "Контакт" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "CONTACT" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "23" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(14) "Контакт" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHORS"]=> array(36) { ["ID"]=> string(2) "24" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:45:07" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "AUTHORS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "24" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_RU"]=> array(36) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28628" ["VALUE"]=> array(2) { ["TEXT"]=> string(149) "<p>Mохамед Рабей Абдельфаттах¹, Хуссейн Эльсиеси²</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(113) "

Mохамед Рабей Абдельфаттах¹, Хуссейн Эльсиеси²

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_RU"]=> array(36) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28629" ["VALUE"]=> array(2) { ["TEXT"]=> string(424) "<p>¹ Департамент хируриги, Факультет медицины, Университет Александрии, Египет<br> ² Центр органной трансплантации, Госпиталь короля Фейсала и научный центр, Эр-Рияд, Королевство Саудовской Аравии</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(382) "

¹ Департамент хируриги, Факультет медицины, Университет Александрии, Египет
² Центр органной трансплантации, Госпиталь короля Фейсала и научный центр, Эр-Рияд, Королевство Саудовской Аравии

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_RU"]=> array(36) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28630" ["VALUE"]=> array(2) { ["TEXT"]=> string(2946) "<p style="text-align: justify;">Риск рецидивов гепатоцеллюлярной карциномы (рГЦК) значителен, и их общий прогноз все еще неблагоприятен. Целью исследования является обобщение данных о частоте рецидивов ГЦК после трансплантации печени (ТП), рассмотрение их клинических особенностей и существующих вариантов терапии в нашем центре. Мы также рассматриваем потенциальные факторы риска рецидивирования ГЦК.</p> <h3>Материалы и методы</h3> <p style="text-align: justify;">Трансплантация печени была выполнена 148 пациентам в сроки с августа 2006 по декабрь 2020 г. в нашем центре. Выявлены случаи рецидивов ГЦК и систематизированы их клинические характеристики.</p> <h3>Результаты</h3> <p style="text-align: justify;">Средние сроки наблюдения после ТП составляли 53±34,8 мес. Рецидивы ГЦК были обнаружены у 16 пациентов (8,9%). Большинство этих больных (68,8%) наблюдали в течение первых двух лет после ТП. Инвазия в лимфатические сосуды, низкая степень дифференцировки опухоли и оценки по шкале RETREAT были достоверно связаны с рецидивами ГЦК.</p> <h3>Выводы</h3> <p style="text-align: justify;">Раннее выявление рецидивов необходимо для применения более эффективных способов контроля рГЦК. Критерии, основанные на оценке объема опухоли, не достаточны для прогнозирования случаев рецидивов ГЦК высокого риска. Следует использовать модели стратификации риска для выявления пациентов с плохим прогнозом при рГЦК. Протоколы их обследования должны быть адаптированы с риском рецидивирования ГЦК. </p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Гепатоцеллюлярная карцинома, трансплантация печени, рецидив опухоли.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(2788) "

Риск рецидивов гепатоцеллюлярной карциномы (рГЦК) значителен, и их общий прогноз все еще неблагоприятен. Целью исследования является обобщение данных о частоте рецидивов ГЦК после трансплантации печени (ТП), рассмотрение их клинических особенностей и существующих вариантов терапии в нашем центре. Мы также рассматриваем потенциальные факторы риска рецидивирования ГЦК.

Материалы и методы

Трансплантация печени была выполнена 148 пациентам в сроки с августа 2006 по декабрь 2020 г. в нашем центре. Выявлены случаи рецидивов ГЦК и систематизированы их клинические характеристики.

Результаты

Средние сроки наблюдения после ТП составляли 53±34,8 мес. Рецидивы ГЦК были обнаружены у 16 пациентов (8,9%). Большинство этих больных (68,8%) наблюдали в течение первых двух лет после ТП. Инвазия в лимфатические сосуды, низкая степень дифференцировки опухоли и оценки по шкале RETREAT были достоверно связаны с рецидивами ГЦК.

Выводы

Раннее выявление рецидивов необходимо для применения более эффективных способов контроля рГЦК. Критерии, основанные на оценке объема опухоли, не достаточны для прогнозирования случаев рецидивов ГЦК высокого риска. Следует использовать модели стратификации риска для выявления пациентов с плохим прогнозом при рГЦК. Протоколы их обследования должны быть адаптированы с риском рецидивирования ГЦК.

Ключевые слова

Гепатоцеллюлярная карцинома, трансплантация печени, рецидив опухоли.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["DOI"]=> array(36) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28631" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-39-44" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-39-44" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_EN"]=> array(36) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28634" ["VALUE"]=> array(2) { ["TEXT"]=> string(109) "<p>Mohamed Rabei Abdelfattah¹, Hussein Elsiesy²</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(73) "

Mohamed Rabei Abdelfattah¹, Hussein Elsiesy²

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_EN"]=> array(36) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28635" ["VALUE"]=> array(2) { ["TEXT"]=> string(799) "<p>¹ Department of Surgery, Faculty of Medicine, University of Alexandria, Egypt<br> ² Organ Transplant Center, King Faisal Specialist Hospital and Research Center, Riyadh, Kingdom Saudi Arabia</p><br> <p><b>Correspondence:</b><br> Prof. Dr. Mohamed Rabei Abdelfattah. MD, Department of Surgery, Faculty of Medicine, University of Alexandria, AL Khartoum Square, Azzaritta, Alexandria, Egypt, PO BOX 21131<br> Phone: 0020102 306 1111 (mob.)<br> E-mail: Mohamad.rabie@gmail.com</p><br> <p><b>Citation:</b> Abdelfattah MR, Elsiesy H. Post-liver transplant HCC recurrence: patterns, treatment, and outcome. Cell Ther Transplant 2022; 11(2): 39-44.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(679) "

¹ Department of Surgery, Faculty of Medicine, University of Alexandria, Egypt
² Organ Transplant Center, King Faisal Specialist Hospital and Research Center, Riyadh, Kingdom Saudi Arabia

Correspondence:
Prof. Dr. Mohamed Rabei Abdelfattah. MD, Department of Surgery, Faculty of Medicine, University of Alexandria, AL Khartoum Square, Azzaritta, Alexandria, Egypt, PO BOX 21131
Phone: 0020102 306 1111 (mob.)
E-mail: Mohamad.rabie@gmail.com

Citation: Abdelfattah MR, Elsiesy H. Post-liver transplant HCC recurrence: patterns, treatment, and outcome. Cell Ther Transplant 2022; 11(2): 39-44.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_EN"]=> array(36) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28636" ["VALUE"]=> array(2) { ["TEXT"]=> string(1758) "<p style="text-align: justify;">The risk for recurrent hepatocellular carcinoma is still significant, and its overall prognosis is dismal. This study aims at reporting incidence of recurrent hepatocellular carcinoma (rHCC) cases following liver transplantation (LT), describing their clinical patterns, and current therapeutic modalities at our center. It also concerns potential risk factors related to HCC recurrence. </p> <h3>Materials and methods</h3> <p style="text-align: justify;">A total of 148 patients underwent LT between August 2006 and December 2020 at our Center. Cases with rHCC were identified, and their clinical data were comprehensively collected.</p> <h3>Results</h3> <p style="text-align: justify;">The mean post-transplant follow-up for the studied patients was 53±34.8 months. A total of 16 patients had HCC recurrence (8.9%). Majority of rHCC (68.8%) were observed within the first two years from LT. Vascular lymphatic invasion, poor tumor differentiation and RETREAT score were significantly related to HCC recurrence.</p> <h3>Conclusions</h3> <p style="text-align: justify;">Early detection is an imperative for the use of more curative rHCC-managing options. The tumor volume-based criteria are insufficient to predict high risk patients for HCC recurrence. Risk stratification models for HCC recurrence should be employed to identify high-risk patients for HCC recurrence. Screening protocols should be tailored to the risk of HCC recurrence.</p> <h2>Keywords</h2> <p style="text-align: justify;">Hepatocellular carcinoma, liver transplant, tumor recurrence.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1600) "

The risk for recurrent hepatocellular carcinoma is still significant, and its overall prognosis is dismal. This study aims at reporting incidence of recurrent hepatocellular carcinoma (rHCC) cases following liver transplantation (LT), describing their clinical patterns, and current therapeutic modalities at our center. It also concerns potential risk factors related to HCC recurrence.

Materials and methods

A total of 148 patients underwent LT between August 2006 and December 2020 at our Center. Cases with rHCC were identified, and their clinical data were comprehensively collected.

Results

The mean post-transplant follow-up for the studied patients was 53±34.8 months. A total of 16 patients had HCC recurrence (8.9%). Majority of rHCC (68.8%) were observed within the first two years from LT. Vascular lymphatic invasion, poor tumor differentiation and RETREAT score were significantly related to HCC recurrence.

Conclusions

Early detection is an imperative for the use of more curative rHCC-managing options. The tumor volume-based criteria are insufficient to predict high risk patients for HCC recurrence. Risk stratification models for HCC recurrence should be employed to identify high-risk patients for HCC recurrence. Screening protocols should be tailored to the risk of HCC recurrence.

Keywords

Hepatocellular carcinoma, liver transplant, tumor recurrence.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["NAME_EN"]=> array(36) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28632" ["VALUE"]=> string(71) "Post-liver transplant HCC recurrence: patterns, treatment, and outcome " ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(71) "Post-liver transplant HCC recurrence: patterns, treatment, and outcome " ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" } ["FULL_TEXT_RU"]=> array(36) { ["ID"]=> string(2) "42" ["TIMESTAMP_X"]=> string(19) "2015-09-07 20:29:18" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(23) "Полный текст" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(12) "FULL_TEXT_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "42" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(23) "Полный текст" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["PDF_RU"]=> array(36) { ["ID"]=> string(2) "43" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF RUS" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_RU" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "43" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28633" ["VALUE"]=> string(4) "2836" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2836" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF RUS" ["~DEFAULT_VALUE"]=> string(0) "" } ["PDF_EN"]=> array(36) { ["ID"]=> string(2) "44" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF ENG" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "44" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28637" ["VALUE"]=> string(4) "2842" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2842" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF ENG" ["~DEFAULT_VALUE"]=> string(0) "" } ["NAME_LONG"]=> array(36) { ["ID"]=> string(2) "45" ["TIMESTAMP_X"]=> string(19) "2023-04-13 00:55:00" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(72) "Название (для очень длинных заголовков)" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "NAME_LONG" ["DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "45" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(80) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(72) "Название (для очень длинных заголовков)" ["~DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } } } ["DISPLAY_PROPERTIES"]=> array(10) { ["AUTHOR_EN"]=> array(37) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28634" ["VALUE"]=> array(2) { ["TEXT"]=> string(109) "<p>Mohamed Rabei Abdelfattah¹, Hussein Elsiesy²</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(73) "

Mohamed Rabei Abdelfattah¹, Hussein Elsiesy²

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(73) "

Mohamed Rabei Abdelfattah¹, Hussein Elsiesy²

" } ["SUMMARY_EN"]=> array(37) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28636" ["VALUE"]=> array(2) { ["TEXT"]=> string(1758) "<p style="text-align: justify;">The risk for recurrent hepatocellular carcinoma is still significant, and its overall prognosis is dismal. This study aims at reporting incidence of recurrent hepatocellular carcinoma (rHCC) cases following liver transplantation (LT), describing their clinical patterns, and current therapeutic modalities at our center. It also concerns potential risk factors related to HCC recurrence. </p> <h3>Materials and methods</h3> <p style="text-align: justify;">A total of 148 patients underwent LT between August 2006 and December 2020 at our Center. Cases with rHCC were identified, and their clinical data were comprehensively collected.</p> <h3>Results</h3> <p style="text-align: justify;">The mean post-transplant follow-up for the studied patients was 53±34.8 months. A total of 16 patients had HCC recurrence (8.9%). Majority of rHCC (68.8%) were observed within the first two years from LT. Vascular lymphatic invasion, poor tumor differentiation and RETREAT score were significantly related to HCC recurrence.</p> <h3>Conclusions</h3> <p style="text-align: justify;">Early detection is an imperative for the use of more curative rHCC-managing options. The tumor volume-based criteria are insufficient to predict high risk patients for HCC recurrence. Risk stratification models for HCC recurrence should be employed to identify high-risk patients for HCC recurrence. Screening protocols should be tailored to the risk of HCC recurrence.</p> <h2>Keywords</h2> <p style="text-align: justify;">Hepatocellular carcinoma, liver transplant, tumor recurrence.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1600) "

The risk for recurrent hepatocellular carcinoma is still significant, and its overall prognosis is dismal. This study aims at reporting incidence of recurrent hepatocellular carcinoma (rHCC) cases following liver transplantation (LT), describing their clinical patterns, and current therapeutic modalities at our center. It also concerns potential risk factors related to HCC recurrence.

Materials and methods

A total of 148 patients underwent LT between August 2006 and December 2020 at our Center. Cases with rHCC were identified, and their clinical data were comprehensively collected.

Results

The mean post-transplant follow-up for the studied patients was 53±34.8 months. A total of 16 patients had HCC recurrence (8.9%). Majority of rHCC (68.8%) were observed within the first two years from LT. Vascular lymphatic invasion, poor tumor differentiation and RETREAT score were significantly related to HCC recurrence.

Conclusions

Early detection is an imperative for the use of more curative rHCC-managing options. The tumor volume-based criteria are insufficient to predict high risk patients for HCC recurrence. Risk stratification models for HCC recurrence should be employed to identify high-risk patients for HCC recurrence. Screening protocols should be tailored to the risk of HCC recurrence.

Keywords

Hepatocellular carcinoma, liver transplant, tumor recurrence.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(1600) "

The risk for recurrent hepatocellular carcinoma is still significant, and its overall prognosis is dismal. This study aims at reporting incidence of recurrent hepatocellular carcinoma (rHCC) cases following liver transplantation (LT), describing their clinical patterns, and current therapeutic modalities at our center. It also concerns potential risk factors related to HCC recurrence.

Materials and methods

A total of 148 patients underwent LT between August 2006 and December 2020 at our Center. Cases with rHCC were identified, and their clinical data were comprehensively collected.

Results

The mean post-transplant follow-up for the studied patients was 53±34.8 months. A total of 16 patients had HCC recurrence (8.9%). Majority of rHCC (68.8%) were observed within the first two years from LT. Vascular lymphatic invasion, poor tumor differentiation and RETREAT score were significantly related to HCC recurrence.

Conclusions

Early detection is an imperative for the use of more curative rHCC-managing options. The tumor volume-based criteria are insufficient to predict high risk patients for HCC recurrence. Risk stratification models for HCC recurrence should be employed to identify high-risk patients for HCC recurrence. Screening protocols should be tailored to the risk of HCC recurrence.

Keywords

Hepatocellular carcinoma, liver transplant, tumor recurrence.

" } ["DOI"]=> array(37) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28631" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-39-44" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-39-44" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-39-44" } ["NAME_EN"]=> array(37) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28632" ["VALUE"]=> string(71) "Post-liver transplant HCC recurrence: patterns, treatment, and outcome " ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(71) "Post-liver transplant HCC recurrence: patterns, treatment, and outcome " ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(71) "Post-liver transplant HCC recurrence: patterns, treatment, and outcome " } ["ORGANIZATION_EN"]=> array(37) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28635" ["VALUE"]=> array(2) { ["TEXT"]=> string(799) "<p>¹ Department of Surgery, Faculty of Medicine, University of Alexandria, Egypt<br> ² Organ Transplant Center, King Faisal Specialist Hospital and Research Center, Riyadh, Kingdom Saudi Arabia</p><br> <p><b>Correspondence:</b><br> Prof. Dr. Mohamed Rabei Abdelfattah. MD, Department of Surgery, Faculty of Medicine, University of Alexandria, AL Khartoum Square, Azzaritta, Alexandria, Egypt, PO BOX 21131<br> Phone: 0020102 306 1111 (mob.)<br> E-mail: Mohamad.rabie@gmail.com</p><br> <p><b>Citation:</b> Abdelfattah MR, Elsiesy H. Post-liver transplant HCC recurrence: patterns, treatment, and outcome. Cell Ther Transplant 2022; 11(2): 39-44.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(679) "

¹ Department of Surgery, Faculty of Medicine, University of Alexandria, Egypt
² Organ Transplant Center, King Faisal Specialist Hospital and Research Center, Riyadh, Kingdom Saudi Arabia

Correspondence:
Prof. Dr. Mohamed Rabei Abdelfattah. MD, Department of Surgery, Faculty of Medicine, University of Alexandria, AL Khartoum Square, Azzaritta, Alexandria, Egypt, PO BOX 21131
Phone: 0020102 306 1111 (mob.)
E-mail: Mohamad.rabie@gmail.com

Citation: Abdelfattah MR, Elsiesy H. Post-liver transplant HCC recurrence: patterns, treatment, and outcome. Cell Ther Transplant 2022; 11(2): 39-44.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(679) "

¹ Department of Surgery, Faculty of Medicine, University of Alexandria, Egypt
² Organ Transplant Center, King Faisal Specialist Hospital and Research Center, Riyadh, Kingdom Saudi Arabia

Correspondence:
Prof. Dr. Mohamed Rabei Abdelfattah. MD, Department of Surgery, Faculty of Medicine, University of Alexandria, AL Khartoum Square, Azzaritta, Alexandria, Egypt, PO BOX 21131
Phone: 0020102 306 1111 (mob.)
E-mail: Mohamad.rabie@gmail.com

Citation: Abdelfattah MR, Elsiesy H. Post-liver transplant HCC recurrence: patterns, treatment, and outcome. Cell Ther Transplant 2022; 11(2): 39-44.

" } ["AUTHOR_RU"]=> array(37) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28628" ["VALUE"]=> array(2) { ["TEXT"]=> string(149) "<p>Mохамед Рабей Абдельфаттах¹, Хуссейн Эльсиеси²</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(113) "

Mохамед Рабей Абдельфаттах¹, Хуссейн Эльсиеси²

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(113) "

Mохамед Рабей Абдельфаттах¹, Хуссейн Эльсиеси²

" } ["SUBMITTED"]=> array(37) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28626" ["VALUE"]=> string(22) "11/12/2021 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "11/12/2021 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "11/12/2021 12:00:00 am" } ["ACCEPTED"]=> array(37) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28627" ["VALUE"]=> string(22) "12/15/2021 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "12/15/2021 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "12/15/2021 12:00:00 am" } ["SUMMARY_RU"]=> array(37) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28630" ["VALUE"]=> array(2) { ["TEXT"]=> string(2946) "<p style="text-align: justify;">Риск рецидивов гепатоцеллюлярной карциномы (рГЦК) значителен, и их общий прогноз все еще неблагоприятен. Целью исследования является обобщение данных о частоте рецидивов ГЦК после трансплантации печени (ТП), рассмотрение их клинических особенностей и существующих вариантов терапии в нашем центре. Мы также рассматриваем потенциальные факторы риска рецидивирования ГЦК.</p> <h3>Материалы и методы</h3> <p style="text-align: justify;">Трансплантация печени была выполнена 148 пациентам в сроки с августа 2006 по декабрь 2020 г. в нашем центре. Выявлены случаи рецидивов ГЦК и систематизированы их клинические характеристики.</p> <h3>Результаты</h3> <p style="text-align: justify;">Средние сроки наблюдения после ТП составляли 53±34,8 мес. Рецидивы ГЦК были обнаружены у 16 пациентов (8,9%). Большинство этих больных (68,8%) наблюдали в течение первых двух лет после ТП. Инвазия в лимфатические сосуды, низкая степень дифференцировки опухоли и оценки по шкале RETREAT были достоверно связаны с рецидивами ГЦК.</p> <h3>Выводы</h3> <p style="text-align: justify;">Раннее выявление рецидивов необходимо для применения более эффективных способов контроля рГЦК. Критерии, основанные на оценке объема опухоли, не достаточны для прогнозирования случаев рецидивов ГЦК высокого риска. Следует использовать модели стратификации риска для выявления пациентов с плохим прогнозом при рГЦК. Протоколы их обследования должны быть адаптированы с риском рецидивирования ГЦК. </p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Гепатоцеллюлярная карцинома, трансплантация печени, рецидив опухоли.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(2788) "

Риск рецидивов гепатоцеллюлярной карциномы (рГЦК) значителен, и их общий прогноз все еще неблагоприятен. Целью исследования является обобщение данных о частоте рецидивов ГЦК после трансплантации печени (ТП), рассмотрение их клинических особенностей и существующих вариантов терапии в нашем центре. Мы также рассматриваем потенциальные факторы риска рецидивирования ГЦК.

Материалы и методы

Трансплантация печени была выполнена 148 пациентам в сроки с августа 2006 по декабрь 2020 г. в нашем центре. Выявлены случаи рецидивов ГЦК и систематизированы их клинические характеристики.

Результаты

Средние сроки наблюдения после ТП составляли 53±34,8 мес. Рецидивы ГЦК были обнаружены у 16 пациентов (8,9%). Большинство этих больных (68,8%) наблюдали в течение первых двух лет после ТП. Инвазия в лимфатические сосуды, низкая степень дифференцировки опухоли и оценки по шкале RETREAT были достоверно связаны с рецидивами ГЦК.

Выводы

Раннее выявление рецидивов необходимо для применения более эффективных способов контроля рГЦК. Критерии, основанные на оценке объема опухоли, не достаточны для прогнозирования случаев рецидивов ГЦК высокого риска. Следует использовать модели стратификации риска для выявления пациентов с плохим прогнозом при рГЦК. Протоколы их обследования должны быть адаптированы с риском рецидивирования ГЦК.

Ключевые слова

Гепатоцеллюлярная карцинома, трансплантация печени, рецидив опухоли.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(2788) "

Риск рецидивов гепатоцеллюлярной карциномы (рГЦК) значителен, и их общий прогноз все еще неблагоприятен. Целью исследования является обобщение данных о частоте рецидивов ГЦК после трансплантации печени (ТП), рассмотрение их клинических особенностей и существующих вариантов терапии в нашем центре. Мы также рассматриваем потенциальные факторы риска рецидивирования ГЦК.

Материалы и методы

Трансплантация печени была выполнена 148 пациентам в сроки с августа 2006 по декабрь 2020 г. в нашем центре. Выявлены случаи рецидивов ГЦК и систематизированы их клинические характеристики.

Результаты

Средние сроки наблюдения после ТП составляли 53±34,8 мес. Рецидивы ГЦК были обнаружены у 16 пациентов (8,9%). Большинство этих больных (68,8%) наблюдали в течение первых двух лет после ТП. Инвазия в лимфатические сосуды, низкая степень дифференцировки опухоли и оценки по шкале RETREAT были достоверно связаны с рецидивами ГЦК.

Выводы

Раннее выявление рецидивов необходимо для применения более эффективных способов контроля рГЦК. Критерии, основанные на оценке объема опухоли, не достаточны для прогнозирования случаев рецидивов ГЦК высокого риска. Следует использовать модели стратификации риска для выявления пациентов с плохим прогнозом при рГЦК. Протоколы их обследования должны быть адаптированы с риском рецидивирования ГЦК.

Ключевые слова

Гепатоцеллюлярная карцинома, трансплантация печени, рецидив опухоли.

" } ["ORGANIZATION_RU"]=> array(37) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28629" ["VALUE"]=> array(2) { ["TEXT"]=> string(424) "<p>¹ Департамент хируриги, Факультет медицины, Университет Александрии, Египет<br> ² Центр органной трансплантации, Госпиталь короля Фейсала и научный центр, Эр-Рияд, Королевство Саудовской Аравии</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(382) "

¹ Департамент хируриги, Факультет медицины, Университет Александрии, Египет
² Центр органной трансплантации, Госпиталь короля Фейсала и научный центр, Эр-Рияд, Королевство Саудовской Аравии

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(382) "

¹ Департамент хируриги, Факультет медицины, Университет Александрии, Египет
² Центр органной трансплантации, Госпиталь короля Фейсала и научный центр, Эр-Рияд, Королевство Саудовской Аравии

" } } } [5]=> array(49) { ["IBLOCK_SECTION_ID"]=> string(3) "213" ["~IBLOCK_SECTION_ID"]=> string(3) "213" ["ID"]=> string(4) "2063" ["~ID"]=> string(4) "2063" ["IBLOCK_ID"]=> string(1) "2" ["~IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(131) "Клиническое наблюдение ребенка с тяжелым течением кожного мастоцитоза" ["~NAME"]=> string(131) "Клиническое наблюдение ребенка с тяжелым течением кожного мастоцитоза" ["ACTIVE_FROM"]=> NULL ["~ACTIVE_FROM"]=> NULL ["TIMESTAMP_X"]=> string(22) "08/10/2022 09:07:42 am" ["~TIMESTAMP_X"]=> string(22) "08/10/2022 09:07:42 am" ["DETAIL_PAGE_URL"]=> string(125) "/en/archive/tom-11-nomer-2/klinicheskiy-sluchay/klinicheskoe-nablyudenie-rebenka-s-tyazhelym-techeniem-kozhnogo-mastotsitoza/" ["~DETAIL_PAGE_URL"]=> string(125) "/en/archive/tom-11-nomer-2/klinicheskiy-sluchay/klinicheskoe-nablyudenie-rebenka-s-tyazhelym-techeniem-kozhnogo-mastotsitoza/" ["LIST_PAGE_URL"]=> string(12) "/en/archive/" ["~LIST_PAGE_URL"]=> string(12) "/en/archive/" ["DETAIL_TEXT"]=> string(18883) "

Introduction

Mastocytosis is a clonal disease of mast cells. The frequency reaches 1:10000 of the population [1]. In adults, mastocytosis most often proceeds for a long time and is benign, and in children, as a rule, it regresses within several years [1, 2].

Mast cells are normally resident in connective tissue and proliferate under the influence of stem cell growth factor. The activating signal is transmitted by the receptor tyrosine kinase KIT. Somatic mutation in the C-KIT proto-oncogene leads to hyperproduction of the activating KIT receptor molecule, which causes excessive proliferation of mast cells. Up to 86% of children with mastocytosis have a somatic mutation in the C-KIT gene [3]. In addition to mast cells, the proliferation of melanocytes also depends on the KIT pathway, thus most likely causing typical pigment rashes [4]. Despite proven clonal growth, the aggressive course of mastocytosis in children, unlike adults, is extremely rare [5].

In aggressive course of the disease, chemotherapeutic approaches are similar to the strategy in adults. The variant with C-KIT mutation is crucial: if the С-KIT D816V is not detected, imatinib is effective [6, 7]. When the C-KIT D816V is revealed, cladribine and interferon alpha are used as the main drugs showing similar efficacy reaching about 50% [8]. New tyrosine kinase inhibitors (avapritinib and midostaurin) are also effective [9, 10]. Currently, allogeneic hematopoietic stem cell transplantation (HSCT) is recognized as the only curative method of aggressive mastocytosis. Appropriate experience with children is limited, however, there are reports on curative effect of HSCT [11].

The most frequent symptoms of mastocytosis are caused by permanent or periodical degranulation, i.e., release of various cytokines and biologically active substances from cytoplasmic granules of the mastocytes. The intensity of degranulation determines the variety of complaints: from their absence to severe itching, bullous rash, anaphylactoid reactions, abdominal pain requiring daily pharmacotherapy [12]. The release of cytokines is provoked by certain medications, bathing, mood swings and other factors [13]. The main therapeutic actions are aimed at avoidance of provoking factors, reducing the degranulation reaction and neutralizing the effect of histamine release. Due to the fact that the prognosis for non-aggressive forms of mastocytosis is generally favorable, and the disease regresses spontaneously in most patients, the main goal of attending physician is to improve the quality of life and ensure psychological welfare of the child and parents before the disease resolves. In this respect, we present a clinical case of skin mastocytosis with later developing osteoblastoma in an infant.

Case report

The boy was born full-term, weight 3190, body length 51 cm, head circumference 33 cm. At birth, there was a polymorphic rash on the baby's skin, including the formation of blisters (Fig. 1). Urticaria pigmentosa was clinically diagnosed.

In addition to the typical skin changes, mastocytosis was manifested by constant severe itching with the need for daily intake of antihistamines. During the first two weeks after birth, histamine crises spontaneously occurred 1-2 times a day, which looked like sudden redness of the skin, short-term appearance of blisters, an increase in itching, screaming and extreme excitement, turning into a fainting state. The duration of the crisis varied from several minutes to an hour. With a strong attack, wheezing on inspiration was noted, once the attack was accompanied by a stop of breathing for 10-15 seconds.

Since early childhood, the child complained of episodic abdominal pain of a pulling-stabbing nature. The attack lasts 30-60 minutes, there is no convincing effects of drotaverine and nonsteroidal anti-inflammatory drug administration. There were unmotivated weekly episodes of vomiting, with no stool сhanges. Evident causes of pain and vomiting were not revealed, endoscopic studies were not performed.

At the age of three months, the child was re-examined. We present the results of the survey. Histological analysis of the skin revealed changes typical of mastocytosis. A widespread proliferate was found, consisting mainly of cells with partially elongated fragmented nuclei expressing tryptase and CD117. No expression of Langerin, CD1a and S100 was detected. A mutation of the KIT D816V gene was detected in DNA from skin biopsy using PCR technique. The concentration of tryptase in the blood was 17.3 (normally, 11.4) µg/l. The dermatological diagnosis of urticaria pigmentosa has been confirmed. Additional analyses were performed to determine the aggressiveness and the degree of organ involvement. The concentration of hemoglobin, reticulocytes, the number of platelets, leukocytes with a leukocyte formula, the rate of erythrocyte sedimentation within the age norm. The blood clotting INR, prothrombin and thromboplastin time, concentration of potassium, sodium, urea, creatinine, uric acid, bilirubin, C-reactive protein, albumin, β-2 microglobulin, immunoglobulin E, fibrinogen, activity of alanine and asparate aminotransferase, lactate dehydrogenase and antithrombin III were within normal ranges. Histological and cytological analysis of the bone marrow revealed normal pattern, with only reactive changes. Ultrasound examination showed normal condition of abdominal organs. There were no signs of aggressive mastocytosis such as cytopenia, liver and bone impairment.

From birth, the child received cetirizine in maximum doses. In severe crises, dimethinden, betamethasone were added, and prednisone was administered once.

The parents reported that the main provoking factors were temperature changes, hot water, emotions, eating hot food, rubbing clothes, as well as acute infectious diseases. From four months of life, the frequency and severity of the crises decreased, from 6 months the vesicular rash disappeared, and from 12 months these crises ceased. However, skin itching with a marked decrease in the quality of life and the need for daily intake of antihistamines, as well as occasional intake of betamethasone, persisted for several years. The itching decreased after sunlight exposure during the summer time. At the age of two, the concentration of blood tryptase returned to normal. Since the age of three, hypersensitivity to changing air and water temperature has decreased.

At 2 years and 8 months, pain and impaired movement evolved in the left shoulder joint. А neoplasm was detected in the left humerus. According to histological and immunohistochemical analysis, osteoblastoma was diagnosed. After the month radical excision of the tumor within healthy tissues was performed. The operation proceeded without complications.

During the following years, abdominal complaints persisted but the rash decreased, with residual moderate skin itching requiring occasional administration of antihistamines. Focal pale hyperpigmentation of the skin is noted (see Fig. 3). Currently, the boy attends primary school.

Discussion

Mastocytosis is a poorly understood clonal disorder with a generally favorable prognosis. As in the presented case, mastocytosis most often appears in the first two years of life. The results of the analysis of a large group of children showed that in 23% of cases, the disease manifests immediately after birth [14]. Recent studies show that the childhood and adult mastocytosis is a clonal neoplasm by its origin. The C-KIT D816V mutation detected in the presented child is one of the most frequent. In the study of Bodemer C. it was found in 42% of children with mastocytosis [3]. The detection of the mutation in the presented child confirmed the diagnosis, since there was no need for chemotherapy.

The vast majority of children, despite the mast cell clonality, develop a complete or partial regression of the symptoms within the first years of life [2, 14]. In our experience, upon observation of 163 children with mastocytosis, the median time of clinical resolution was 34 (2-226) months [5]. The probability of regression increases with the onset of the disease in early childhood and does not depend on the severity of mastocytosis manifestations [5, 14, 15].

Due to high probability of spontaneous regression, parents and the attending physician should provide symptomatic treatment so that the child could tolerate the disease until its resolution. According to various studies, 29.5-64% of children with mastocytosis require pharmacological treatment [2, 16-18]. Most often, long-term use of H1 and H2 histamine blockers, as well as cromoline sodium, a stabilizer of mast cell membranes, is recommended to relieve the symptoms. Treatment with short courses of glucocorticosteroids is acceptable when the effect is not complete, [13, 19]. The therapy has been satisfactorily tolerated for many years, being quite safe, as shown by the present case and other observations [20]. A follow-up of 111 children with mastocytosis showed that the number of patients with severe course is less than 5%, while, in most cases, the disease either does not require regular treatment or is easily controlled by antihistamines [16]. In our clinical case, the antihistamine therapy proved to be insufficient, thus requiring usage of glucocorticosteroids. However, this severe course seems to be uncommon in mastocytosis.

Despite the severity of the complaints, there were no signs of aggressive mastocytosis in the child. Signs of aggressiveness include pronounced organomegaly, anemia, osteolytic syndrome and intestinal damage with weight loss. There were no indications for bone marrow analysis, however, both puncture and trephine biopsy were made and did not reveal specific infiltration [13]. In everyday practice, the severity of symptoms encourages doctors to conduct an in-depth examination of the patient, sometimes being excessive [5].

Osteoblastoma refers to rare bone tumor diseases with a favorable prognosis. According to the analysis of 99 patients, approximately half of them have a lesion of the vertebrae or humerus. Surgical treatment leads to recovery [21]. Localization of osteoblastoma, course, therapy and stable response to treatment of the humerus in the presented child, corresponded to the published data. According to the SEER register analysis (Surveillance, Epidemiology and End Results), where the results of observation in 421 patients with mastocytosis, including children, were analyzed, there was no increase in the number of secondary malignant diseases compared to the average population [22].

Conclusion

The presented clinical observation again confirms that, even in severe skin form of mastocytosis, the prognosis is favorable. The main efforts of attending doctor should be focused on improving the quality of life and emotional comfort of the child and his parents.

Conflict of interest

None declared.

References

1. Brockow K. Epidemiology, prognosis, and risk factors in mastocytosis. Immunol Allergy Clin North Am. 2014; 34(2): 283-295.
   doi: 10.1016/j.iac.2014.01.003
2. Azaña JM, Torrelo A, Mediero IG, et al. Urticaria pigmentosa: a review of 67 pediatric cases. Pediatr Dermatol. 1994; 11(2): 102-106.
   doi: 10.1111/j.1525-1470.1994.tb00560.x
3. Bodemer C, Hermine O, Palmérini F, et al. Pediatric mastocytosis is a clonal disease associated with D816V and other activating c-KIT mutations. J Invest Dermatol. 2010;130(3):804-815. doi: 10.1038/jid.2009.281
4. Kimura Y, Jones N, Klüppel M, et al. Targeted mutations of the juxtamembrane tyrosines in the Kit receptor tyrosine kinase selectively affect multiple cell lineages. Proc Natl Acad Sci USA. 2004; 101: 6015-6020.
5. Potapenko VG, Baikov VV, Boychenko EG, et al. Mastocytosis in children. A prospective study of 163 patients with remote parental surveys. Russian Journal of Pediatric Hematology and Oncology (RZhDGiO). 2021; 8(2): 13-25. doi: 10.21682/2311-1267-2021-8-2-13-25
   (In Russian).
6. Morren MA, Hoppé A, Renard M, et al. Imatinib mesylate in the treatment of diffuse cutaneous mastocytosis. J Pediatr. 2013; 162(1): 205-207. doi: 10.1016/j.jpeds.2012.08.035
7. Agarwala MK, George R, Mathews V, et al. Role of imatinib in the treatment of pediatric onset indolent systemic mastocytosis: a case report. J Dermatol Treat. 2013; 24(6): 481-483. doi: 10.3109/09546634.2013.802274
8. Lim KH, Tefferi A, Lasho TL, et al. Systemic mastocytosis in 342 consecutive adults: survival studies and prognostic factors. Blood. 2009; 113(23): 5727-5736. doi: 10.1182/blood-2009-02-205237
9. Gotlib J, Kluin-Nelemans HC, George TI, et al. Efficacy and Safety of Midostaurin in Advanced Systemic Mastocytosis. Reiter A N Engl J Med. 2016; 374(26): 2530-2541. doi: 10.1056/NEJMoa1513098
10. DeAngelo DJ, Quiery AT, Radia D, et al. Clinical activity in a phase 1 study of Blu-285, a potent, highly-selective inhibitor of KIT D816V in advanced systemic mastocytosis (AdvSM). Blood. 2017; 130(Suppl 1): 2. doi: 10.1182/blood.V130.Suppl_1.2.2
11. Srinivasan A, Ilonze CC, Travis SR, et al. Hemophagocytic lymphohistiocytosis in systemic mastocytosis treated with allogeneic bone marrow transplant: A case report. Pediatr Blood Cancer. 2020; 67(1): e28017. doi: 10.1002/pbc.28017
12. Carter MC, Metcalfe DD. Paediatric mastocytosis. Arch Dis Child. 2002; 86(5): 315-319. doi: 10.1136/adc.86.5.315
13. Heide R, Beishuizen A, De Groot H, et al. Mastocytosis in children: a protocol for management. Pediatr Dermatol. 2008; 25(4): 493‐500. doi: 10.1111/j.1525-1470.2008.00738.x
14. Méni C, Bruneau J, Georgin-Lavialle S. et al. Paediatric mastocytosis: a systematic review of 1747 cases. Br J Dermatol. 2015; 172(3): 642-651. doi: 10.1111/bjd.13567
15. Caplan RM. The natural course of urticaria pigmentosa. Analysis and follow-up of 112 cases. Arch Dermatol. 1963; 87: 146-157.
16. Potapenko VG, Skoryukova EV, Lisukova EG, et al. Mastocytosis in children. Clinical and laboratory characteristics of a group of 111 patients. Pediatrics. 2018; 97(4): 135-140. doi: 10.24110/0031-403X-2018-97-4-135-140 (In Russian).
17. Kiszewski AE, Durán-Mckinster C, Orozco-Covarrubias L, et al. Cutaneous mastocytosis in children: a clinical analysis of 71 cases.
    J Eur Acad Dermatol Venereol. 2004; 18(3): 285‐290. doi: 10.1111/j.1468-3083.2004.00830.x
18. Akoglu G, Erkin G, Cakir B, et al. Cutaneous mastocytosis: demographic aspects and clinical features of 55 patients. J Eur Acad Dermatol Venereol. 2006; 20(8): 969‐973. doi: 10.1111/j.1468-3083.2006.01696.x
19. Minutello K, Gupta V. Cromolyn Sodium. In: StatPearls. Treasure Island (FL): StatPearls Publishing; 2020.
20. Cardet JC, Akin C, Lee MJ. Mastocytosis: update on pharmacotherapy and future directions. Expert Opin Pharmacother. 2013; 14(15): 2033-2045. doi: 10.1517/14656566.2013.824424
21. Berry M, Mankin H, Gebhardt M, et al. Osteoblastoma: a 30-year study of 99 cases. J Surg Oncol. 2008; 98(3): 179-183.
    doi: 10.1002/jso.21105
22. Shivarov V, Gueorguieva R, Ivanova M, et al. Incidence of second solid cancers in mastocytosis patients: a SEER database analysis. Leuk Lymphoma. 2018; 59(6): 1474-1477. doi: 10.1080/10428194.2017.1382694

" ["~DETAIL_TEXT"]=> string(18883) "

Introduction

Mastocytosis is a clonal disease of mast cells. The frequency reaches 1:10000 of the population [1]. In adults, mastocytosis most often proceeds for a long time and is benign, and in children, as a rule, it regresses within several years [1, 2].

Mast cells are normally resident in connective tissue and proliferate under the influence of stem cell growth factor. The activating signal is transmitted by the receptor tyrosine kinase KIT. Somatic mutation in the C-KIT proto-oncogene leads to hyperproduction of the activating KIT receptor molecule, which causes excessive proliferation of mast cells. Up to 86% of children with mastocytosis have a somatic mutation in the C-KIT gene [3]. In addition to mast cells, the proliferation of melanocytes also depends on the KIT pathway, thus most likely causing typical pigment rashes [4]. Despite proven clonal growth, the aggressive course of mastocytosis in children, unlike adults, is extremely rare [5].

In aggressive course of the disease, chemotherapeutic approaches are similar to the strategy in adults. The variant with C-KIT mutation is crucial: if the С-KIT D816V is not detected, imatinib is effective [6, 7]. When the C-KIT D816V is revealed, cladribine and interferon alpha are used as the main drugs showing similar efficacy reaching about 50% [8]. New tyrosine kinase inhibitors (avapritinib and midostaurin) are also effective [9, 10]. Currently, allogeneic hematopoietic stem cell transplantation (HSCT) is recognized as the only curative method of aggressive mastocytosis. Appropriate experience with children is limited, however, there are reports on curative effect of HSCT [11].

The most frequent symptoms of mastocytosis are caused by permanent or periodical degranulation, i.e., release of various cytokines and biologically active substances from cytoplasmic granules of the mastocytes. The intensity of degranulation determines the variety of complaints: from their absence to severe itching, bullous rash, anaphylactoid reactions, abdominal pain requiring daily pharmacotherapy [12]. The release of cytokines is provoked by certain medications, bathing, mood swings and other factors [13]. The main therapeutic actions are aimed at avoidance of provoking factors, reducing the degranulation reaction and neutralizing the effect of histamine release. Due to the fact that the prognosis for non-aggressive forms of mastocytosis is generally favorable, and the disease regresses spontaneously in most patients, the main goal of attending physician is to improve the quality of life and ensure psychological welfare of the child and parents before the disease resolves. In this respect, we present a clinical case of skin mastocytosis with later developing osteoblastoma in an infant.

Case report

The boy was born full-term, weight 3190, body length 51 cm, head circumference 33 cm. At birth, there was a polymorphic rash on the baby's skin, including the formation of blisters (Fig. 1). Urticaria pigmentosa was clinically diagnosed.

In addition to the typical skin changes, mastocytosis was manifested by constant severe itching with the need for daily intake of antihistamines. During the first two weeks after birth, histamine crises spontaneously occurred 1-2 times a day, which looked like sudden redness of the skin, short-term appearance of blisters, an increase in itching, screaming and extreme excitement, turning into a fainting state. The duration of the crisis varied from several minutes to an hour. With a strong attack, wheezing on inspiration was noted, once the attack was accompanied by a stop of breathing for 10-15 seconds.

Since early childhood, the child complained of episodic abdominal pain of a pulling-stabbing nature. The attack lasts 30-60 minutes, there is no convincing effects of drotaverine and nonsteroidal anti-inflammatory drug administration. There were unmotivated weekly episodes of vomiting, with no stool сhanges. Evident causes of pain and vomiting were not revealed, endoscopic studies were not performed.

At the age of three months, the child was re-examined. We present the results of the survey. Histological analysis of the skin revealed changes typical of mastocytosis. A widespread proliferate was found, consisting mainly of cells with partially elongated fragmented nuclei expressing tryptase and CD117. No expression of Langerin, CD1a and S100 was detected. A mutation of the KIT D816V gene was detected in DNA from skin biopsy using PCR technique. The concentration of tryptase in the blood was 17.3 (normally, 11.4) µg/l. The dermatological diagnosis of urticaria pigmentosa has been confirmed. Additional analyses were performed to determine the aggressiveness and the degree of organ involvement. The concentration of hemoglobin, reticulocytes, the number of platelets, leukocytes with a leukocyte formula, the rate of erythrocyte sedimentation within the age norm. The blood clotting INR, prothrombin and thromboplastin time, concentration of potassium, sodium, urea, creatinine, uric acid, bilirubin, C-reactive protein, albumin, β-2 microglobulin, immunoglobulin E, fibrinogen, activity of alanine and asparate aminotransferase, lactate dehydrogenase and antithrombin III were within normal ranges. Histological and cytological analysis of the bone marrow revealed normal pattern, with only reactive changes. Ultrasound examination showed normal condition of abdominal organs. There were no signs of aggressive mastocytosis such as cytopenia, liver and bone impairment.

From birth, the child received cetirizine in maximum doses. In severe crises, dimethinden, betamethasone were added, and prednisone was administered once.

The parents reported that the main provoking factors were temperature changes, hot water, emotions, eating hot food, rubbing clothes, as well as acute infectious diseases. From four months of life, the frequency and severity of the crises decreased, from 6 months the vesicular rash disappeared, and from 12 months these crises ceased. However, skin itching with a marked decrease in the quality of life and the need for daily intake of antihistamines, as well as occasional intake of betamethasone, persisted for several years. The itching decreased after sunlight exposure during the summer time. At the age of two, the concentration of blood tryptase returned to normal. Since the age of three, hypersensitivity to changing air and water temperature has decreased.

At 2 years and 8 months, pain and impaired movement evolved in the left shoulder joint. А neoplasm was detected in the left humerus. According to histological and immunohistochemical analysis, osteoblastoma was diagnosed. After the month radical excision of the tumor within healthy tissues was performed. The operation proceeded without complications.

During the following years, abdominal complaints persisted but the rash decreased, with residual moderate skin itching requiring occasional administration of antihistamines. Focal pale hyperpigmentation of the skin is noted (see Fig. 3). Currently, the boy attends primary school.

Discussion

Mastocytosis is a poorly understood clonal disorder with a generally favorable prognosis. As in the presented case, mastocytosis most often appears in the first two years of life. The results of the analysis of a large group of children showed that in 23% of cases, the disease manifests immediately after birth [14]. Recent studies show that the childhood and adult mastocytosis is a clonal neoplasm by its origin. The C-KIT D816V mutation detected in the presented child is one of the most frequent. In the study of Bodemer C. it was found in 42% of children with mastocytosis [3]. The detection of the mutation in the presented child confirmed the diagnosis, since there was no need for chemotherapy.

The vast majority of children, despite the mast cell clonality, develop a complete or partial regression of the symptoms within the first years of life [2, 14]. In our experience, upon observation of 163 children with mastocytosis, the median time of clinical resolution was 34 (2-226) months [5]. The probability of regression increases with the onset of the disease in early childhood and does not depend on the severity of mastocytosis manifestations [5, 14, 15].

Due to high probability of spontaneous regression, parents and the attending physician should provide symptomatic treatment so that the child could tolerate the disease until its resolution. According to various studies, 29.5-64% of children with mastocytosis require pharmacological treatment [2, 16-18]. Most often, long-term use of H1 and H2 histamine blockers, as well as cromoline sodium, a stabilizer of mast cell membranes, is recommended to relieve the symptoms. Treatment with short courses of glucocorticosteroids is acceptable when the effect is not complete, [13, 19]. The therapy has been satisfactorily tolerated for many years, being quite safe, as shown by the present case and other observations [20]. A follow-up of 111 children with mastocytosis showed that the number of patients with severe course is less than 5%, while, in most cases, the disease either does not require regular treatment or is easily controlled by antihistamines [16]. In our clinical case, the antihistamine therapy proved to be insufficient, thus requiring usage of glucocorticosteroids. However, this severe course seems to be uncommon in mastocytosis.

Despite the severity of the complaints, there were no signs of aggressive mastocytosis in the child. Signs of aggressiveness include pronounced organomegaly, anemia, osteolytic syndrome and intestinal damage with weight loss. There were no indications for bone marrow analysis, however, both puncture and trephine biopsy were made and did not reveal specific infiltration [13]. In everyday practice, the severity of symptoms encourages doctors to conduct an in-depth examination of the patient, sometimes being excessive [5].

Osteoblastoma refers to rare bone tumor diseases with a favorable prognosis. According to the analysis of 99 patients, approximately half of them have a lesion of the vertebrae or humerus. Surgical treatment leads to recovery [21]. Localization of osteoblastoma, course, therapy and stable response to treatment of the humerus in the presented child, corresponded to the published data. According to the SEER register analysis (Surveillance, Epidemiology and End Results), where the results of observation in 421 patients with mastocytosis, including children, were analyzed, there was no increase in the number of secondary malignant diseases compared to the average population [22].

Conclusion

The presented clinical observation again confirms that, even in severe skin form of mastocytosis, the prognosis is favorable. The main efforts of attending doctor should be focused on improving the quality of life and emotional comfort of the child and his parents.

Conflict of interest

None declared.

References

1. Brockow K. Epidemiology, prognosis, and risk factors in mastocytosis. Immunol Allergy Clin North Am. 2014; 34(2): 283-295.
   doi: 10.1016/j.iac.2014.01.003
2. Azaña JM, Torrelo A, Mediero IG, et al. Urticaria pigmentosa: a review of 67 pediatric cases. Pediatr Dermatol. 1994; 11(2): 102-106.
   doi: 10.1111/j.1525-1470.1994.tb00560.x
3. Bodemer C, Hermine O, Palmérini F, et al. Pediatric mastocytosis is a clonal disease associated with D816V and other activating c-KIT mutations. J Invest Dermatol. 2010;130(3):804-815. doi: 10.1038/jid.2009.281
4. Kimura Y, Jones N, Klüppel M, et al. Targeted mutations of the juxtamembrane tyrosines in the Kit receptor tyrosine kinase selectively affect multiple cell lineages. Proc Natl Acad Sci USA. 2004; 101: 6015-6020.
5. Potapenko VG, Baikov VV, Boychenko EG, et al. Mastocytosis in children. A prospective study of 163 patients with remote parental surveys. Russian Journal of Pediatric Hematology and Oncology (RZhDGiO). 2021; 8(2): 13-25. doi: 10.21682/2311-1267-2021-8-2-13-25
   (In Russian).
6. Morren MA, Hoppé A, Renard M, et al. Imatinib mesylate in the treatment of diffuse cutaneous mastocytosis. J Pediatr. 2013; 162(1): 205-207. doi: 10.1016/j.jpeds.2012.08.035
7. Agarwala MK, George R, Mathews V, et al. Role of imatinib in the treatment of pediatric onset indolent systemic mastocytosis: a case report. J Dermatol Treat. 2013; 24(6): 481-483. doi: 10.3109/09546634.2013.802274
8. Lim KH, Tefferi A, Lasho TL, et al. Systemic mastocytosis in 342 consecutive adults: survival studies and prognostic factors. Blood. 2009; 113(23): 5727-5736. doi: 10.1182/blood-2009-02-205237
9. Gotlib J, Kluin-Nelemans HC, George TI, et al. Efficacy and Safety of Midostaurin in Advanced Systemic Mastocytosis. Reiter A N Engl J Med. 2016; 374(26): 2530-2541. doi: 10.1056/NEJMoa1513098
10. DeAngelo DJ, Quiery AT, Radia D, et al. Clinical activity in a phase 1 study of Blu-285, a potent, highly-selective inhibitor of KIT D816V in advanced systemic mastocytosis (AdvSM). Blood. 2017; 130(Suppl 1): 2. doi: 10.1182/blood.V130.Suppl_1.2.2
11. Srinivasan A, Ilonze CC, Travis SR, et al. Hemophagocytic lymphohistiocytosis in systemic mastocytosis treated with allogeneic bone marrow transplant: A case report. Pediatr Blood Cancer. 2020; 67(1): e28017. doi: 10.1002/pbc.28017
12. Carter MC, Metcalfe DD. Paediatric mastocytosis. Arch Dis Child. 2002; 86(5): 315-319. doi: 10.1136/adc.86.5.315
13. Heide R, Beishuizen A, De Groot H, et al. Mastocytosis in children: a protocol for management. Pediatr Dermatol. 2008; 25(4): 493‐500. doi: 10.1111/j.1525-1470.2008.00738.x
14. Méni C, Bruneau J, Georgin-Lavialle S. et al. Paediatric mastocytosis: a systematic review of 1747 cases. Br J Dermatol. 2015; 172(3): 642-651. doi: 10.1111/bjd.13567
15. Caplan RM. The natural course of urticaria pigmentosa. Analysis and follow-up of 112 cases. Arch Dermatol. 1963; 87: 146-157.
16. Potapenko VG, Skoryukova EV, Lisukova EG, et al. Mastocytosis in children. Clinical and laboratory characteristics of a group of 111 patients. Pediatrics. 2018; 97(4): 135-140. doi: 10.24110/0031-403X-2018-97-4-135-140 (In Russian).
17. Kiszewski AE, Durán-Mckinster C, Orozco-Covarrubias L, et al. Cutaneous mastocytosis in children: a clinical analysis of 71 cases.
    J Eur Acad Dermatol Venereol. 2004; 18(3): 285‐290. doi: 10.1111/j.1468-3083.2004.00830.x
18. Akoglu G, Erkin G, Cakir B, et al. Cutaneous mastocytosis: demographic aspects and clinical features of 55 patients. J Eur Acad Dermatol Venereol. 2006; 20(8): 969‐973. doi: 10.1111/j.1468-3083.2006.01696.x
19. Minutello K, Gupta V. Cromolyn Sodium. In: StatPearls. Treasure Island (FL): StatPearls Publishing; 2020.
20. Cardet JC, Akin C, Lee MJ. Mastocytosis: update on pharmacotherapy and future directions. Expert Opin Pharmacother. 2013; 14(15): 2033-2045. doi: 10.1517/14656566.2013.824424
21. Berry M, Mankin H, Gebhardt M, et al. Osteoblastoma: a 30-year study of 99 cases. J Surg Oncol. 2008; 98(3): 179-183.
    doi: 10.1002/jso.21105
22. Shivarov V, Gueorguieva R, Ivanova M, et al. Incidence of second solid cancers in mastocytosis patients: a SEER database analysis. Leuk Lymphoma. 2018; 59(6): 1474-1477. doi: 10.1080/10428194.2017.1382694

" ["DETAIL_TEXT_TYPE"]=> string(4) "html" ["~DETAIL_TEXT_TYPE"]=> string(4) "html" ["PREVIEW_TEXT"]=> string(0) "" ["~PREVIEW_TEXT"]=> string(0) "" ["PREVIEW_TEXT_TYPE"]=> string(4) "text" ["~PREVIEW_TEXT_TYPE"]=> string(4) "text" ["PREVIEW_PICTURE"]=> NULL ["~PREVIEW_PICTURE"]=> NULL ["LANG_DIR"]=> string(4) "/ru/" ["~LANG_DIR"]=> string(4) "/ru/" ["SORT"]=> string(2) "20" ["~SORT"]=> string(2) "20" ["CODE"]=> string(76) "klinicheskoe-nablyudenie-rebenka-s-tyazhelym-techeniem-kozhnogo-mastotsitoza" ["~CODE"]=> string(76) "klinicheskoe-nablyudenie-rebenka-s-tyazhelym-techeniem-kozhnogo-mastotsitoza" ["EXTERNAL_ID"]=> string(4) "2063" ["~EXTERNAL_ID"]=> string(4) "2063" ["IBLOCK_TYPE_ID"]=> string(7) "journal" ["~IBLOCK_TYPE_ID"]=> string(7) "journal" ["IBLOCK_CODE"]=> string(7) "volumes" ["~IBLOCK_CODE"]=> string(7) "volumes" ["IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["~IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["LID"]=> string(2) "s2" ["~LID"]=> string(2) "s2" ["EDIT_LINK"]=> NULL ["DELETE_LINK"]=> NULL ["DISPLAY_ACTIVE_FROM"]=> string(0) "" ["IPROPERTY_VALUES"]=> array(18) { ["ELEMENT_META_TITLE"]=> string(131) "Клиническое наблюдение ребенка с тяжелым течением кожного мастоцитоза" ["ELEMENT_META_KEYWORDS"]=> string(0) "" ["ELEMENT_META_DESCRIPTION"]=> string(194) "Клиническое наблюдение ребенка с тяжелым течением кожного мастоцитозаSevere course of cutaneous mastocytosis in a child. Case report" ["ELEMENT_PREVIEW_PICTURE_FILE_ALT"]=> string(2384) "<p style="text-align: justify;">Мастоцитоз – заболевание системы крови с накоплением кланальных тучных клеток в одном или нескольких органах. У детей чаще всего поражается кожа. У большей части болезнь регрессирует самостоятельно, независимо от тяжести клинических проявлений.</p> <h3>Описание случая</h3> <p style="text-align: justify;">Заболевание дебютировало сразу после рождения в виде тяжелой типичной уртикарной и везикулярной сыпи, ежедневных приливов и зуда. Проводилось симптоматическое лечение антигистаминными препаратами и короткими курсами глюкокортикостероидов. С 4 месяцев началась положительная динамика: разрешились приливы, прошли боли в животе, уменьшились сыпь, зуд, снизилась потребность в фармакотерапии. В 2 года и 9 месяцев ребенок был радикально прооперирован по поводу остеобластомы. В настоящее время сохраняется умеренный кожный зуд, ребенок растет и развивается по возрасту, антигистаминные препараты принимает лишь эпизодически.</p> <h3>Заключение</h3> <p style="text-align: justify;">Клиническое наблюдение демонстрирует самостоятельный регресс заболевания даже при тяжелом течении.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Мастоцитоз, клиническое наблюдение, пигментная крапивница, триптаза, антигистаминные средства, C-KIT, тучные клетки.</p>" ["ELEMENT_PREVIEW_PICTURE_FILE_TITLE"]=> string(131) "Клиническое наблюдение ребенка с тяжелым течением кожного мастоцитоза" ["ELEMENT_DETAIL_PICTURE_FILE_ALT"]=> string(131) "Клиническое наблюдение ребенка с тяжелым течением кожного мастоцитоза" ["ELEMENT_DETAIL_PICTURE_FILE_TITLE"]=> string(131) "Клиническое наблюдение ребенка с тяжелым течением кожного мастоцитоза" ["SECTION_META_TITLE"]=> string(131) "Клиническое наблюдение ребенка с тяжелым течением кожного мастоцитоза" ["SECTION_META_KEYWORDS"]=> string(131) "Клиническое наблюдение ребенка с тяжелым течением кожного мастоцитоза" ["SECTION_META_DESCRIPTION"]=> string(131) "Клиническое наблюдение ребенка с тяжелым течением кожного мастоцитоза" ["SECTION_PICTURE_FILE_ALT"]=> string(131) "Клиническое наблюдение ребенка с тяжелым течением кожного мастоцитоза" ["SECTION_PICTURE_FILE_TITLE"]=> string(131) "Клиническое наблюдение ребенка с тяжелым течением кожного мастоцитоза" ["SECTION_PICTURE_FILE_NAME"]=> string(80) "klinicheskoe-nablyudenie-rebenka-s-tyazhelym-techeniem-kozhnogo-mastotsitoza-img" ["SECTION_DETAIL_PICTURE_FILE_ALT"]=> string(131) "Клиническое наблюдение ребенка с тяжелым течением кожного мастоцитоза" ["SECTION_DETAIL_PICTURE_FILE_TITLE"]=> string(131) "Клиническое наблюдение ребенка с тяжелым течением кожного мастоцитоза" ["SECTION_DETAIL_PICTURE_FILE_NAME"]=> string(80) "klinicheskoe-nablyudenie-rebenka-s-tyazhelym-techeniem-kozhnogo-mastotsitoza-img" ["ELEMENT_PREVIEW_PICTURE_FILE_NAME"]=> string(80) "klinicheskoe-nablyudenie-rebenka-s-tyazhelym-techeniem-kozhnogo-mastotsitoza-img" ["ELEMENT_DETAIL_PICTURE_FILE_NAME"]=> string(80) "klinicheskoe-nablyudenie-rebenka-s-tyazhelym-techeniem-kozhnogo-mastotsitoza-img" } ["FIELDS"]=> array(1) { ["IBLOCK_SECTION_ID"]=> string(3) "213" } ["PROPERTIES"]=> array(18) { ["KEYWORDS"]=> array(36) { ["ID"]=> string(2) "19" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:46:01" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(27) "Ключевые слова" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "KEYWORDS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "19" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "4" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "Y" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "Y" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(27) "Ключевые слова" ["~DEFAULT_VALUE"]=> string(0) "" } ["SUBMITTED"]=> array(36) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28654" ["VALUE"]=> string(22) "06/06/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "06/06/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL } ["ACCEPTED"]=> array(36) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28655" ["VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL } ["PUBLISHED"]=> array(36) { ["ID"]=> string(2) "22" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Дата публикации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "PUBLISHED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "22" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Дата публикации" ["~DEFAULT_VALUE"]=> NULL } ["CONTACT"]=> array(36) { ["ID"]=> string(2) "23" ["TIMESTAMP_X"]=> string(19) "2015-09-03 14:43:05" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(14) "Контакт" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "CONTACT" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "23" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(14) "Контакт" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHORS"]=> array(36) { ["ID"]=> string(2) "24" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:45:07" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "AUTHORS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "24" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_RU"]=> array(36) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28656" ["VALUE"]=> array(2) { ["TEXT"]=> string(139) "<p>Всеволод Г. Потапенко¹, Сергей Р. Талыпов²</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(103) "

Всеволод Г. Потапенко¹, Сергей Р. Талыпов²

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_RU"]=> array(36) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28657" ["VALUE"]=> array(2) { ["TEXT"]=> string(424) "<p>¹ Городская клиническая больница №31, Санкт-Петербург, Россия <br> ² Национальный медицинский исследовательский центр детской гематологии, онкологии и иммунологии им. Д. Рогачева, Москва, Россия</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(382) "

¹ Городская клиническая больница №31, Санкт-Петербург, Россия
² Национальный медицинский исследовательский центр детской гематологии, онкологии и иммунологии им. Д. Рогачева, Москва, Россия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_RU"]=> array(36) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28658" ["VALUE"]=> array(2) { ["TEXT"]=> string(2384) "<p style="text-align: justify;">Мастоцитоз – заболевание системы крови с накоплением кланальных тучных клеток в одном или нескольких органах. У детей чаще всего поражается кожа. У большей части болезнь регрессирует самостоятельно, независимо от тяжести клинических проявлений.</p> <h3>Описание случая</h3> <p style="text-align: justify;">Заболевание дебютировало сразу после рождения в виде тяжелой типичной уртикарной и везикулярной сыпи, ежедневных приливов и зуда. Проводилось симптоматическое лечение антигистаминными препаратами и короткими курсами глюкокортикостероидов. С 4 месяцев началась положительная динамика: разрешились приливы, прошли боли в животе, уменьшились сыпь, зуд, снизилась потребность в фармакотерапии. В 2 года и 9 месяцев ребенок был радикально прооперирован по поводу остеобластомы. В настоящее время сохраняется умеренный кожный зуд, ребенок растет и развивается по возрасту, антигистаминные препараты принимает лишь эпизодически.</p> <h3>Заключение</h3> <p style="text-align: justify;">Клиническое наблюдение демонстрирует самостоятельный регресс заболевания даже при тяжелом течении.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Мастоцитоз, клиническое наблюдение, пигментная крапивница, триптаза, антигистаминные средства, C-KIT, тучные клетки.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(2260) "

Мастоцитоз – заболевание системы крови с накоплением кланальных тучных клеток в одном или нескольких органах. У детей чаще всего поражается кожа. У большей части болезнь регрессирует самостоятельно, независимо от тяжести клинических проявлений.

Описание случая

Заболевание дебютировало сразу после рождения в виде тяжелой типичной уртикарной и везикулярной сыпи, ежедневных приливов и зуда. Проводилось симптоматическое лечение антигистаминными препаратами и короткими курсами глюкокортикостероидов. С 4 месяцев началась положительная динамика: разрешились приливы, прошли боли в животе, уменьшились сыпь, зуд, снизилась потребность в фармакотерапии. В 2 года и 9 месяцев ребенок был радикально прооперирован по поводу остеобластомы. В настоящее время сохраняется умеренный кожный зуд, ребенок растет и развивается по возрасту, антигистаминные препараты принимает лишь эпизодически.

Заключение

Клиническое наблюдение демонстрирует самостоятельный регресс заболевания даже при тяжелом течении.

Ключевые слова

Мастоцитоз, клиническое наблюдение, пигментная крапивница, триптаза, антигистаминные средства, C-KIT, тучные клетки.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["DOI"]=> array(36) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28659" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-58-62" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-58-62" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_EN"]=> array(36) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28662" ["VALUE"]=> array(2) { ["TEXT"]=> string(107) "<p>Vsevolod G. Potapenko¹, Sergey R. Talypov²</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(71) "

Vsevolod G. Potapenko¹, Sergey R. Talypov²

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_EN"]=> array(36) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28663" ["VALUE"]=> array(2) { ["TEXT"]=> string(752) "<p>¹ Municipal Clinical Hospital No. 31, St. Petersburg, Russia<br> ² D. Rogachev National Medical Research Center of Pediatric Hematology, Oncology and Immunology, Moscow, Russia</p><br> <p><b>Correspondence:</b><br> Dr. Vsevolod G. Potapenko, PhD, Hematologist, Hematology Department, Municipal Clinical Hospital № 31, Pr. Dinamo, 3, 197110, St. Petersburg, Russia<br> Phone: +7 (905) 284-51-38<br> E-mail: potapenko.vsevolod@mail.ru </p><br> <p><b>Citation:</b> Potapenko VG, Talypov SR. Severe course of cutaneous mastocytosis in a child. Case report. Cell Ther Transplant 2022; 11(2): 58-62.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(632) "

¹ Municipal Clinical Hospital No. 31, St. Petersburg, Russia
² D. Rogachev National Medical Research Center of Pediatric Hematology, Oncology and Immunology, Moscow, Russia

Correspondence:
Dr. Vsevolod G. Potapenko, PhD, Hematologist, Hematology Department, Municipal Clinical Hospital № 31, Pr. Dinamo, 3, 197110, St. Petersburg, Russia
Phone: +7 (905) 284-51-38
E-mail: potapenko.vsevolod@mail.ru

Citation: Potapenko VG, Talypov SR. Severe course of cutaneous mastocytosis in a child. Case report. Cell Ther Transplant 2022; 11(2): 58-62.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_EN"]=> array(36) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28664" ["VALUE"]=> array(2) { ["TEXT"]=> string(1402) "<p style="text-align: justify;">Mastocytosis is a disease of the blood system with the accumulation of clonal mast cells in one or more organs. In children, the skin is most often affected. In most cases, the disease regresses spontaneously, regardless of severe clinical manifestations. </p> <h3>Case description</h3> <p style="text-align: justify;">The disease was diagnosed after birth. Mastocytosis manifested with severe typical urticular and vesicular rash, daily hot flashes and itching. Skin infiltration with mast cells was confirmed by immunohistological examination of the skin. Symptomatic treatment was carried out with antihistamine drugs and short courses of glucocorticosteroids. The disease started to resolve since 4 months of age, with reduction of: hot flashes, abdominal pain, rash, and itching, thus decreasing the needs for drug therapy. At the age of 2 years 9 months, the child underwent radical surgery for osteoblastoma. Currently, moderate skin itching persists, the child develops according to his age, takes antihistamines only occasionally. Hence, this clinical observation demonstrates benign course of mastocytosis, even in severe cases.</p> <h2>Keywords</h2> <p style="text-align: justify;">Мastocytosis, сase report, pigmented urticaria, tryptase, C-KIT, mast cells.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1312) "

Mastocytosis is a disease of the blood system with the accumulation of clonal mast cells in one or more organs. In children, the skin is most often affected. In most cases, the disease regresses spontaneously, regardless of severe clinical manifestations.

Case description

The disease was diagnosed after birth. Mastocytosis manifested with severe typical urticular and vesicular rash, daily hot flashes and itching. Skin infiltration with mast cells was confirmed by immunohistological examination of the skin. Symptomatic treatment was carried out with antihistamine drugs and short courses of glucocorticosteroids. The disease started to resolve since 4 months of age, with reduction of: hot flashes, abdominal pain, rash, and itching, thus decreasing the needs for drug therapy. At the age of 2 years 9 months, the child underwent radical surgery for osteoblastoma. Currently, moderate skin itching persists, the child develops according to his age, takes antihistamines only occasionally. Hence, this clinical observation demonstrates benign course of mastocytosis, even in severe cases.

Keywords

Мastocytosis, сase report, pigmented urticaria, tryptase, C-KIT, mast cells.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["NAME_EN"]=> array(36) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28660" ["VALUE"]=> string(63) "Severe course of cutaneous mastocytosis in a child. Case report" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(63) "Severe course of cutaneous mastocytosis in a child. Case report" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" } ["FULL_TEXT_RU"]=> array(36) { ["ID"]=> string(2) "42" ["TIMESTAMP_X"]=> string(19) "2015-09-07 20:29:18" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(23) "Полный текст" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(12) "FULL_TEXT_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "42" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(23) "Полный текст" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["PDF_RU"]=> array(36) { ["ID"]=> string(2) "43" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF RUS" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_RU" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "43" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28661" ["VALUE"]=> string(4) "2854" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2854" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF RUS" ["~DEFAULT_VALUE"]=> string(0) "" } ["PDF_EN"]=> array(36) { ["ID"]=> string(2) "44" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF ENG" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "44" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28665" ["VALUE"]=> string(4) "2858" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2858" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF ENG" ["~DEFAULT_VALUE"]=> string(0) "" } ["NAME_LONG"]=> array(36) { ["ID"]=> string(2) "45" ["TIMESTAMP_X"]=> string(19) "2023-04-13 00:55:00" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(72) "Название (для очень длинных заголовков)" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "NAME_LONG" ["DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "45" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(80) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(72) "Название (для очень длинных заголовков)" ["~DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } } } ["DISPLAY_PROPERTIES"]=> array(10) { ["AUTHOR_EN"]=> array(37) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28662" ["VALUE"]=> array(2) { ["TEXT"]=> string(107) "<p>Vsevolod G. Potapenko¹, Sergey R. Talypov²</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(71) "

Vsevolod G. Potapenko¹, Sergey R. Talypov²

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(71) "

Vsevolod G. Potapenko¹, Sergey R. Talypov²

" } ["SUMMARY_EN"]=> array(37) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28664" ["VALUE"]=> array(2) { ["TEXT"]=> string(1402) "<p style="text-align: justify;">Mastocytosis is a disease of the blood system with the accumulation of clonal mast cells in one or more organs. In children, the skin is most often affected. In most cases, the disease regresses spontaneously, regardless of severe clinical manifestations. </p> <h3>Case description</h3> <p style="text-align: justify;">The disease was diagnosed after birth. Mastocytosis manifested with severe typical urticular and vesicular rash, daily hot flashes and itching. Skin infiltration with mast cells was confirmed by immunohistological examination of the skin. Symptomatic treatment was carried out with antihistamine drugs and short courses of glucocorticosteroids. The disease started to resolve since 4 months of age, with reduction of: hot flashes, abdominal pain, rash, and itching, thus decreasing the needs for drug therapy. At the age of 2 years 9 months, the child underwent radical surgery for osteoblastoma. Currently, moderate skin itching persists, the child develops according to his age, takes antihistamines only occasionally. Hence, this clinical observation demonstrates benign course of mastocytosis, even in severe cases.</p> <h2>Keywords</h2> <p style="text-align: justify;">Мastocytosis, сase report, pigmented urticaria, tryptase, C-KIT, mast cells.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1312) "

Mastocytosis is a disease of the blood system with the accumulation of clonal mast cells in one or more organs. In children, the skin is most often affected. In most cases, the disease regresses spontaneously, regardless of severe clinical manifestations.

Case description

The disease was diagnosed after birth. Mastocytosis manifested with severe typical urticular and vesicular rash, daily hot flashes and itching. Skin infiltration with mast cells was confirmed by immunohistological examination of the skin. Symptomatic treatment was carried out with antihistamine drugs and short courses of glucocorticosteroids. The disease started to resolve since 4 months of age, with reduction of: hot flashes, abdominal pain, rash, and itching, thus decreasing the needs for drug therapy. At the age of 2 years 9 months, the child underwent radical surgery for osteoblastoma. Currently, moderate skin itching persists, the child develops according to his age, takes antihistamines only occasionally. Hence, this clinical observation demonstrates benign course of mastocytosis, even in severe cases.

Keywords

Мastocytosis, сase report, pigmented urticaria, tryptase, C-KIT, mast cells.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(1312) "

Mastocytosis is a disease of the blood system with the accumulation of clonal mast cells in one or more organs. In children, the skin is most often affected. In most cases, the disease regresses spontaneously, regardless of severe clinical manifestations.

Case description

The disease was diagnosed after birth. Mastocytosis manifested with severe typical urticular and vesicular rash, daily hot flashes and itching. Skin infiltration with mast cells was confirmed by immunohistological examination of the skin. Symptomatic treatment was carried out with antihistamine drugs and short courses of glucocorticosteroids. The disease started to resolve since 4 months of age, with reduction of: hot flashes, abdominal pain, rash, and itching, thus decreasing the needs for drug therapy. At the age of 2 years 9 months, the child underwent radical surgery for osteoblastoma. Currently, moderate skin itching persists, the child develops according to his age, takes antihistamines only occasionally. Hence, this clinical observation demonstrates benign course of mastocytosis, even in severe cases.

Keywords

Мastocytosis, сase report, pigmented urticaria, tryptase, C-KIT, mast cells.

" } ["DOI"]=> array(37) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28659" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-58-62" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-58-62" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-58-62" } ["NAME_EN"]=> array(37) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28660" ["VALUE"]=> string(63) "Severe course of cutaneous mastocytosis in a child. Case report" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(63) "Severe course of cutaneous mastocytosis in a child. Case report" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(63) "Severe course of cutaneous mastocytosis in a child. Case report" } ["ORGANIZATION_EN"]=> array(37) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28663" ["VALUE"]=> array(2) { ["TEXT"]=> string(752) "<p>¹ Municipal Clinical Hospital No. 31, St. Petersburg, Russia<br> ² D. Rogachev National Medical Research Center of Pediatric Hematology, Oncology and Immunology, Moscow, Russia</p><br> <p><b>Correspondence:</b><br> Dr. Vsevolod G. Potapenko, PhD, Hematologist, Hematology Department, Municipal Clinical Hospital № 31, Pr. Dinamo, 3, 197110, St. Petersburg, Russia<br> Phone: +7 (905) 284-51-38<br> E-mail: potapenko.vsevolod@mail.ru </p><br> <p><b>Citation:</b> Potapenko VG, Talypov SR. Severe course of cutaneous mastocytosis in a child. Case report. Cell Ther Transplant 2022; 11(2): 58-62.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(632) "

¹ Municipal Clinical Hospital No. 31, St. Petersburg, Russia
² D. Rogachev National Medical Research Center of Pediatric Hematology, Oncology and Immunology, Moscow, Russia

Correspondence:
Dr. Vsevolod G. Potapenko, PhD, Hematologist, Hematology Department, Municipal Clinical Hospital № 31, Pr. Dinamo, 3, 197110, St. Petersburg, Russia
Phone: +7 (905) 284-51-38
E-mail: potapenko.vsevolod@mail.ru

Citation: Potapenko VG, Talypov SR. Severe course of cutaneous mastocytosis in a child. Case report. Cell Ther Transplant 2022; 11(2): 58-62.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(632) "

¹ Municipal Clinical Hospital No. 31, St. Petersburg, Russia
² D. Rogachev National Medical Research Center of Pediatric Hematology, Oncology and Immunology, Moscow, Russia

Correspondence:
Dr. Vsevolod G. Potapenko, PhD, Hematologist, Hematology Department, Municipal Clinical Hospital № 31, Pr. Dinamo, 3, 197110, St. Petersburg, Russia
Phone: +7 (905) 284-51-38
E-mail: potapenko.vsevolod@mail.ru

Citation: Potapenko VG, Talypov SR. Severe course of cutaneous mastocytosis in a child. Case report. Cell Ther Transplant 2022; 11(2): 58-62.

" } ["AUTHOR_RU"]=> array(37) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28656" ["VALUE"]=> array(2) { ["TEXT"]=> string(139) "<p>Всеволод Г. Потапенко¹, Сергей Р. Талыпов²</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(103) "

Всеволод Г. Потапенко¹, Сергей Р. Талыпов²

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(103) "

Всеволод Г. Потапенко¹, Сергей Р. Талыпов²

" } ["SUBMITTED"]=> array(37) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28654" ["VALUE"]=> string(22) "06/06/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "06/06/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "06/06/2022 12:00:00 am" } ["ACCEPTED"]=> array(37) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28655" ["VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "07/05/2022 12:00:00 am" } ["SUMMARY_RU"]=> array(37) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28658" ["VALUE"]=> array(2) { ["TEXT"]=> string(2384) "<p style="text-align: justify;">Мастоцитоз – заболевание системы крови с накоплением кланальных тучных клеток в одном или нескольких органах. У детей чаще всего поражается кожа. У большей части болезнь регрессирует самостоятельно, независимо от тяжести клинических проявлений.</p> <h3>Описание случая</h3> <p style="text-align: justify;">Заболевание дебютировало сразу после рождения в виде тяжелой типичной уртикарной и везикулярной сыпи, ежедневных приливов и зуда. Проводилось симптоматическое лечение антигистаминными препаратами и короткими курсами глюкокортикостероидов. С 4 месяцев началась положительная динамика: разрешились приливы, прошли боли в животе, уменьшились сыпь, зуд, снизилась потребность в фармакотерапии. В 2 года и 9 месяцев ребенок был радикально прооперирован по поводу остеобластомы. В настоящее время сохраняется умеренный кожный зуд, ребенок растет и развивается по возрасту, антигистаминные препараты принимает лишь эпизодически.</p> <h3>Заключение</h3> <p style="text-align: justify;">Клиническое наблюдение демонстрирует самостоятельный регресс заболевания даже при тяжелом течении.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Мастоцитоз, клиническое наблюдение, пигментная крапивница, триптаза, антигистаминные средства, C-KIT, тучные клетки.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(2260) "

Мастоцитоз – заболевание системы крови с накоплением кланальных тучных клеток в одном или нескольких органах. У детей чаще всего поражается кожа. У большей части болезнь регрессирует самостоятельно, независимо от тяжести клинических проявлений.

Описание случая

Заболевание дебютировало сразу после рождения в виде тяжелой типичной уртикарной и везикулярной сыпи, ежедневных приливов и зуда. Проводилось симптоматическое лечение антигистаминными препаратами и короткими курсами глюкокортикостероидов. С 4 месяцев началась положительная динамика: разрешились приливы, прошли боли в животе, уменьшились сыпь, зуд, снизилась потребность в фармакотерапии. В 2 года и 9 месяцев ребенок был радикально прооперирован по поводу остеобластомы. В настоящее время сохраняется умеренный кожный зуд, ребенок растет и развивается по возрасту, антигистаминные препараты принимает лишь эпизодически.

Заключение

Клиническое наблюдение демонстрирует самостоятельный регресс заболевания даже при тяжелом течении.

Ключевые слова

Мастоцитоз, клиническое наблюдение, пигментная крапивница, триптаза, антигистаминные средства, C-KIT, тучные клетки.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(2260) "

Мастоцитоз – заболевание системы крови с накоплением кланальных тучных клеток в одном или нескольких органах. У детей чаще всего поражается кожа. У большей части болезнь регрессирует самостоятельно, независимо от тяжести клинических проявлений.

Описание случая

Заболевание дебютировало сразу после рождения в виде тяжелой типичной уртикарной и везикулярной сыпи, ежедневных приливов и зуда. Проводилось симптоматическое лечение антигистаминными препаратами и короткими курсами глюкокортикостероидов. С 4 месяцев началась положительная динамика: разрешились приливы, прошли боли в животе, уменьшились сыпь, зуд, снизилась потребность в фармакотерапии. В 2 года и 9 месяцев ребенок был радикально прооперирован по поводу остеобластомы. В настоящее время сохраняется умеренный кожный зуд, ребенок растет и развивается по возрасту, антигистаминные препараты принимает лишь эпизодически.

Заключение

Клиническое наблюдение демонстрирует самостоятельный регресс заболевания даже при тяжелом течении.

Ключевые слова

Мастоцитоз, клиническое наблюдение, пигментная крапивница, триптаза, антигистаминные средства, C-KIT, тучные клетки.

" } ["ORGANIZATION_RU"]=> array(37) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28657" ["VALUE"]=> array(2) { ["TEXT"]=> string(424) "<p>¹ Городская клиническая больница №31, Санкт-Петербург, Россия <br> ² Национальный медицинский исследовательский центр детской гематологии, онкологии и иммунологии им. Д. Рогачева, Москва, Россия</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(382) "

¹ Городская клиническая больница №31, Санкт-Петербург, Россия
² Национальный медицинский исследовательский центр детской гематологии, онкологии и иммунологии им. Д. Рогачева, Москва, Россия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(382) "

¹ Городская клиническая больница №31, Санкт-Петербург, Россия
² Национальный медицинский исследовательский центр детской гематологии, онкологии и иммунологии им. Д. Рогачева, Москва, Россия

" } } } [6]=> array(49) { ["IBLOCK_SECTION_ID"]=> string(3) "213" ["~IBLOCK_SECTION_ID"]=> string(3) "213" ["ID"]=> string(4) "2062" ["~ID"]=> string(4) "2062" ["IBLOCK_ID"]=> string(1) "2" ["~IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(169) "Осложненное течение вакцинации БЦЖ у детей до года с острыми лейкозами на фоне химиотерапии" ["~NAME"]=> string(169) "Осложненное течение вакцинации БЦЖ у детей до года с острыми лейкозами на фоне химиотерапии" ["ACTIVE_FROM"]=> NULL ["~ACTIVE_FROM"]=> NULL ["TIMESTAMP_X"]=> string(22) "08/10/2022 09:43:10 am" ["~TIMESTAMP_X"]=> string(22) "08/10/2022 09:43:10 am" ["DETAIL_PAGE_URL"]=> string(147) "/en/archive/tom-11-nomer-2/klinicheskiy-sluchay/oslozhnennoe-techenie-vaktsinatsii-btszh-u-detey-do-goda-s-ostrymi-leykozami-na-fone-khimioterapii/" ["~DETAIL_PAGE_URL"]=> string(147) "/en/archive/tom-11-nomer-2/klinicheskiy-sluchay/oslozhnennoe-techenie-vaktsinatsii-btszh-u-detey-do-goda-s-ostrymi-leykozami-na-fone-khimioterapii/" ["LIST_PAGE_URL"]=> string(12) "/en/archive/" ["~LIST_PAGE_URL"]=> string(12) "/en/archive/" ["DETAIL_TEXT"]=> string(14043) "

Introduction

According to the World Health Organization, the Russian Federation is among 30 countries with high tuberculosis burden. BCG vaccine has a proven protective effect against tuberculous meningitis and disseminated tuberculosis in children [1]. The Bacillus Calmette-Guérin (BCG) vaccine is produced from a live and attenuated strain of Mycobacterium bovis. In Russian Federation the primary BCG vaccination is mandatory for all newborns is at 3-7 days of life. Although vaccination with BCG is considered to be safe, it may cause regional (BCG-itis) and disseminated (BCG-osis) complications in immunocompromised host. As it is given early in life, some patients may receive the vaccine before some specific contraindications are revealed.

There is currently no systematic published data on complicated BCG vaccination in infants with acute leukemia. The term "infant leukemia" generally refers to acute lymphoblastic leukemia (ALL) diagnosed in patients younger than 1 or acute myeloid leukemia (AML) registered in children younger than 2 years [2].

We report 2 cases of children with infant acute leukemia developing BCG vaccination complications and demonstrate a possible therapeutic approach to this condition.

Case descriptions

Clinical case 1

A 1-month-old girl was admitted to R.M. Gorbacheva Children Research Institute in February 2020. She was a term neonate (birth weight 3.130 kg) born by normal vaginal delivery. The mother underwent regular prenatal check-ups revealing vaginal candidiasis and anemia of pregnancy. The patient received BCG-M vaccine on the 3^rd day of life. In February 2020, routine CBC performed in a 9-day-old neonate have shown a high WBC counts of 265×10⁹/l with 43% of blast cells in peripheral blood. The diagnosis of infant AML, FAB M4, ХХ t(2;11) with KMT2A rearrangement was established. At the time of the diagnosis the patient had no clinical signs of any disease. Patient received 1^st AM42E chemotherapy course according to AML-MRD 2018 protocol with a dose reduction due to young age and was then referred to R. M. Gorbacheva Children Research Institute for further treatment. Upon admission to the clinic on February 19^th 2020, the pancytopenia (Hb 69 g/l, Plt 2×10⁹/l, WBC 1.5×10⁹/l) and high serum C-reactive protein level (156 mg/l) were found, thus leading to diagnosis of febrile neutropenia. The examination on admission revealed skin hyperemia at the BCG-M vaccination site and elbow area of the arm (Fig. 1). Empirical therapy regimen consisting of meropenem, linezolid, and anidulafungin was administered.

The chest X-ray (Fig. 2) and computed tomography (Fig. 3) have been performed in order to find possible sings of generalized BCG infection did not yield any abnormal findings.

According to pediatric phthisiologist’s recommendation, isoniazid was administrated in order to control BCGitis symptoms and prevent the spread of BCG infection possible due to AML therapy-associated immunosuppression. Along with systemic therapy the local treatment consisting of dimexide lotion and hypertonic solution were used.

The signs of local BCGitis resolved after one month after treatment initiation.

In April 2020, the patient achieved complete remission with minimal residual disease persistence registered by flow cytometry. The child then received hAM chemotherapy regimen instead of FLAida, which should have been given according AML-MRD 2018 protocol, due to the risk of life-threatening generalized BCG-infection. By the end of May 2020, the patient was found to be COVID-19 infection PCR test-positive without clinical or CT signs of infection. In July 2020 he received 3 anti-Covid-19 convalescent plasma transfusions (10 ml/kg) due to prolonged SARS-CoV-2 persistence. The SARS-CoV-2 negative status was achieved after the second transfusion. Haploidentical allogeneic stem cell transplantation was performed on 24^th of July in complete remission. Conditioning regimen consisted of intraveneous busulfan (12 mg/kg) and fludarabin. Graft-versus-host disease prophylaxis included post-transplant cyclophosphamide, tacrolimus and everolimus. Engraftment was achieved on day +20. By June 2022 the patient has full donor chimerism, there are no signs of AML and no symptoms of BCG infection.

Clinical case 2

A 1-month-old girl was admitted to R.M. Gorbacheva Children Research Institute in August 2019. The child was born from the second pregnancy (second birth) by caesarean section. She received BCG-M vaccine on the 3^rd day of life. Then, as the child was one month old, the routine check-up revealed hepatosplenomegaly. The CBC have shown a high WBC count of 112×10⁹/l with 90% of blasts. Also 76.2% of lymphoblasts with CD45dim/SSClow/CD19+/CD38+/CD123+/CD10-/CD20-/CD22-/CD7-/CD117-/CD33-/CD13-/CD64-/CD15-/sIgM-/cytIgM-/MPO-/cytCD3-/cytCD79а+ immunophenotype were found in bone marrow, which corresponded to B-I ALL (EGIL). The blasts cytogenetics was characterized by chromosome rearrangements 46,XX,t(11;19)(q23;p13)[4]/46,XX[16]. The girl was enrolled in Interfant 2006 protocol with 2/3 dose reduction during remission induction due to young age at diagnosis. The hematological remission and MRD-negative status by flow cytometry and molecular biology test were achieved on day 36. She then proceeded to consolidation therapy (Protocol IB) starting on 17^th of September 2019. On day 5 of consolidation regimen the 9-mm upper left shoulder (BCGm vaccination site) infiltrate with central pustule appeared, although the child had not yet developed post-chemotherapy cytopenia. The regional lymph nodes were not enlarged. According to pediatric phthisiologist’s recommendation isoniazid was added to antimicrobial therapy regimen (already containing meropenem, linezolid and anidulofungin). The chemotherapy was suspended till BCGitis regression (de-evolution of pustules and crusts formation). After BCGitis resolved isoniazid treatment stopped due to hematological toxicity (agranulocytosis) development. An allogeneic hemopoietic stem cell transplantat from matched related donor was performed on 12^th of November 2019 with conditioning regimen consisting of intravenous busulfan (12 mg/kg) and fludarabin. The graft-versus-host disease prophylaxis was post-transplant cyclophosphamide-based. On day +27 post HSCT the MRD-negative remission with partial (40%) donor chimerism were registered. The patient received donor lymphocyte infusion in order to boost donor chimerism. Then, 1^st isolated bone marrow relapse was diagnosed on day +63. The patient received FLAG chemotherapy in January 2020. However in February 2020 ALL progression (75% of CD22-positive blasts in bone marrow) was confirmed. The 3 weekly inotuzumab ozogamicin infusions (0.8 mg/m², 0.5 mg/m², and 0.5 mg/m²) were administered leading to MRD-negative remission achievement on 5^th of March 2020. Then, on 16^th March 2020 the patient received a second allogeneic stem cell transplantation from haploidentical donor (father). Conditioning regimen consisted of treosulfan (36 g/m²) and fludarabin, the graft-versus-host disease prophylaxis included post-transplant cyclophosphamide and sirolimus. Engraftment was registered on day +17. The patient developed a Grade2 skin acute graft-versus-host disease successfully treated by glucocorticoids administration. By June 2022 she is alive, in remission, and retains full donor chimerism. The growth and development are normal.

Discussion

Adverse reactions to BCG vaccination are likely to be substantially underreported with only 1-10% of them being registered [3, 4]. These complications may be mild as well as severe. For the mild complications, e.g., cutaneous lesions (hyperemia, swelling, soreness, abscess formation, keloid and blister formation), the rate is estimated to be less than 1/1,000. Local ulceration at the vaccination site, suppurative lymphadenitis, osteitis, osteomyelitis, and disseminated BCG infection are severe complications, which occur in approximately two cases per 1 million of vaccinations [5].

Although BCG vaccination is contraindicated in patients with cancer, the majority of children are immunized at birth before the diagnosis is established. We describe two different cases of BCG vaccination complications, which may have very different pathogenesis. The first case demonstrates opportunistic BCG infection development in patient with profound cytopenia and immune deficiency. The second BCGitis case developed past CBC counts recovery and may be explained by immune reconstitution inflammatory syndrome. Immune reconstitution syndrome is usually presented in patients with HIV receiving highly active antiretroviral therapy (HAART) and is defined as paradoxical worsening of an opportunistic infection correlating with immune recovery [6]. This phenomenon is not unique to HAART recipients and has also been described in context of high-dose systemic steroids and chemotherapy withdrawal [7, 8].

There are currently no guidelines for anti-mycobacterial therapy and prophylaxis in infants with history of BCG vaccination at birth developing secondary immune deficiency due to hematological malignancy and chemotherapy. Also, different approaches are used to manage immune reconstitution syndrome-associated BCGitis, including surgical debridement, needle aspiration, steroids and anti-mycobacterial treatment. In some cases spontaneous resolution without intervention or antibiotics has occurred [9]. In our patients the BCGitis was successfully treated by chemotherapy suspension and combination of local and systemic antimycobacterial treatment.

Conflict of interests

None declared.

References

1. Global tuberculosis report, WHO 2020. Access: www.who.int/publications/i/item/9789240013131
2. Brown P. Treatment of infant leukemias: challenge and promise. Hematology Am Soc Hematol Educ Program. 2013;2013:596-600.
   doi: 10.1182/asheducation-2013.1.596
3. Lotte A, Wasz-Hockert O, Poisson N, Engbaek H, Landmann H, Quast U, et al. Second IUATLD study on complications induced by intradermal BCG-vaccination. Bull Int Union Tuberc Lung Dis. 1988; 63(2):47-59. PMID: 3066422
4. Lotte A, Wasz-Höckert O, Poisson N, Dumitrescu N, Verron M, Couvet E. BCG complications. Estimates of the risks among vaccinated subjects and statistical analysis of their main characteristics. Adv Tuberc Res. 1984;21:107-193. PMID: 6475644
5. Tural-Kara T, Ozdemir H, Erat T, Yahsi A, Ciftci E. Local Cutaneous complications after bacille Calmette-Guerin vaccine: Experience of a single center. Int J Clin Pediatr. 2017;6(3-4):37-41. doi: 10.14740/ijcp279w
6. Alexander A, Rode H. Adverse reactions to the Bacillus Calmette-Guerin vaccine in HIV-positive infants. J Pediatr Surg. 2007;42(3):549-552. doi: 10.1016/j.jpedsurg.2006.10.059
7. Barretto J, Wirk B. Early recognition of immune reconstitution inflammatory syndrome leads to avoidance of endotracheal intubation. World J Oncol. 2012;3(4):194-198. doi: 10.4021/wjon527w
8. Miceli MH, Maertens J, Buve K, Grazziutti M, Woods G, Rahman M, Barlogie B, et al. Immune reconstitution inflammatory syndrome in cancer patients with pulmonary aspergillosis recovering from neutropenia: Proof of principle, description, and clinical and research implications. Cancer. 2007;110(1):112-120. doi: 10.1002/cncr.22738
9. Puthanakit T, Oberdorfer P, Punjaisee S, Wannarit P, Sirisanthana T, Sirisanthana V. Immune reconstitution syndrome due to bacillus Calmette-Guérin after initiation of antiretroviral therapy in children with HIV infection. Clin Infect Dis. 2005;41(7):1049-1052.
   doi: 10.1086/433177

" ["~DETAIL_TEXT"]=> string(14043) "

Introduction

According to the World Health Organization, the Russian Federation is among 30 countries with high tuberculosis burden. BCG vaccine has a proven protective effect against tuberculous meningitis and disseminated tuberculosis in children [1]. The Bacillus Calmette-Guérin (BCG) vaccine is produced from a live and attenuated strain of Mycobacterium bovis. In Russian Federation the primary BCG vaccination is mandatory for all newborns is at 3-7 days of life. Although vaccination with BCG is considered to be safe, it may cause regional (BCG-itis) and disseminated (BCG-osis) complications in immunocompromised host. As it is given early in life, some patients may receive the vaccine before some specific contraindications are revealed.

There is currently no systematic published data on complicated BCG vaccination in infants with acute leukemia. The term "infant leukemia" generally refers to acute lymphoblastic leukemia (ALL) diagnosed in patients younger than 1 or acute myeloid leukemia (AML) registered in children younger than 2 years [2].

We report 2 cases of children with infant acute leukemia developing BCG vaccination complications and demonstrate a possible therapeutic approach to this condition.

Case descriptions

Clinical case 1

A 1-month-old girl was admitted to R.M. Gorbacheva Children Research Institute in February 2020. She was a term neonate (birth weight 3.130 kg) born by normal vaginal delivery. The mother underwent regular prenatal check-ups revealing vaginal candidiasis and anemia of pregnancy. The patient received BCG-M vaccine on the 3^rd day of life. In February 2020, routine CBC performed in a 9-day-old neonate have shown a high WBC counts of 265×10⁹/l with 43% of blast cells in peripheral blood. The diagnosis of infant AML, FAB M4, ХХ t(2;11) with KMT2A rearrangement was established. At the time of the diagnosis the patient had no clinical signs of any disease. Patient received 1^st AM42E chemotherapy course according to AML-MRD 2018 protocol with a dose reduction due to young age and was then referred to R. M. Gorbacheva Children Research Institute for further treatment. Upon admission to the clinic on February 19^th 2020, the pancytopenia (Hb 69 g/l, Plt 2×10⁹/l, WBC 1.5×10⁹/l) and high serum C-reactive protein level (156 mg/l) were found, thus leading to diagnosis of febrile neutropenia. The examination on admission revealed skin hyperemia at the BCG-M vaccination site and elbow area of the arm (Fig. 1). Empirical therapy regimen consisting of meropenem, linezolid, and anidulafungin was administered.

The chest X-ray (Fig. 2) and computed tomography (Fig. 3) have been performed in order to find possible sings of generalized BCG infection did not yield any abnormal findings.

According to pediatric phthisiologist’s recommendation, isoniazid was administrated in order to control BCGitis symptoms and prevent the spread of BCG infection possible due to AML therapy-associated immunosuppression. Along with systemic therapy the local treatment consisting of dimexide lotion and hypertonic solution were used.

The signs of local BCGitis resolved after one month after treatment initiation.

In April 2020, the patient achieved complete remission with minimal residual disease persistence registered by flow cytometry. The child then received hAM chemotherapy regimen instead of FLAida, which should have been given according AML-MRD 2018 protocol, due to the risk of life-threatening generalized BCG-infection. By the end of May 2020, the patient was found to be COVID-19 infection PCR test-positive without clinical or CT signs of infection. In July 2020 he received 3 anti-Covid-19 convalescent plasma transfusions (10 ml/kg) due to prolonged SARS-CoV-2 persistence. The SARS-CoV-2 negative status was achieved after the second transfusion. Haploidentical allogeneic stem cell transplantation was performed on 24^th of July in complete remission. Conditioning regimen consisted of intraveneous busulfan (12 mg/kg) and fludarabin. Graft-versus-host disease prophylaxis included post-transplant cyclophosphamide, tacrolimus and everolimus. Engraftment was achieved on day +20. By June 2022 the patient has full donor chimerism, there are no signs of AML and no symptoms of BCG infection.

Clinical case 2

A 1-month-old girl was admitted to R.M. Gorbacheva Children Research Institute in August 2019. The child was born from the second pregnancy (second birth) by caesarean section. She received BCG-M vaccine on the 3^rd day of life. Then, as the child was one month old, the routine check-up revealed hepatosplenomegaly. The CBC have shown a high WBC count of 112×10⁹/l with 90% of blasts. Also 76.2% of lymphoblasts with CD45dim/SSClow/CD19+/CD38+/CD123+/CD10-/CD20-/CD22-/CD7-/CD117-/CD33-/CD13-/CD64-/CD15-/sIgM-/cytIgM-/MPO-/cytCD3-/cytCD79а+ immunophenotype were found in bone marrow, which corresponded to B-I ALL (EGIL). The blasts cytogenetics was characterized by chromosome rearrangements 46,XX,t(11;19)(q23;p13)[4]/46,XX[16]. The girl was enrolled in Interfant 2006 protocol with 2/3 dose reduction during remission induction due to young age at diagnosis. The hematological remission and MRD-negative status by flow cytometry and molecular biology test were achieved on day 36. She then proceeded to consolidation therapy (Protocol IB) starting on 17^th of September 2019. On day 5 of consolidation regimen the 9-mm upper left shoulder (BCGm vaccination site) infiltrate with central pustule appeared, although the child had not yet developed post-chemotherapy cytopenia. The regional lymph nodes were not enlarged. According to pediatric phthisiologist’s recommendation isoniazid was added to antimicrobial therapy regimen (already containing meropenem, linezolid and anidulofungin). The chemotherapy was suspended till BCGitis regression (de-evolution of pustules and crusts formation). After BCGitis resolved isoniazid treatment stopped due to hematological toxicity (agranulocytosis) development. An allogeneic hemopoietic stem cell transplantat from matched related donor was performed on 12^th of November 2019 with conditioning regimen consisting of intravenous busulfan (12 mg/kg) and fludarabin. The graft-versus-host disease prophylaxis was post-transplant cyclophosphamide-based. On day +27 post HSCT the MRD-negative remission with partial (40%) donor chimerism were registered. The patient received donor lymphocyte infusion in order to boost donor chimerism. Then, 1^st isolated bone marrow relapse was diagnosed on day +63. The patient received FLAG chemotherapy in January 2020. However in February 2020 ALL progression (75% of CD22-positive blasts in bone marrow) was confirmed. The 3 weekly inotuzumab ozogamicin infusions (0.8 mg/m², 0.5 mg/m², and 0.5 mg/m²) were administered leading to MRD-negative remission achievement on 5^th of March 2020. Then, on 16^th March 2020 the patient received a second allogeneic stem cell transplantation from haploidentical donor (father). Conditioning regimen consisted of treosulfan (36 g/m²) and fludarabin, the graft-versus-host disease prophylaxis included post-transplant cyclophosphamide and sirolimus. Engraftment was registered on day +17. The patient developed a Grade2 skin acute graft-versus-host disease successfully treated by glucocorticoids administration. By June 2022 she is alive, in remission, and retains full donor chimerism. The growth and development are normal.

Discussion

Adverse reactions to BCG vaccination are likely to be substantially underreported with only 1-10% of them being registered [3, 4]. These complications may be mild as well as severe. For the mild complications, e.g., cutaneous lesions (hyperemia, swelling, soreness, abscess formation, keloid and blister formation), the rate is estimated to be less than 1/1,000. Local ulceration at the vaccination site, suppurative lymphadenitis, osteitis, osteomyelitis, and disseminated BCG infection are severe complications, which occur in approximately two cases per 1 million of vaccinations [5].

Although BCG vaccination is contraindicated in patients with cancer, the majority of children are immunized at birth before the diagnosis is established. We describe two different cases of BCG vaccination complications, which may have very different pathogenesis. The first case demonstrates opportunistic BCG infection development in patient with profound cytopenia and immune deficiency. The second BCGitis case developed past CBC counts recovery and may be explained by immune reconstitution inflammatory syndrome. Immune reconstitution syndrome is usually presented in patients with HIV receiving highly active antiretroviral therapy (HAART) and is defined as paradoxical worsening of an opportunistic infection correlating with immune recovery [6]. This phenomenon is not unique to HAART recipients and has also been described in context of high-dose systemic steroids and chemotherapy withdrawal [7, 8].

There are currently no guidelines for anti-mycobacterial therapy and prophylaxis in infants with history of BCG vaccination at birth developing secondary immune deficiency due to hematological malignancy and chemotherapy. Also, different approaches are used to manage immune reconstitution syndrome-associated BCGitis, including surgical debridement, needle aspiration, steroids and anti-mycobacterial treatment. In some cases spontaneous resolution without intervention or antibiotics has occurred [9]. In our patients the BCGitis was successfully treated by chemotherapy suspension and combination of local and systemic antimycobacterial treatment.

Conflict of interests

None declared.

References

1. Global tuberculosis report, WHO 2020. Access: www.who.int/publications/i/item/9789240013131
2. Brown P. Treatment of infant leukemias: challenge and promise. Hematology Am Soc Hematol Educ Program. 2013;2013:596-600.
   doi: 10.1182/asheducation-2013.1.596
3. Lotte A, Wasz-Hockert O, Poisson N, Engbaek H, Landmann H, Quast U, et al. Second IUATLD study on complications induced by intradermal BCG-vaccination. Bull Int Union Tuberc Lung Dis. 1988; 63(2):47-59. PMID: 3066422
4. Lotte A, Wasz-Höckert O, Poisson N, Dumitrescu N, Verron M, Couvet E. BCG complications. Estimates of the risks among vaccinated subjects and statistical analysis of their main characteristics. Adv Tuberc Res. 1984;21:107-193. PMID: 6475644
5. Tural-Kara T, Ozdemir H, Erat T, Yahsi A, Ciftci E. Local Cutaneous complications after bacille Calmette-Guerin vaccine: Experience of a single center. Int J Clin Pediatr. 2017;6(3-4):37-41. doi: 10.14740/ijcp279w
6. Alexander A, Rode H. Adverse reactions to the Bacillus Calmette-Guerin vaccine in HIV-positive infants. J Pediatr Surg. 2007;42(3):549-552. doi: 10.1016/j.jpedsurg.2006.10.059
7. Barretto J, Wirk B. Early recognition of immune reconstitution inflammatory syndrome leads to avoidance of endotracheal intubation. World J Oncol. 2012;3(4):194-198. doi: 10.4021/wjon527w
8. Miceli MH, Maertens J, Buve K, Grazziutti M, Woods G, Rahman M, Barlogie B, et al. Immune reconstitution inflammatory syndrome in cancer patients with pulmonary aspergillosis recovering from neutropenia: Proof of principle, description, and clinical and research implications. Cancer. 2007;110(1):112-120. doi: 10.1002/cncr.22738
9. Puthanakit T, Oberdorfer P, Punjaisee S, Wannarit P, Sirisanthana T, Sirisanthana V. Immune reconstitution syndrome due to bacillus Calmette-Guérin after initiation of antiretroviral therapy in children with HIV infection. Clin Infect Dis. 2005;41(7):1049-1052.
   doi: 10.1086/433177

" ["DETAIL_TEXT_TYPE"]=> string(4) "html" ["~DETAIL_TEXT_TYPE"]=> string(4) "html" ["PREVIEW_TEXT"]=> string(0) "" ["~PREVIEW_TEXT"]=> string(0) "" ["PREVIEW_TEXT_TYPE"]=> string(4) "text" ["~PREVIEW_TEXT_TYPE"]=> string(4) "text" ["PREVIEW_PICTURE"]=> NULL ["~PREVIEW_PICTURE"]=> NULL ["LANG_DIR"]=> string(4) "/ru/" ["~LANG_DIR"]=> string(4) "/ru/" ["SORT"]=> string(2) "10" ["~SORT"]=> string(2) "10" ["CODE"]=> string(98) "oslozhnennoe-techenie-vaktsinatsii-btszh-u-detey-do-goda-s-ostrymi-leykozami-na-fone-khimioterapii" ["~CODE"]=> string(98) "oslozhnennoe-techenie-vaktsinatsii-btszh-u-detey-do-goda-s-ostrymi-leykozami-na-fone-khimioterapii" ["EXTERNAL_ID"]=> string(4) "2062" ["~EXTERNAL_ID"]=> string(4) "2062" ["IBLOCK_TYPE_ID"]=> string(7) "journal" ["~IBLOCK_TYPE_ID"]=> string(7) "journal" ["IBLOCK_CODE"]=> string(7) "volumes" ["~IBLOCK_CODE"]=> string(7) "volumes" ["IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["~IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["LID"]=> string(2) "s2" ["~LID"]=> string(2) "s2" ["EDIT_LINK"]=> NULL ["DELETE_LINK"]=> NULL ["DISPLAY_ACTIVE_FROM"]=> string(0) "" ["IPROPERTY_VALUES"]=> array(18) { ["ELEMENT_META_TITLE"]=> string(169) "Осложненное течение вакцинации БЦЖ у детей до года с острыми лейкозами на фоне химиотерапии" ["ELEMENT_META_KEYWORDS"]=> string(0) "" ["ELEMENT_META_DESCRIPTION"]=> string(250) "Осложненное течение вакцинации БЦЖ у детей до года с острыми лейкозами на фоне химиотерапииComplicated BCG vaccination during chemotherapy in infant acute leukemia patients" ["ELEMENT_PREVIEW_PICTURE_FILE_ALT"]=> string(1610) "<p style="text-align: justify;">Осложненное течение вакцинации БЦЖ считается редким состоянием, однако иммунокомпрометированные пациенты, в том числе дети раннего возраста с гемобластозами на фоне химиотерапии, имеют высокий риск развития данного нежелательного явления. На сегодняшний день в литературе отсутствует информация о ведении осложненной вакцинации БЦЖ у пациентов с младенческим лейкозом. </p> <p style="text-align: justify;">Мы сообщаем о 2 случаях успешного лечения пациентов с младенческим лейкозом, у которых на фоне химиотерапии имелось осложненное течение вакцинации БЦЖ, и демонстрируем наш мультидисциплинарный терапевтический подход.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Острый миелоидный лейкоз, острый лимфобластный лейкоз, дети младшего возраста, БЦЖ-вакцинация, осложнения, аллогенная трансплантация гемопоэтических клеток. </p>" ["ELEMENT_PREVIEW_PICTURE_FILE_TITLE"]=> string(169) "Осложненное течение вакцинации БЦЖ у детей до года с острыми лейкозами на фоне химиотерапии" ["ELEMENT_DETAIL_PICTURE_FILE_ALT"]=> string(169) "Осложненное течение вакцинации БЦЖ у детей до года с острыми лейкозами на фоне химиотерапии" ["ELEMENT_DETAIL_PICTURE_FILE_TITLE"]=> string(169) "Осложненное течение вакцинации БЦЖ у детей до года с острыми лейкозами на фоне химиотерапии" ["SECTION_META_TITLE"]=> string(169) "Осложненное течение вакцинации БЦЖ у детей до года с острыми лейкозами на фоне химиотерапии" ["SECTION_META_KEYWORDS"]=> string(169) "Осложненное течение вакцинации БЦЖ у детей до года с острыми лейкозами на фоне химиотерапии" ["SECTION_META_DESCRIPTION"]=> string(169) "Осложненное течение вакцинации БЦЖ у детей до года с острыми лейкозами на фоне химиотерапии" ["SECTION_PICTURE_FILE_ALT"]=> string(169) "Осложненное течение вакцинации БЦЖ у детей до года с острыми лейкозами на фоне химиотерапии" ["SECTION_PICTURE_FILE_TITLE"]=> string(169) "Осложненное течение вакцинации БЦЖ у детей до года с острыми лейкозами на фоне химиотерапии" ["SECTION_PICTURE_FILE_NAME"]=> string(100) "oslozhnennoe-techenie-vaktsinatsii-btszh-u-detey-do-goda-s-ostrymi-leykozami-na-fone-khimioterapii-i" ["SECTION_DETAIL_PICTURE_FILE_ALT"]=> string(169) "Осложненное течение вакцинации БЦЖ у детей до года с острыми лейкозами на фоне химиотерапии" ["SECTION_DETAIL_PICTURE_FILE_TITLE"]=> string(169) "Осложненное течение вакцинации БЦЖ у детей до года с острыми лейкозами на фоне химиотерапии" ["SECTION_DETAIL_PICTURE_FILE_NAME"]=> string(100) "oslozhnennoe-techenie-vaktsinatsii-btszh-u-detey-do-goda-s-ostrymi-leykozami-na-fone-khimioterapii-i" ["ELEMENT_PREVIEW_PICTURE_FILE_NAME"]=> string(100) "oslozhnennoe-techenie-vaktsinatsii-btszh-u-detey-do-goda-s-ostrymi-leykozami-na-fone-khimioterapii-i" ["ELEMENT_DETAIL_PICTURE_FILE_NAME"]=> string(100) "oslozhnennoe-techenie-vaktsinatsii-btszh-u-detey-do-goda-s-ostrymi-leykozami-na-fone-khimioterapii-i" } ["FIELDS"]=> array(1) { ["IBLOCK_SECTION_ID"]=> string(3) "213" } ["PROPERTIES"]=> array(18) { ["KEYWORDS"]=> array(36) { ["ID"]=> string(2) "19" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:46:01" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(27) "Ключевые слова" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "KEYWORDS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "19" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "4" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "Y" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "Y" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(27) "Ключевые слова" ["~DEFAULT_VALUE"]=> string(0) "" } ["SUBMITTED"]=> array(36) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28650" ["VALUE"]=> string(22) "06/10/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "06/10/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL } ["ACCEPTED"]=> array(36) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28651" ["VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL } ["PUBLISHED"]=> array(36) { ["ID"]=> string(2) "22" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Дата публикации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "PUBLISHED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "22" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Дата публикации" ["~DEFAULT_VALUE"]=> NULL } ["CONTACT"]=> array(36) { ["ID"]=> string(2) "23" ["TIMESTAMP_X"]=> string(19) "2015-09-03 14:43:05" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(14) "Контакт" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "CONTACT" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "23" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(14) "Контакт" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHORS"]=> array(36) { ["ID"]=> string(2) "24" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:45:07" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "AUTHORS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "24" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_RU"]=> array(36) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28666" ["VALUE"]=> array(2) { ["TEXT"]=> string(368) "<p>Жемал З. Рахманова¹, Олеся В. Паина¹, Олеся С. Юдинцева¹, Анна А. Старшинова², Елена В. Семенова¹, Людмила С. Зубаровская¹</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(284) "

Жемал З. Рахманова¹, Олеся В. Паина¹, Олеся С. Юдинцева¹, Анна А. Старшинова², Елена В. Семенова¹, Людмила С. Зубаровская¹

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_RU"]=> array(36) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28667" ["VALUE"]=> array(2) { ["TEXT"]=> string(606) "<p>¹ НИИ детской онкологии, гематологии и трансплантологии им. Р. М. Горбачевой, Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия<br> ² Национальный медицинский исследовательский центр им. В. В. Алмазова, Санкт-Петербург, Россия</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(564) "

¹ НИИ детской онкологии, гематологии и трансплантологии им. Р. М. Горбачевой, Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия
² Национальный медицинский исследовательский центр им. В. В. Алмазова, Санкт-Петербург, Россия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_RU"]=> array(36) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28668" ["VALUE"]=> array(2) { ["TEXT"]=> string(1610) "<p style="text-align: justify;">Осложненное течение вакцинации БЦЖ считается редким состоянием, однако иммунокомпрометированные пациенты, в том числе дети раннего возраста с гемобластозами на фоне химиотерапии, имеют высокий риск развития данного нежелательного явления. На сегодняшний день в литературе отсутствует информация о ведении осложненной вакцинации БЦЖ у пациентов с младенческим лейкозом. </p> <p style="text-align: justify;">Мы сообщаем о 2 случаях успешного лечения пациентов с младенческим лейкозом, у которых на фоне химиотерапии имелось осложненное течение вакцинации БЦЖ, и демонстрируем наш мультидисциплинарный терапевтический подход.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Острый миелоидный лейкоз, острый лимфобластный лейкоз, дети младшего возраста, БЦЖ-вакцинация, осложнения, аллогенная трансплантация гемопоэтических клеток. </p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1532) "

Осложненное течение вакцинации БЦЖ считается редким состоянием, однако иммунокомпрометированные пациенты, в том числе дети раннего возраста с гемобластозами на фоне химиотерапии, имеют высокий риск развития данного нежелательного явления. На сегодняшний день в литературе отсутствует информация о ведении осложненной вакцинации БЦЖ у пациентов с младенческим лейкозом.

Мы сообщаем о 2 случаях успешного лечения пациентов с младенческим лейкозом, у которых на фоне химиотерапии имелось осложненное течение вакцинации БЦЖ, и демонстрируем наш мультидисциплинарный терапевтический подход.

Ключевые слова

Острый миелоидный лейкоз, острый лимфобластный лейкоз, дети младшего возраста, БЦЖ-вакцинация, осложнения, аллогенная трансплантация гемопоэтических клеток.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["DOI"]=> array(36) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28652" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-54-57" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-54-57" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_EN"]=> array(36) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28670" ["VALUE"]=> array(2) { ["TEXT"]=> string(287) "<p>Zhemal Z. Rakhmanova¹, Olesya V. Paina¹, Olesya S. Yudinceva¹, Anna A. Starshinova², Elena V. Semenova¹, Ludmila S. Zubarovskaya¹</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(203) "

Zhemal Z. Rakhmanova¹, Olesya V. Paina¹, Olesya S. Yudinceva¹, Anna A. Starshinova², Elena V. Semenova¹, Ludmila S. Zubarovskaya¹

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_EN"]=> array(36) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28671" ["VALUE"]=> array(2) { ["TEXT"]=> string(853) "<p>¹ RM Gorbacheva Research Institute of Pediatric Oncology, Hematology and Transplantology, Pavlov University, St. Petersburg, Russia<br> ² V.A. Almazov National Medical Research Center, St. Petersburg, Russia</p><br> <p><b>Correspondence:</b><br> Dr. Zhemal Z. Rakhmanova, RM Gorbacheva Research Institute of Pediatric Oncology, Hematology and Transplantology, L. Tolstoy St., 6-8, 197022, Pavlov University, St. Petersburg, Russia<br> Phone: +7 (999) 206-12-76<br> E-mail: rakhmanovazhemal@gmail.com</p><br> <p><b>Citation:</b> Rakhmanova ZZ, Paina OV, Yudinceva OS, et al. Complicated BCG vaccination during chemotherapy in infant acute leukemia patients. Cell Ther Transplant 2022; 11(2): 54-57.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(733) "

¹ RM Gorbacheva Research Institute of Pediatric Oncology, Hematology and Transplantology, Pavlov University, St. Petersburg, Russia
² V.A. Almazov National Medical Research Center, St. Petersburg, Russia

Correspondence:
Dr. Zhemal Z. Rakhmanova, RM Gorbacheva Research Institute of Pediatric Oncology, Hematology and Transplantology, L. Tolstoy St., 6-8, 197022, Pavlov University, St. Petersburg, Russia
Phone: +7 (999) 206-12-76
E-mail: rakhmanovazhemal@gmail.com

Citation: Rakhmanova ZZ, Paina OV, Yudinceva OS, et al. Complicated BCG vaccination during chemotherapy in infant acute leukemia patients. Cell Ther Transplant 2022; 11(2): 54-57.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_EN"]=> array(36) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28672" ["VALUE"]=> array(2) { ["TEXT"]=> string(772) "<p style="text-align: justify;">BCG vaccination complications, such as BCGitis and BCG-osis are relatively rare complications, which may occur in immunocompromised patients, including infants with hematological malignancies receiving chemotherapy. There is currently very few published data complicated BCG vaccination cases in infants with hematological malignancies. We report 2 children with infant acute leukemia developing BCG vaccination complications demonstrating a multidisciplinary therapeutic approach needed in these cases.</p> <h2>Keywords</h2> <p style="text-align: justify;">Acute myeloid leukemia, acute lymphoblastic leukemia, infants, BCG-itis, BCG-osis, allogeneic stem cell transplantation.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(716) "

BCG vaccination complications, such as BCGitis and BCG-osis are relatively rare complications, which may occur in immunocompromised patients, including infants with hematological malignancies receiving chemotherapy. There is currently very few published data complicated BCG vaccination cases in infants with hematological malignancies. We report 2 children with infant acute leukemia developing BCG vaccination complications demonstrating a multidisciplinary therapeutic approach needed in these cases.

Keywords

Acute myeloid leukemia, acute lymphoblastic leukemia, infants, BCG-itis, BCG-osis, allogeneic stem cell transplantation.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["NAME_EN"]=> array(36) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28653" ["VALUE"]=> string(81) "Complicated BCG vaccination during chemotherapy in infant acute leukemia patients" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(81) "Complicated BCG vaccination during chemotherapy in infant acute leukemia patients" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" } ["FULL_TEXT_RU"]=> array(36) { ["ID"]=> string(2) "42" ["TIMESTAMP_X"]=> string(19) "2015-09-07 20:29:18" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(23) "Полный текст" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(12) "FULL_TEXT_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "42" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(23) "Полный текст" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["PDF_RU"]=> array(36) { ["ID"]=> string(2) "43" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF RUS" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_RU" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "43" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28669" ["VALUE"]=> string(4) "2859" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2859" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF RUS" ["~DEFAULT_VALUE"]=> string(0) "" } ["PDF_EN"]=> array(36) { ["ID"]=> string(2) "44" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF ENG" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "44" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28673" ["VALUE"]=> string(4) "2860" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2860" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF ENG" ["~DEFAULT_VALUE"]=> string(0) "" } ["NAME_LONG"]=> array(36) { ["ID"]=> string(2) "45" ["TIMESTAMP_X"]=> string(19) "2023-04-13 00:55:00" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(72) "Название (для очень длинных заголовков)" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "NAME_LONG" ["DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "45" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(80) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(72) "Название (для очень длинных заголовков)" ["~DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } } } ["DISPLAY_PROPERTIES"]=> array(10) { ["AUTHOR_EN"]=> array(37) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28670" ["VALUE"]=> array(2) { ["TEXT"]=> string(287) "<p>Zhemal Z. Rakhmanova¹, Olesya V. Paina¹, Olesya S. Yudinceva¹, Anna A. Starshinova², Elena V. Semenova¹, Ludmila S. Zubarovskaya¹</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(203) "

Zhemal Z. Rakhmanova¹, Olesya V. Paina¹, Olesya S. Yudinceva¹, Anna A. Starshinova², Elena V. Semenova¹, Ludmila S. Zubarovskaya¹

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(203) "

Zhemal Z. Rakhmanova¹, Olesya V. Paina¹, Olesya S. Yudinceva¹, Anna A. Starshinova², Elena V. Semenova¹, Ludmila S. Zubarovskaya¹

" } ["SUMMARY_EN"]=> array(37) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28672" ["VALUE"]=> array(2) { ["TEXT"]=> string(772) "<p style="text-align: justify;">BCG vaccination complications, such as BCGitis and BCG-osis are relatively rare complications, which may occur in immunocompromised patients, including infants with hematological malignancies receiving chemotherapy. There is currently very few published data complicated BCG vaccination cases in infants with hematological malignancies. We report 2 children with infant acute leukemia developing BCG vaccination complications demonstrating a multidisciplinary therapeutic approach needed in these cases.</p> <h2>Keywords</h2> <p style="text-align: justify;">Acute myeloid leukemia, acute lymphoblastic leukemia, infants, BCG-itis, BCG-osis, allogeneic stem cell transplantation.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(716) "

BCG vaccination complications, such as BCGitis and BCG-osis are relatively rare complications, which may occur in immunocompromised patients, including infants with hematological malignancies receiving chemotherapy. There is currently very few published data complicated BCG vaccination cases in infants with hematological malignancies. We report 2 children with infant acute leukemia developing BCG vaccination complications demonstrating a multidisciplinary therapeutic approach needed in these cases.

Keywords

Acute myeloid leukemia, acute lymphoblastic leukemia, infants, BCG-itis, BCG-osis, allogeneic stem cell transplantation.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(716) "

BCG vaccination complications, such as BCGitis and BCG-osis are relatively rare complications, which may occur in immunocompromised patients, including infants with hematological malignancies receiving chemotherapy. There is currently very few published data complicated BCG vaccination cases in infants with hematological malignancies. We report 2 children with infant acute leukemia developing BCG vaccination complications demonstrating a multidisciplinary therapeutic approach needed in these cases.

Keywords

Acute myeloid leukemia, acute lymphoblastic leukemia, infants, BCG-itis, BCG-osis, allogeneic stem cell transplantation.

" } ["DOI"]=> array(37) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28652" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-54-57" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-54-57" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-54-57" } ["NAME_EN"]=> array(37) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28653" ["VALUE"]=> string(81) "Complicated BCG vaccination during chemotherapy in infant acute leukemia patients" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(81) "Complicated BCG vaccination during chemotherapy in infant acute leukemia patients" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(81) "Complicated BCG vaccination during chemotherapy in infant acute leukemia patients" } ["ORGANIZATION_EN"]=> array(37) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28671" ["VALUE"]=> array(2) { ["TEXT"]=> string(853) "<p>¹ RM Gorbacheva Research Institute of Pediatric Oncology, Hematology and Transplantology, Pavlov University, St. Petersburg, Russia<br> ² V.A. Almazov National Medical Research Center, St. Petersburg, Russia</p><br> <p><b>Correspondence:</b><br> Dr. Zhemal Z. Rakhmanova, RM Gorbacheva Research Institute of Pediatric Oncology, Hematology and Transplantology, L. Tolstoy St., 6-8, 197022, Pavlov University, St. Petersburg, Russia<br> Phone: +7 (999) 206-12-76<br> E-mail: rakhmanovazhemal@gmail.com</p><br> <p><b>Citation:</b> Rakhmanova ZZ, Paina OV, Yudinceva OS, et al. Complicated BCG vaccination during chemotherapy in infant acute leukemia patients. Cell Ther Transplant 2022; 11(2): 54-57.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(733) "

¹ RM Gorbacheva Research Institute of Pediatric Oncology, Hematology and Transplantology, Pavlov University, St. Petersburg, Russia
² V.A. Almazov National Medical Research Center, St. Petersburg, Russia

Correspondence:
Dr. Zhemal Z. Rakhmanova, RM Gorbacheva Research Institute of Pediatric Oncology, Hematology and Transplantology, L. Tolstoy St., 6-8, 197022, Pavlov University, St. Petersburg, Russia
Phone: +7 (999) 206-12-76
E-mail: rakhmanovazhemal@gmail.com

Citation: Rakhmanova ZZ, Paina OV, Yudinceva OS, et al. Complicated BCG vaccination during chemotherapy in infant acute leukemia patients. Cell Ther Transplant 2022; 11(2): 54-57.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(733) "

¹ RM Gorbacheva Research Institute of Pediatric Oncology, Hematology and Transplantology, Pavlov University, St. Petersburg, Russia
² V.A. Almazov National Medical Research Center, St. Petersburg, Russia

Correspondence:
Dr. Zhemal Z. Rakhmanova, RM Gorbacheva Research Institute of Pediatric Oncology, Hematology and Transplantology, L. Tolstoy St., 6-8, 197022, Pavlov University, St. Petersburg, Russia
Phone: +7 (999) 206-12-76
E-mail: rakhmanovazhemal@gmail.com

Citation: Rakhmanova ZZ, Paina OV, Yudinceva OS, et al. Complicated BCG vaccination during chemotherapy in infant acute leukemia patients. Cell Ther Transplant 2022; 11(2): 54-57.

" } ["AUTHOR_RU"]=> array(37) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28666" ["VALUE"]=> array(2) { ["TEXT"]=> string(368) "<p>Жемал З. Рахманова¹, Олеся В. Паина¹, Олеся С. Юдинцева¹, Анна А. Старшинова², Елена В. Семенова¹, Людмила С. Зубаровская¹</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(284) "

Жемал З. Рахманова¹, Олеся В. Паина¹, Олеся С. Юдинцева¹, Анна А. Старшинова², Елена В. Семенова¹, Людмила С. Зубаровская¹

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(284) "

Жемал З. Рахманова¹, Олеся В. Паина¹, Олеся С. Юдинцева¹, Анна А. Старшинова², Елена В. Семенова¹, Людмила С. Зубаровская¹

" } ["SUBMITTED"]=> array(37) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28650" ["VALUE"]=> string(22) "06/10/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "06/10/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "06/10/2022 12:00:00 am" } ["ACCEPTED"]=> array(37) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28651" ["VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "07/05/2022 12:00:00 am" } ["SUMMARY_RU"]=> array(37) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28668" ["VALUE"]=> array(2) { ["TEXT"]=> string(1610) "<p style="text-align: justify;">Осложненное течение вакцинации БЦЖ считается редким состоянием, однако иммунокомпрометированные пациенты, в том числе дети раннего возраста с гемобластозами на фоне химиотерапии, имеют высокий риск развития данного нежелательного явления. На сегодняшний день в литературе отсутствует информация о ведении осложненной вакцинации БЦЖ у пациентов с младенческим лейкозом. </p> <p style="text-align: justify;">Мы сообщаем о 2 случаях успешного лечения пациентов с младенческим лейкозом, у которых на фоне химиотерапии имелось осложненное течение вакцинации БЦЖ, и демонстрируем наш мультидисциплинарный терапевтический подход.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Острый миелоидный лейкоз, острый лимфобластный лейкоз, дети младшего возраста, БЦЖ-вакцинация, осложнения, аллогенная трансплантация гемопоэтических клеток. </p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1532) "

Осложненное течение вакцинации БЦЖ считается редким состоянием, однако иммунокомпрометированные пациенты, в том числе дети раннего возраста с гемобластозами на фоне химиотерапии, имеют высокий риск развития данного нежелательного явления. На сегодняшний день в литературе отсутствует информация о ведении осложненной вакцинации БЦЖ у пациентов с младенческим лейкозом.

Мы сообщаем о 2 случаях успешного лечения пациентов с младенческим лейкозом, у которых на фоне химиотерапии имелось осложненное течение вакцинации БЦЖ, и демонстрируем наш мультидисциплинарный терапевтический подход.

Ключевые слова

Острый миелоидный лейкоз, острый лимфобластный лейкоз, дети младшего возраста, БЦЖ-вакцинация, осложнения, аллогенная трансплантация гемопоэтических клеток.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(1532) "

Осложненное течение вакцинации БЦЖ считается редким состоянием, однако иммунокомпрометированные пациенты, в том числе дети раннего возраста с гемобластозами на фоне химиотерапии, имеют высокий риск развития данного нежелательного явления. На сегодняшний день в литературе отсутствует информация о ведении осложненной вакцинации БЦЖ у пациентов с младенческим лейкозом.

Мы сообщаем о 2 случаях успешного лечения пациентов с младенческим лейкозом, у которых на фоне химиотерапии имелось осложненное течение вакцинации БЦЖ, и демонстрируем наш мультидисциплинарный терапевтический подход.

Ключевые слова

Острый миелоидный лейкоз, острый лимфобластный лейкоз, дети младшего возраста, БЦЖ-вакцинация, осложнения, аллогенная трансплантация гемопоэтических клеток.

" } ["ORGANIZATION_RU"]=> array(37) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28667" ["VALUE"]=> array(2) { ["TEXT"]=> string(606) "<p>¹ НИИ детской онкологии, гематологии и трансплантологии им. Р. М. Горбачевой, Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия<br> ² Национальный медицинский исследовательский центр им. В. В. Алмазова, Санкт-Петербург, Россия</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(564) "

¹ НИИ детской онкологии, гематологии и трансплантологии им. Р. М. Горбачевой, Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия
² Национальный медицинский исследовательский центр им. В. В. Алмазова, Санкт-Петербург, Россия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(564) "

¹ НИИ детской онкологии, гематологии и трансплантологии им. Р. М. Горбачевой, Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия
² Национальный медицинский исследовательский центр им. В. В. Алмазова, Санкт-Петербург, Россия

" } } } [7]=> array(49) { ["IBLOCK_SECTION_ID"]=> string(3) "214" ["~IBLOCK_SECTION_ID"]=> string(3) "214" ["ID"]=> string(4) "2067" ["~ID"]=> string(4) "2067" ["IBLOCK_ID"]=> string(1) "2" ["~IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(204) "Перспективы использования радиомического анализа для дифференциальной диагностики новообразований челюстей" ["~NAME"]=> string(204) "Перспективы использования радиомического анализа для дифференциальной диагностики новообразований челюстей" ["ACTIVE_FROM"]=> NULL ["~ACTIVE_FROM"]=> NULL ["TIMESTAMP_X"]=> string(22) "08/11/2022 09:44:44 am" ["~TIMESTAMP_X"]=> string(22) "08/11/2022 09:44:44 am" ["DETAIL_PAGE_URL"]=> string(159) "/en/archive/tom-11-nomer-2/eksperimentalnye-issledovaniya/perspektivy-ispolzovaniya-radiomicheskogo-analiza-dlya-differentsialnoy-diagnostiki-novoobrazovaniy-/" ["~DETAIL_PAGE_URL"]=> string(159) "/en/archive/tom-11-nomer-2/eksperimentalnye-issledovaniya/perspektivy-ispolzovaniya-radiomicheskogo-analiza-dlya-differentsialnoy-diagnostiki-novoobrazovaniy-/" ["LIST_PAGE_URL"]=> string(12) "/en/archive/" ["~LIST_PAGE_URL"]=> string(12) "/en/archive/" ["DETAIL_TEXT"]=> string(15265) "

Introduction

Jaws host to a wide variety of cysts and neoplasms due to multiple tissues involved in tooth formation [1]. Numerous benign jaw tumors and several cysts of both odontogenic and nonodontogenic origin can exhibit a biologically aggressive course being incredibly challenging diagnostically [1, 2]. Clinical and radiographic findings of jaw lesions are often misleading and usually only the histologic examination can clarify the diagnosis [3]. Some jaw neoplasms have identic radiographic features and, conversely, some cysts can appear histologically identical and cannot be defined without radiographic findings[3]. The diagnosis of odontogenic lesions requires knowledge of a clinical and, especially, an associated radiographic features [3, 4]. But often it is necessary to have an idea about the nature of the formation already at the stage of X-ray study to have an opportunity to determine surgical tactics [5, 6].

Radiomics – "radi-" deriving from the science of radiology and "-omics" to indicate mapping of the human genome – is a rapidly evolving field providing non-invasive way to characterize tissues and organs using features extracted from standard-of-care medical imaging [7]. Radiomics is a quantitative imaging [7]. It implies the extraction of many features from medical images and its conversion to high-dimensional data [7, 8]. The main principle of radiomics is that pixels of an image and their relationships, contain information on phenotype, pathophysiology, and biology of a tissue [8]. In addition, we can extract hidden data from the medical image by using a quantitative analysis, thereby making the description of the radiograph more objective and entire. This idea is based on the theory that the signs obtained with the help of radiomics reflect the mechanisms that occur in formation at the genetic and molecular levels [9]. The goal of radiomics is to create a mathematical model and algorithm helping to analyze X-ray data and to characterize the pathophysiological features of the displayed tissues [9, 10].

To create such a model, one need to go through several stages [10]:

1. Clinical task definition – what information should we get from the image? (e.g. to determine a nature of the neoplasm).

2. Database creation. It is necessary to collect a database of medical images suitable for the clinical task (e. g. CBCT of patients with jaw neoplasms).

3. Working with images:
a. region of the interest (ROI) selection – it is necessary to select an area for radiomic features collection in all images, usually the area of the neoplasm.
b. radiomic features extraction – for each selected area in every image one should calculate its radiomic features (key features one can see in the Table 1).

4. Choosing of the most informative features from the full set of calculated.

5. Creating of the mathematical model based on the obtained signs. This model will predict the necessary sign – the type of tumor, the probability of malignancy, etc.

The field of radiomics has the significant potential for noninvasive differentiate of neoplasms [8, 10].

The aim of our study is to evaluate the possibility of using radiomic analysis in jaw neoplasms diagnostics.

Table 1. Summary of the most frequently used radiomic features

Materials and methods

Patients’ selection and examination

The study was performed in the Research Institute of Dentistry and Maxillofacial Surgery of the First Pavlov State Medical University in Saint Petersburg, Russia. We enrolled patients (N=23) showing the most common surgically assessed benign odontogenic jaw lesions. The basic requirement for enrollment was the presence of a radiologically visible osteolytic lesion of either uni- or multilocular configuration with or without an irregular outline. All patients underwent full clinical, radiological and pathological examination. An average median age of the patients was years, 12 of them were males and 11 were females. The diagnosis in all cases was confirmed by histologic examination, performed after surgical procedure. Morphological data are shown in the Table 2.

CBCT scans were taken with the Planmeca Romexis (Finland). Secondary reconstruction yielded multiplanar data sets allowing visualization of the pathologic process in axial, coronal and sagittal plane. DICOM (Digital Imaging and Communications in Medicine) data sets were exported and saved for each individual to provide data for image segmentation.

Region of the interest (ROI) selection

Image segmentation is a process of ROI definition from the background or neighboring structures. We used the open-source software 3D Slicer for jaw lesions segmentation, performing it in a semi-automatic way. Afterward, we accomplished manual segmentation to control and ensure correct segmentation. Jaw neoplasm segmentation on CT images was based on detecting differences in density – main group. For control measurements, a segmentation of a similar zone on the healthy side of the jaw was performed – control group.

Radiomic features extraction and selection

We used the comprehensive open-source platform PyRadiomics built into 3D Slicer for radiomic analysis. The interface of the software is designed for medical images analyzing and managing the radiological data. The software processes and extracts radiomic characteristics from medical images using a large panel of hard-coded function algorithms.

We computed, extracted, and analyzed 104 radiomic features of the studied areas. These features were divided into 6 main types: 11 non-texture, 18 first-order statistics, 24 gray-level co-occurrence matrix (GLCM), 14 gray level dependence matrix (GLDM), 16 gray-level run-length matrix (GLRLM), 16 gray-level size zone matrix, and 5 neighborhood gray tone difference matrix.

Specificity of their calculation imply cross-correlation of many of them. This can lead to interpretation errors due to multicollinearity. We used the forward stepwise selection method, adding and removing according to their significance, determined by a statistical test. We also excluded non-textural ones from the comparative analysis since the shape and size of the allocated control area were determined by the operator.

Statistical analyses

We preformed statistical analyses using the IBM SPSS 22.0 (SPSS Inc., Chicago, IL) statistical software. Having the matched sample with plenty of features with non-normally distributed differences we used Wilcoxon signed-rank test for a primary comparison of groups locations. We also calculated Pearson correlation coefficient as a measure of correlation between radiomic features and groups. P values < 0.05 were regarded as indicating statistical significance.

Results

After feature extraction and selection, we obtained a subset containing 9 texture features (Tab. 3). These ones showed the least cross-correlation having statistically significant relationship with the presence of the jaw lesion.

The significantly higher correlation of the median gray level intensity within the ROI definitely attracts attention (Fig. 1). Moreover, 54 out of 92 studied texture features have strong (R >0.7) or medium (0.5 < R < 0.7) correlation with "median". It is not surprising that stepwise logistic regression with forward selection gives us model with this only variable. This fact confirms known idea that X-ray jaw neoplasm diagnosis bases on density differences detecting.

Statistically significant differences other most informative features displayed in the Figure 2.

Table 3. Radiomic feature subset

Figure 2. Informative subset of radiomic features in the studied groups

Discussion

Preoperative x-ray analysis showed differences between jaw neoplasms, which can help in the differential diagnosis of jaw formations. After analysis, we found 9 texture features with significant differences between jaw lesions: median, uniformity, cluster shade, long run high gray level emphasis, size zone non uniformity, zone entropy, zone percentage, busyness and contrast.

Texture analysis has a potential application in the complex diagnosis of jaw neoplasms. Cystic lesions of the jaw are readily apparent on radiographs or CT, however subtle differences in internal components within the lesions are often difficult to assess quantitatively.

Texture analysis can complement histological findings and speed up treatment. Biopsy can often be uninformative because the inflammatory changes can be so extensive that it is difficult to distinguish them histologically from other cystic lesions without extensive additional tissue sampling to make a diagnosis. Non-invasive tissue analysis with texture analysis can provide more information and prevent additional invasive procedures. Texture analysis can extract mineable high-dimensional data from digital medical images and may aid in the identification and differentiation of various jaw lesions.

Conclusion

This pilot study demonstrates that differences in texture analysis features may help non-invasively differentiate several lesions of the jaw. This study adds to the limited previously published data and suggests a potentially novel image-based assessment of odontogenic cystic and lesions of the jaws, which can be considered as an adjunct to the diagnosis.

Radiomics is becoming increasingly more important in medical imaging. The progress of medical imaging data creates an environment ideal for machine-learning and data-based science.

Radiomics-based decision-support systems for precision diagnosis and treatment can be a powerful tool in modern medicine. Hence, the radiomic image analysis may effectively contribute to clinical decision-making and treatment management.

Conflict of interests

None reported.

References

1. Yang H, Jo E, Kim HJ, Cha IH, Jung YS, Nam W, et al. Deep learning for automated detection of cyst and tumors of the jaw in panoramic radiographs. J Clin Med. 2020; 9(6):1839. doi: 10.3390/jcm9061839
2. Tamiolakis P, Thermos G, Tosios KI, Sklavounou-Andrikopoulou A. Demographic and cinical characteristics of 5294 jaw cysts:
   A retrospective study of 38 years. Head Neck Pathol. 2019; 13(4):587-596. doi: 10.1007/s12105-019-01011-7
3. Yu D, Hu J, Feng Z, Song M, Zhu H. Deep learning based diagnosis for cysts and tumors of jaw with massive healthy samples. Sci Rep. 2022; 12(1):1855. doi: 10.1038/s41598-022-05913-5
4. Krishnamurthy A, Ramshankar V, Majhi U. Clear cell odontogenic carcinoma of the mandible and temporomandibuar joint with cervical lymph nodal metastasis. Natl J Maxillofac Surg. 2014;5(2):221-3. doi: 10.4103/0975-5950.154842
5. Lysenko AV, Razumova AY, Yaremenko AI, Mirzakhmedov RR. Augmented reality in the treatment of sialolithiasis. Stomatologiia. 2020;99(4):64-66. (In Russian). doi: 10.17116/stomat20209904164
6. Yaremenko АI, Lysenko AV, Ivanova EA, Galibin OV. Augmented reality technology for auricular reconstruction in the treatment of microtia. Cell Ther Transplant. 2020; 9(2): 78-82. doi: 10.18620/ctt-1866-8836-2020-9-2-78-82
7. Bianchi J, Gonçalves JR, Ruellas ACO, Vimort JB, Yatabe M, Paniagua B, et al. Software comparison to analyze bone radiomics from high resolution CBCT scans of mandibular condyles. Dentomaxillofac Radiol. 2019; 48(6):20190049. doi: 10.1259/dmfr.20190049
8. Lysenko AV, Yaremenko AI, Ivanov VM et al. Experience in the use of a radio-oriented augmented reality navigation system for biopsy of a neoplasm of the lower jaw. Cell Ther Transplant. 2021; 10(3-4): 78-83. doi: 10.18620/ctt-1866-8836-2021-10-3-4-78-83
9. Mukherjee P, Cintra M, Huang C, Zhou M, Zhu S, Colevas AD et al. CT-based radiomic signatures for predicting histopathologic features in head and neck squamous cell carcinoma. Radiol Imaging Cancer. 2020; 2(3):e190039. doi: 10.1148/rycan.2020190039
10. Alabi RO, Bello IO, Youssef O, Elmusrati M, Mäkitie AA, Almangush A. Utilizing deep machine learning for prognostication of oral squamous cell carcinoma-a systematic review. Front Oral Health. 2021;2:686863. doi: 10.3389/froh.2021.686863

" ["~DETAIL_TEXT"]=> string(15265) "

Introduction

Jaws host to a wide variety of cysts and neoplasms due to multiple tissues involved in tooth formation [1]. Numerous benign jaw tumors and several cysts of both odontogenic and nonodontogenic origin can exhibit a biologically aggressive course being incredibly challenging diagnostically [1, 2]. Clinical and radiographic findings of jaw lesions are often misleading and usually only the histologic examination can clarify the diagnosis [3]. Some jaw neoplasms have identic radiographic features and, conversely, some cysts can appear histologically identical and cannot be defined without radiographic findings[3]. The diagnosis of odontogenic lesions requires knowledge of a clinical and, especially, an associated radiographic features [3, 4]. But often it is necessary to have an idea about the nature of the formation already at the stage of X-ray study to have an opportunity to determine surgical tactics [5, 6].

Radiomics – "radi-" deriving from the science of radiology and "-omics" to indicate mapping of the human genome – is a rapidly evolving field providing non-invasive way to characterize tissues and organs using features extracted from standard-of-care medical imaging [7]. Radiomics is a quantitative imaging [7]. It implies the extraction of many features from medical images and its conversion to high-dimensional data [7, 8]. The main principle of radiomics is that pixels of an image and their relationships, contain information on phenotype, pathophysiology, and biology of a tissue [8]. In addition, we can extract hidden data from the medical image by using a quantitative analysis, thereby making the description of the radiograph more objective and entire. This idea is based on the theory that the signs obtained with the help of radiomics reflect the mechanisms that occur in formation at the genetic and molecular levels [9]. The goal of radiomics is to create a mathematical model and algorithm helping to analyze X-ray data and to characterize the pathophysiological features of the displayed tissues [9, 10].

To create such a model, one need to go through several stages [10]:

1. Clinical task definition – what information should we get from the image? (e.g. to determine a nature of the neoplasm).

2. Database creation. It is necessary to collect a database of medical images suitable for the clinical task (e. g. CBCT of patients with jaw neoplasms).

3. Working with images:
a. region of the interest (ROI) selection – it is necessary to select an area for radiomic features collection in all images, usually the area of the neoplasm.
b. radiomic features extraction – for each selected area in every image one should calculate its radiomic features (key features one can see in the Table 1).

4. Choosing of the most informative features from the full set of calculated.

5. Creating of the mathematical model based on the obtained signs. This model will predict the necessary sign – the type of tumor, the probability of malignancy, etc.

The field of radiomics has the significant potential for noninvasive differentiate of neoplasms [8, 10].

The aim of our study is to evaluate the possibility of using radiomic analysis in jaw neoplasms diagnostics.

Table 1. Summary of the most frequently used radiomic features

Materials and methods

Patients’ selection and examination

The study was performed in the Research Institute of Dentistry and Maxillofacial Surgery of the First Pavlov State Medical University in Saint Petersburg, Russia. We enrolled patients (N=23) showing the most common surgically assessed benign odontogenic jaw lesions. The basic requirement for enrollment was the presence of a radiologically visible osteolytic lesion of either uni- or multilocular configuration with or without an irregular outline. All patients underwent full clinical, radiological and pathological examination. An average median age of the patients was years, 12 of them were males and 11 were females. The diagnosis in all cases was confirmed by histologic examination, performed after surgical procedure. Morphological data are shown in the Table 2.

CBCT scans were taken with the Planmeca Romexis (Finland). Secondary reconstruction yielded multiplanar data sets allowing visualization of the pathologic process in axial, coronal and sagittal plane. DICOM (Digital Imaging and Communications in Medicine) data sets were exported and saved for each individual to provide data for image segmentation.

Region of the interest (ROI) selection

Image segmentation is a process of ROI definition from the background or neighboring structures. We used the open-source software 3D Slicer for jaw lesions segmentation, performing it in a semi-automatic way. Afterward, we accomplished manual segmentation to control and ensure correct segmentation. Jaw neoplasm segmentation on CT images was based on detecting differences in density – main group. For control measurements, a segmentation of a similar zone on the healthy side of the jaw was performed – control group.

Radiomic features extraction and selection

We used the comprehensive open-source platform PyRadiomics built into 3D Slicer for radiomic analysis. The interface of the software is designed for medical images analyzing and managing the radiological data. The software processes and extracts radiomic characteristics from medical images using a large panel of hard-coded function algorithms.

We computed, extracted, and analyzed 104 radiomic features of the studied areas. These features were divided into 6 main types: 11 non-texture, 18 first-order statistics, 24 gray-level co-occurrence matrix (GLCM), 14 gray level dependence matrix (GLDM), 16 gray-level run-length matrix (GLRLM), 16 gray-level size zone matrix, and 5 neighborhood gray tone difference matrix.

Specificity of their calculation imply cross-correlation of many of them. This can lead to interpretation errors due to multicollinearity. We used the forward stepwise selection method, adding and removing according to their significance, determined by a statistical test. We also excluded non-textural ones from the comparative analysis since the shape and size of the allocated control area were determined by the operator.

Statistical analyses

We preformed statistical analyses using the IBM SPSS 22.0 (SPSS Inc., Chicago, IL) statistical software. Having the matched sample with plenty of features with non-normally distributed differences we used Wilcoxon signed-rank test for a primary comparison of groups locations. We also calculated Pearson correlation coefficient as a measure of correlation between radiomic features and groups. P values < 0.05 were regarded as indicating statistical significance.

Results

After feature extraction and selection, we obtained a subset containing 9 texture features (Tab. 3). These ones showed the least cross-correlation having statistically significant relationship with the presence of the jaw lesion.

The significantly higher correlation of the median gray level intensity within the ROI definitely attracts attention (Fig. 1). Moreover, 54 out of 92 studied texture features have strong (R >0.7) or medium (0.5 < R < 0.7) correlation with "median". It is not surprising that stepwise logistic regression with forward selection gives us model with this only variable. This fact confirms known idea that X-ray jaw neoplasm diagnosis bases on density differences detecting.

Statistically significant differences other most informative features displayed in the Figure 2.

Table 3. Radiomic feature subset

Figure 2. Informative subset of radiomic features in the studied groups

Discussion

Preoperative x-ray analysis showed differences between jaw neoplasms, which can help in the differential diagnosis of jaw formations. After analysis, we found 9 texture features with significant differences between jaw lesions: median, uniformity, cluster shade, long run high gray level emphasis, size zone non uniformity, zone entropy, zone percentage, busyness and contrast.

Texture analysis has a potential application in the complex diagnosis of jaw neoplasms. Cystic lesions of the jaw are readily apparent on radiographs or CT, however subtle differences in internal components within the lesions are often difficult to assess quantitatively.

Texture analysis can complement histological findings and speed up treatment. Biopsy can often be uninformative because the inflammatory changes can be so extensive that it is difficult to distinguish them histologically from other cystic lesions without extensive additional tissue sampling to make a diagnosis. Non-invasive tissue analysis with texture analysis can provide more information and prevent additional invasive procedures. Texture analysis can extract mineable high-dimensional data from digital medical images and may aid in the identification and differentiation of various jaw lesions.

Conclusion

This pilot study demonstrates that differences in texture analysis features may help non-invasively differentiate several lesions of the jaw. This study adds to the limited previously published data and suggests a potentially novel image-based assessment of odontogenic cystic and lesions of the jaws, which can be considered as an adjunct to the diagnosis.

Radiomics is becoming increasingly more important in medical imaging. The progress of medical imaging data creates an environment ideal for machine-learning and data-based science.

Radiomics-based decision-support systems for precision diagnosis and treatment can be a powerful tool in modern medicine. Hence, the radiomic image analysis may effectively contribute to clinical decision-making and treatment management.

Conflict of interests

None reported.

References

1. Yang H, Jo E, Kim HJ, Cha IH, Jung YS, Nam W, et al. Deep learning for automated detection of cyst and tumors of the jaw in panoramic radiographs. J Clin Med. 2020; 9(6):1839. doi: 10.3390/jcm9061839
2. Tamiolakis P, Thermos G, Tosios KI, Sklavounou-Andrikopoulou A. Demographic and cinical characteristics of 5294 jaw cysts:
   A retrospective study of 38 years. Head Neck Pathol. 2019; 13(4):587-596. doi: 10.1007/s12105-019-01011-7
3. Yu D, Hu J, Feng Z, Song M, Zhu H. Deep learning based diagnosis for cysts and tumors of jaw with massive healthy samples. Sci Rep. 2022; 12(1):1855. doi: 10.1038/s41598-022-05913-5
4. Krishnamurthy A, Ramshankar V, Majhi U. Clear cell odontogenic carcinoma of the mandible and temporomandibuar joint with cervical lymph nodal metastasis. Natl J Maxillofac Surg. 2014;5(2):221-3. doi: 10.4103/0975-5950.154842
5. Lysenko AV, Razumova AY, Yaremenko AI, Mirzakhmedov RR. Augmented reality in the treatment of sialolithiasis. Stomatologiia. 2020;99(4):64-66. (In Russian). doi: 10.17116/stomat20209904164
6. Yaremenko АI, Lysenko AV, Ivanova EA, Galibin OV. Augmented reality technology for auricular reconstruction in the treatment of microtia. Cell Ther Transplant. 2020; 9(2): 78-82. doi: 10.18620/ctt-1866-8836-2020-9-2-78-82
7. Bianchi J, Gonçalves JR, Ruellas ACO, Vimort JB, Yatabe M, Paniagua B, et al. Software comparison to analyze bone radiomics from high resolution CBCT scans of mandibular condyles. Dentomaxillofac Radiol. 2019; 48(6):20190049. doi: 10.1259/dmfr.20190049
8. Lysenko AV, Yaremenko AI, Ivanov VM et al. Experience in the use of a radio-oriented augmented reality navigation system for biopsy of a neoplasm of the lower jaw. Cell Ther Transplant. 2021; 10(3-4): 78-83. doi: 10.18620/ctt-1866-8836-2021-10-3-4-78-83
9. Mukherjee P, Cintra M, Huang C, Zhou M, Zhu S, Colevas AD et al. CT-based radiomic signatures for predicting histopathologic features in head and neck squamous cell carcinoma. Radiol Imaging Cancer. 2020; 2(3):e190039. doi: 10.1148/rycan.2020190039
10. Alabi RO, Bello IO, Youssef O, Elmusrati M, Mäkitie AA, Almangush A. Utilizing deep machine learning for prognostication of oral squamous cell carcinoma-a systematic review. Front Oral Health. 2021;2:686863. doi: 10.3389/froh.2021.686863

" ["DETAIL_TEXT_TYPE"]=> string(4) "html" ["~DETAIL_TEXT_TYPE"]=> string(4) "html" ["PREVIEW_TEXT"]=> string(0) "" ["~PREVIEW_TEXT"]=> string(0) "" ["PREVIEW_TEXT_TYPE"]=> string(4) "text" ["~PREVIEW_TEXT_TYPE"]=> string(4) "text" ["PREVIEW_PICTURE"]=> NULL ["~PREVIEW_PICTURE"]=> NULL ["LANG_DIR"]=> string(4) "/ru/" ["~LANG_DIR"]=> string(4) "/ru/" ["SORT"]=> string(2) "40" ["~SORT"]=> string(2) "40" ["CODE"]=> string(100) "perspektivy-ispolzovaniya-radiomicheskogo-analiza-dlya-differentsialnoy-diagnostiki-novoobrazovaniy-" ["~CODE"]=> string(100) "perspektivy-ispolzovaniya-radiomicheskogo-analiza-dlya-differentsialnoy-diagnostiki-novoobrazovaniy-" ["EXTERNAL_ID"]=> string(4) "2067" ["~EXTERNAL_ID"]=> string(4) "2067" ["IBLOCK_TYPE_ID"]=> string(7) "journal" ["~IBLOCK_TYPE_ID"]=> string(7) "journal" ["IBLOCK_CODE"]=> string(7) "volumes" ["~IBLOCK_CODE"]=> string(7) "volumes" ["IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["~IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["LID"]=> string(2) "s2" ["~LID"]=> string(2) "s2" ["EDIT_LINK"]=> NULL ["DELETE_LINK"]=> NULL ["DISPLAY_ACTIVE_FROM"]=> string(0) "" ["IPROPERTY_VALUES"]=> array(18) { ["ELEMENT_META_TITLE"]=> string(204) "Перспективы использования радиомического анализа для дифференциальной диагностики новообразований челюстей" ["ELEMENT_META_KEYWORDS"]=> string(0) "" ["ELEMENT_META_DESCRIPTION"]=> string(281) "Перспективы использования радиомического анализа для дифференциальной диагностики новообразований челюстейPerspectives of radiomics analysis in differential diagnosis of jaw neoplasms" ["ELEMENT_PREVIEW_PICTURE_FILE_ALT"]=> string(2469) "<p style="text-align: justify;">Радиомика извлекает информацию из биомедицинских изображений, используя специальные алгоритмы характеристики данных. Эта информация – радиомические признаки – традиционно не измеряется в обычных радиологических изображениях. После преобразования их в математические модели их можно комбинировать с клиническими и гистологическими данными для построения прогностических моделей, упрощающих диагностику и выбор лечения. В нашем исследовании описан данный подход и его возможности в диагностике новообразований челюстей. Прогностический и прогностический потенциал радиомики в сочетании с клиническими данными может помочь в процессе принятия решений и может привести к индивидуальному хирургическому подходу при лечении новообразований челюстей. Этот метод имеет потенциал для более точной оценки, классификации, стратификации риска и управления лечением новообразований челюсти. Радиомика набирает популярность благодаря потенциальным приложениям для количественной оценки заболеваний, прогностического моделирования, планирования лечения и оценки ответа, что способствует развитию персонализированной медицины.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Радиомика, новообразования челюстей, компьютерная томография, прогностический биомаркер, прогностический индикатор.</p>" ["ELEMENT_PREVIEW_PICTURE_FILE_TITLE"]=> string(204) "Перспективы использования радиомического анализа для дифференциальной диагностики новообразований челюстей" ["ELEMENT_DETAIL_PICTURE_FILE_ALT"]=> string(204) "Перспективы использования радиомического анализа для дифференциальной диагностики новообразований челюстей" ["ELEMENT_DETAIL_PICTURE_FILE_TITLE"]=> string(204) "Перспективы использования радиомического анализа для дифференциальной диагностики новообразований челюстей" ["SECTION_META_TITLE"]=> string(204) "Перспективы использования радиомического анализа для дифференциальной диагностики новообразований челюстей" ["SECTION_META_KEYWORDS"]=> string(204) "Перспективы использования радиомического анализа для дифференциальной диагностики новообразований челюстей" ["SECTION_META_DESCRIPTION"]=> string(204) "Перспективы использования радиомического анализа для дифференциальной диагностики новообразований челюстей" ["SECTION_PICTURE_FILE_ALT"]=> string(204) "Перспективы использования радиомического анализа для дифференциальной диагностики новообразований челюстей" ["SECTION_PICTURE_FILE_TITLE"]=> string(204) "Перспективы использования радиомического анализа для дифференциальной диагностики новообразований челюстей" ["SECTION_PICTURE_FILE_NAME"]=> string(100) "perspektivy-ispolzovaniya-radiomicheskogo-analiza-dlya-differentsialnoy-diagnostiki-novoobrazovaniy-" ["SECTION_DETAIL_PICTURE_FILE_ALT"]=> string(204) "Перспективы использования радиомического анализа для дифференциальной диагностики новообразований челюстей" ["SECTION_DETAIL_PICTURE_FILE_TITLE"]=> string(204) "Перспективы использования радиомического анализа для дифференциальной диагностики новообразований челюстей" ["SECTION_DETAIL_PICTURE_FILE_NAME"]=> string(100) "perspektivy-ispolzovaniya-radiomicheskogo-analiza-dlya-differentsialnoy-diagnostiki-novoobrazovaniy-" ["ELEMENT_PREVIEW_PICTURE_FILE_NAME"]=> string(100) "perspektivy-ispolzovaniya-radiomicheskogo-analiza-dlya-differentsialnoy-diagnostiki-novoobrazovaniy-" ["ELEMENT_DETAIL_PICTURE_FILE_NAME"]=> string(100) "perspektivy-ispolzovaniya-radiomicheskogo-analiza-dlya-differentsialnoy-diagnostiki-novoobrazovaniy-" } ["FIELDS"]=> array(1) { ["IBLOCK_SECTION_ID"]=> string(3) "214" } ["PROPERTIES"]=> array(18) { ["KEYWORDS"]=> array(36) { ["ID"]=> string(2) "19" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:46:01" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(27) "Ключевые слова" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "KEYWORDS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "19" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "4" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "Y" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "Y" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(27) "Ключевые слова" ["~DEFAULT_VALUE"]=> string(0) "" } ["SUBMITTED"]=> array(36) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28710" ["VALUE"]=> string(22) "04/26/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "04/26/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL } ["ACCEPTED"]=> array(36) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28711" ["VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL } ["PUBLISHED"]=> array(36) { ["ID"]=> string(2) "22" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Дата публикации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "PUBLISHED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "22" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Дата публикации" ["~DEFAULT_VALUE"]=> NULL } ["CONTACT"]=> array(36) { ["ID"]=> string(2) "23" ["TIMESTAMP_X"]=> string(19) "2015-09-03 14:43:05" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(14) "Контакт" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "CONTACT" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "23" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(14) "Контакт" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHORS"]=> array(36) { ["ID"]=> string(2) "24" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:45:07" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "AUTHORS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "24" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_RU"]=> array(36) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28712" ["VALUE"]=> array(2) { ["TEXT"]=> string(365) "<p>Анна В. Лысенко¹, Андрей И. Яременко², Александр И. Любимов³, Владимир М. Иванов⁴, Роман Ю. Шипов⁴, Елизавета А. Иванова¹</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(281) "

Анна В. Лысенко¹, Андрей И. Яременко², Александр И. Любимов³, Владимир М. Иванов⁴, Роман Ю. Шипов⁴, Елизавета А. Иванова¹

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_RU"]=> array(36) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28713" ["VALUE"]=> array(2) { ["TEXT"]=> string(989) "<p>¹ Отдел челюстно-лицевой хирургии НИИ стоматологии и челюстно-лицевой хирургии, Санкт-Петербург, Россия<br> ² Кафедра челюстно-лицевой хирургии, Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия<br> ³ 1-е отделение усовершенствования хирургов, Военно-медицинская академия им. С.М. Кирова, Санкт-Петербург, Россия<br> ⁴ Санкт-Петербургский политехнический университет Петра Великого, Санкт-Петербург, Россия</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(911) "

¹ Отдел челюстно-лицевой хирургии НИИ стоматологии и челюстно-лицевой хирургии, Санкт-Петербург, Россия
² Кафедра челюстно-лицевой хирургии, Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия
³ 1-е отделение усовершенствования хирургов, Военно-медицинская академия им. С.М. Кирова, Санкт-Петербург, Россия
⁴ Санкт-Петербургский политехнический университет Петра Великого, Санкт-Петербург, Россия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_RU"]=> array(36) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28714" ["VALUE"]=> array(2) { ["TEXT"]=> string(2469) "<p style="text-align: justify;">Радиомика извлекает информацию из биомедицинских изображений, используя специальные алгоритмы характеристики данных. Эта информация – радиомические признаки – традиционно не измеряется в обычных радиологических изображениях. После преобразования их в математические модели их можно комбинировать с клиническими и гистологическими данными для построения прогностических моделей, упрощающих диагностику и выбор лечения. В нашем исследовании описан данный подход и его возможности в диагностике новообразований челюстей. Прогностический и прогностический потенциал радиомики в сочетании с клиническими данными может помочь в процессе принятия решений и может привести к индивидуальному хирургическому подходу при лечении новообразований челюстей. Этот метод имеет потенциал для более точной оценки, классификации, стратификации риска и управления лечением новообразований челюсти. Радиомика набирает популярность благодаря потенциальным приложениям для количественной оценки заболеваний, прогностического моделирования, планирования лечения и оценки ответа, что способствует развитию персонализированной медицины.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Радиомика, новообразования челюстей, компьютерная томография, прогностический биомаркер, прогностический индикатор.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(2413) "

Радиомика извлекает информацию из биомедицинских изображений, используя специальные алгоритмы характеристики данных. Эта информация – радиомические признаки – традиционно не измеряется в обычных радиологических изображениях. После преобразования их в математические модели их можно комбинировать с клиническими и гистологическими данными для построения прогностических моделей, упрощающих диагностику и выбор лечения. В нашем исследовании описан данный подход и его возможности в диагностике новообразований челюстей. Прогностический и прогностический потенциал радиомики в сочетании с клиническими данными может помочь в процессе принятия решений и может привести к индивидуальному хирургическому подходу при лечении новообразований челюстей. Этот метод имеет потенциал для более точной оценки, классификации, стратификации риска и управления лечением новообразований челюсти. Радиомика набирает популярность благодаря потенциальным приложениям для количественной оценки заболеваний, прогностического моделирования, планирования лечения и оценки ответа, что способствует развитию персонализированной медицины.

Ключевые слова

Радиомика, новообразования челюстей, компьютерная томография, прогностический биомаркер, прогностический индикатор.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["DOI"]=> array(36) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28715" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-93-98" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-93-98" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_EN"]=> array(36) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28718" ["VALUE"]=> array(2) { ["TEXT"]=> string(283) "<p>Anna V. Lysenko¹, Andrey I. Yaremenko², Aleksandr I. Lуubimov³, Vladimir M. Ivanov⁴, Roman U. Shipov⁴, Elizaveta A. Ivanova¹</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(199) "

Anna V. Lysenko¹, Andrey I. Yaremenko², Aleksandr I. Lуubimov³, Vladimir M. Ivanov⁴, Roman U. Shipov⁴, Elizaveta A. Ivanova¹

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_EN"]=> array(36) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28719" ["VALUE"]=> array(2) { ["TEXT"]=> string(1129) "<p>¹ Department of Maxillofacial Surgery, Research Institute of Dentistry and Maxillofacial Surgery, St. Petersburg, Russia<br> ² Department of Maxillofacial Surgery, Pavlov University, St. Petersburg, Russia<br> ³ 1^st Department for Surgeons’ Advanced Training, Kirov’s Military Medical Academy, St. Petersburg, Russia<br> ⁴ Peter the Great St. Petersburg Polytechnic University, St. Petersburg, Russia</p><br> <p><b>Correspondence:</b><br> Dr. Anna V. Lysenko, Department of Maxillofacial Surgery, Research Institute of Dentistry and Maxillofacial Surgery, Pavlov University, 44 Petrogradskaya Emb., 197101, St. Petersburg, Russia<br> Phone: +7 (812) 429-03-33<br> E-mail: lysenko.anna@mail.ru</p><br> <p><b>Citation:</b> Lysenko AV, Yaremenko AI, Lyubimov AI, et al. Perspectives of radiomics analysis in differential diagnosis of jaw neoplasms. Cell Ther Transplant 2022; 11(2): 93-98.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(961) "

¹ Department of Maxillofacial Surgery, Research Institute of Dentistry and Maxillofacial Surgery, St. Petersburg, Russia
² Department of Maxillofacial Surgery, Pavlov University, St. Petersburg, Russia
³ 1^st Department for Surgeons’ Advanced Training, Kirov’s Military Medical Academy, St. Petersburg, Russia
⁴ Peter the Great St. Petersburg Polytechnic University, St. Petersburg, Russia

Correspondence:
Dr. Anna V. Lysenko, Department of Maxillofacial Surgery, Research Institute of Dentistry and Maxillofacial Surgery, Pavlov University, 44 Petrogradskaya Emb., 197101, St. Petersburg, Russia
Phone: +7 (812) 429-03-33
E-mail: lysenko.anna@mail.ru

Citation: Lysenko AV, Yaremenko AI, Lyubimov AI, et al. Perspectives of radiomics analysis in differential diagnosis of jaw neoplasms. Cell Ther Transplant 2022; 11(2): 93-98.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_EN"]=> array(36) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28720" ["VALUE"]=> array(2) { ["TEXT"]=> string(1249) "<p style="text-align: justify;">Radiomics extracts information from biomedical images using specific data characterization algorithms. This information – radiomic features – is traditionally unmeasured in conventional radiological images. After converting them into mathematical models, one can combine them with clinical and histological data to build prediction models simplifying diagnosis and treatment selection. Our study describes this approach and its opportunities in jaws neoplasm diagnostics. The prognostic and predictive potential of radiomics, combined with clinical data, could help the decision-making process and could lead to individualized surgical approach for jaw neoplasm. This method has the potential of more accurately assessing, classifying, risk stratifying, and guiding the management of jaw neoplasm. Radiomics has been gaining popularity due to potential applications in disease quantification, predictive modeling, treatment planning, and response assessment – paving way for the advancement of personalized medicine.</p> <h2>Keywords</h2> <p style="text-align: justify;">Radiomics, jaw neoplasms, CT scan, predictive biomarker, prognostic indicator.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1193) "

Radiomics extracts information from biomedical images using specific data characterization algorithms. This information – radiomic features – is traditionally unmeasured in conventional radiological images. After converting them into mathematical models, one can combine them with clinical and histological data to build prediction models simplifying diagnosis and treatment selection. Our study describes this approach and its opportunities in jaws neoplasm diagnostics. The prognostic and predictive potential of radiomics, combined with clinical data, could help the decision-making process and could lead to individualized surgical approach for jaw neoplasm. This method has the potential of more accurately assessing, classifying, risk stratifying, and guiding the management of jaw neoplasm. Radiomics has been gaining popularity due to potential applications in disease quantification, predictive modeling, treatment planning, and response assessment – paving way for the advancement of personalized medicine.

Keywords

Radiomics, jaw neoplasms, CT scan, predictive biomarker, prognostic indicator.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["NAME_EN"]=> array(36) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28716" ["VALUE"]=> string(77) "Perspectives of radiomics analysis in differential diagnosis of jaw neoplasms" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(77) "Perspectives of radiomics analysis in differential diagnosis of jaw neoplasms" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" } ["FULL_TEXT_RU"]=> array(36) { ["ID"]=> string(2) "42" ["TIMESTAMP_X"]=> string(19) "2015-09-07 20:29:18" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(23) "Полный текст" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(12) "FULL_TEXT_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "42" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(23) "Полный текст" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["PDF_RU"]=> array(36) { ["ID"]=> string(2) "43" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF RUS" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_RU" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "43" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28717" ["VALUE"]=> string(4) "2894" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2894" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF RUS" ["~DEFAULT_VALUE"]=> string(0) "" } ["PDF_EN"]=> array(36) { ["ID"]=> string(2) "44" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF ENG" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "44" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28721" ["VALUE"]=> string(4) "2895" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2895" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF ENG" ["~DEFAULT_VALUE"]=> string(0) "" } ["NAME_LONG"]=> array(36) { ["ID"]=> string(2) "45" ["TIMESTAMP_X"]=> string(19) "2023-04-13 00:55:00" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(72) "Название (для очень длинных заголовков)" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "NAME_LONG" ["DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "45" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(80) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(72) "Название (для очень длинных заголовков)" ["~DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } } } ["DISPLAY_PROPERTIES"]=> array(10) { ["AUTHOR_EN"]=> array(37) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28718" ["VALUE"]=> array(2) { ["TEXT"]=> string(283) "<p>Anna V. Lysenko¹, Andrey I. Yaremenko², Aleksandr I. Lуubimov³, Vladimir M. Ivanov⁴, Roman U. Shipov⁴, Elizaveta A. Ivanova¹</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(199) "

Anna V. Lysenko¹, Andrey I. Yaremenko², Aleksandr I. Lуubimov³, Vladimir M. Ivanov⁴, Roman U. Shipov⁴, Elizaveta A. Ivanova¹

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(199) "

Anna V. Lysenko¹, Andrey I. Yaremenko², Aleksandr I. Lуubimov³, Vladimir M. Ivanov⁴, Roman U. Shipov⁴, Elizaveta A. Ivanova¹

" } ["SUMMARY_EN"]=> array(37) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28720" ["VALUE"]=> array(2) { ["TEXT"]=> string(1249) "<p style="text-align: justify;">Radiomics extracts information from biomedical images using specific data characterization algorithms. This information – radiomic features – is traditionally unmeasured in conventional radiological images. After converting them into mathematical models, one can combine them with clinical and histological data to build prediction models simplifying diagnosis and treatment selection. Our study describes this approach and its opportunities in jaws neoplasm diagnostics. The prognostic and predictive potential of radiomics, combined with clinical data, could help the decision-making process and could lead to individualized surgical approach for jaw neoplasm. This method has the potential of more accurately assessing, classifying, risk stratifying, and guiding the management of jaw neoplasm. Radiomics has been gaining popularity due to potential applications in disease quantification, predictive modeling, treatment planning, and response assessment – paving way for the advancement of personalized medicine.</p> <h2>Keywords</h2> <p style="text-align: justify;">Radiomics, jaw neoplasms, CT scan, predictive biomarker, prognostic indicator.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1193) "

Radiomics extracts information from biomedical images using specific data characterization algorithms. This information – radiomic features – is traditionally unmeasured in conventional radiological images. After converting them into mathematical models, one can combine them with clinical and histological data to build prediction models simplifying diagnosis and treatment selection. Our study describes this approach and its opportunities in jaws neoplasm diagnostics. The prognostic and predictive potential of radiomics, combined with clinical data, could help the decision-making process and could lead to individualized surgical approach for jaw neoplasm. This method has the potential of more accurately assessing, classifying, risk stratifying, and guiding the management of jaw neoplasm. Radiomics has been gaining popularity due to potential applications in disease quantification, predictive modeling, treatment planning, and response assessment – paving way for the advancement of personalized medicine.

Keywords

Radiomics, jaw neoplasms, CT scan, predictive biomarker, prognostic indicator.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(1193) "

Radiomics extracts information from biomedical images using specific data characterization algorithms. This information – radiomic features – is traditionally unmeasured in conventional radiological images. After converting them into mathematical models, one can combine them with clinical and histological data to build prediction models simplifying diagnosis and treatment selection. Our study describes this approach and its opportunities in jaws neoplasm diagnostics. The prognostic and predictive potential of radiomics, combined with clinical data, could help the decision-making process and could lead to individualized surgical approach for jaw neoplasm. This method has the potential of more accurately assessing, classifying, risk stratifying, and guiding the management of jaw neoplasm. Radiomics has been gaining popularity due to potential applications in disease quantification, predictive modeling, treatment planning, and response assessment – paving way for the advancement of personalized medicine.

Keywords

Radiomics, jaw neoplasms, CT scan, predictive biomarker, prognostic indicator.

" } ["DOI"]=> array(37) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28715" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-93-98" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-93-98" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-93-98" } ["NAME_EN"]=> array(37) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28716" ["VALUE"]=> string(77) "Perspectives of radiomics analysis in differential diagnosis of jaw neoplasms" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(77) "Perspectives of radiomics analysis in differential diagnosis of jaw neoplasms" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(77) "Perspectives of radiomics analysis in differential diagnosis of jaw neoplasms" } ["ORGANIZATION_EN"]=> array(37) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28719" ["VALUE"]=> array(2) { ["TEXT"]=> string(1129) "<p>¹ Department of Maxillofacial Surgery, Research Institute of Dentistry and Maxillofacial Surgery, St. Petersburg, Russia<br> ² Department of Maxillofacial Surgery, Pavlov University, St. Petersburg, Russia<br> ³ 1^st Department for Surgeons’ Advanced Training, Kirov’s Military Medical Academy, St. Petersburg, Russia<br> ⁴ Peter the Great St. Petersburg Polytechnic University, St. Petersburg, Russia</p><br> <p><b>Correspondence:</b><br> Dr. Anna V. Lysenko, Department of Maxillofacial Surgery, Research Institute of Dentistry and Maxillofacial Surgery, Pavlov University, 44 Petrogradskaya Emb., 197101, St. Petersburg, Russia<br> Phone: +7 (812) 429-03-33<br> E-mail: lysenko.anna@mail.ru</p><br> <p><b>Citation:</b> Lysenko AV, Yaremenko AI, Lyubimov AI, et al. Perspectives of radiomics analysis in differential diagnosis of jaw neoplasms. Cell Ther Transplant 2022; 11(2): 93-98.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(961) "

¹ Department of Maxillofacial Surgery, Research Institute of Dentistry and Maxillofacial Surgery, St. Petersburg, Russia
² Department of Maxillofacial Surgery, Pavlov University, St. Petersburg, Russia
³ 1^st Department for Surgeons’ Advanced Training, Kirov’s Military Medical Academy, St. Petersburg, Russia
⁴ Peter the Great St. Petersburg Polytechnic University, St. Petersburg, Russia

Correspondence:
Dr. Anna V. Lysenko, Department of Maxillofacial Surgery, Research Institute of Dentistry and Maxillofacial Surgery, Pavlov University, 44 Petrogradskaya Emb., 197101, St. Petersburg, Russia
Phone: +7 (812) 429-03-33
E-mail: lysenko.anna@mail.ru

Citation: Lysenko AV, Yaremenko AI, Lyubimov AI, et al. Perspectives of radiomics analysis in differential diagnosis of jaw neoplasms. Cell Ther Transplant 2022; 11(2): 93-98.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(961) "

¹ Department of Maxillofacial Surgery, Research Institute of Dentistry and Maxillofacial Surgery, St. Petersburg, Russia
² Department of Maxillofacial Surgery, Pavlov University, St. Petersburg, Russia
³ 1^st Department for Surgeons’ Advanced Training, Kirov’s Military Medical Academy, St. Petersburg, Russia
⁴ Peter the Great St. Petersburg Polytechnic University, St. Petersburg, Russia

Correspondence:
Dr. Anna V. Lysenko, Department of Maxillofacial Surgery, Research Institute of Dentistry and Maxillofacial Surgery, Pavlov University, 44 Petrogradskaya Emb., 197101, St. Petersburg, Russia
Phone: +7 (812) 429-03-33
E-mail: lysenko.anna@mail.ru

Citation: Lysenko AV, Yaremenko AI, Lyubimov AI, et al. Perspectives of radiomics analysis in differential diagnosis of jaw neoplasms. Cell Ther Transplant 2022; 11(2): 93-98.

" } ["AUTHOR_RU"]=> array(37) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28712" ["VALUE"]=> array(2) { ["TEXT"]=> string(365) "<p>Анна В. Лысенко¹, Андрей И. Яременко², Александр И. Любимов³, Владимир М. Иванов⁴, Роман Ю. Шипов⁴, Елизавета А. Иванова¹</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(281) "

Анна В. Лысенко¹, Андрей И. Яременко², Александр И. Любимов³, Владимир М. Иванов⁴, Роман Ю. Шипов⁴, Елизавета А. Иванова¹

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(281) "

Анна В. Лысенко¹, Андрей И. Яременко², Александр И. Любимов³, Владимир М. Иванов⁴, Роман Ю. Шипов⁴, Елизавета А. Иванова¹

" } ["SUBMITTED"]=> array(37) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28710" ["VALUE"]=> string(22) "04/26/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "04/26/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "04/26/2022 12:00:00 am" } ["ACCEPTED"]=> array(37) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28711" ["VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "06/24/2022 12:00:00 am" } ["SUMMARY_RU"]=> array(37) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28714" ["VALUE"]=> array(2) { ["TEXT"]=> string(2469) "<p style="text-align: justify;">Радиомика извлекает информацию из биомедицинских изображений, используя специальные алгоритмы характеристики данных. Эта информация – радиомические признаки – традиционно не измеряется в обычных радиологических изображениях. После преобразования их в математические модели их можно комбинировать с клиническими и гистологическими данными для построения прогностических моделей, упрощающих диагностику и выбор лечения. В нашем исследовании описан данный подход и его возможности в диагностике новообразований челюстей. Прогностический и прогностический потенциал радиомики в сочетании с клиническими данными может помочь в процессе принятия решений и может привести к индивидуальному хирургическому подходу при лечении новообразований челюстей. Этот метод имеет потенциал для более точной оценки, классификации, стратификации риска и управления лечением новообразований челюсти. Радиомика набирает популярность благодаря потенциальным приложениям для количественной оценки заболеваний, прогностического моделирования, планирования лечения и оценки ответа, что способствует развитию персонализированной медицины.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Радиомика, новообразования челюстей, компьютерная томография, прогностический биомаркер, прогностический индикатор.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(2413) "

Радиомика извлекает информацию из биомедицинских изображений, используя специальные алгоритмы характеристики данных. Эта информация – радиомические признаки – традиционно не измеряется в обычных радиологических изображениях. После преобразования их в математические модели их можно комбинировать с клиническими и гистологическими данными для построения прогностических моделей, упрощающих диагностику и выбор лечения. В нашем исследовании описан данный подход и его возможности в диагностике новообразований челюстей. Прогностический и прогностический потенциал радиомики в сочетании с клиническими данными может помочь в процессе принятия решений и может привести к индивидуальному хирургическому подходу при лечении новообразований челюстей. Этот метод имеет потенциал для более точной оценки, классификации, стратификации риска и управления лечением новообразований челюсти. Радиомика набирает популярность благодаря потенциальным приложениям для количественной оценки заболеваний, прогностического моделирования, планирования лечения и оценки ответа, что способствует развитию персонализированной медицины.

Ключевые слова

Радиомика, новообразования челюстей, компьютерная томография, прогностический биомаркер, прогностический индикатор.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(2413) "

Радиомика извлекает информацию из биомедицинских изображений, используя специальные алгоритмы характеристики данных. Эта информация – радиомические признаки – традиционно не измеряется в обычных радиологических изображениях. После преобразования их в математические модели их можно комбинировать с клиническими и гистологическими данными для построения прогностических моделей, упрощающих диагностику и выбор лечения. В нашем исследовании описан данный подход и его возможности в диагностике новообразований челюстей. Прогностический и прогностический потенциал радиомики в сочетании с клиническими данными может помочь в процессе принятия решений и может привести к индивидуальному хирургическому подходу при лечении новообразований челюстей. Этот метод имеет потенциал для более точной оценки, классификации, стратификации риска и управления лечением новообразований челюсти. Радиомика набирает популярность благодаря потенциальным приложениям для количественной оценки заболеваний, прогностического моделирования, планирования лечения и оценки ответа, что способствует развитию персонализированной медицины.

Ключевые слова

Радиомика, новообразования челюстей, компьютерная томография, прогностический биомаркер, прогностический индикатор.

" } ["ORGANIZATION_RU"]=> array(37) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28713" ["VALUE"]=> array(2) { ["TEXT"]=> string(989) "<p>¹ Отдел челюстно-лицевой хирургии НИИ стоматологии и челюстно-лицевой хирургии, Санкт-Петербург, Россия<br> ² Кафедра челюстно-лицевой хирургии, Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия<br> ³ 1-е отделение усовершенствования хирургов, Военно-медицинская академия им. С.М. Кирова, Санкт-Петербург, Россия<br> ⁴ Санкт-Петербургский политехнический университет Петра Великого, Санкт-Петербург, Россия</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(911) "

¹ Отдел челюстно-лицевой хирургии НИИ стоматологии и челюстно-лицевой хирургии, Санкт-Петербург, Россия
² Кафедра челюстно-лицевой хирургии, Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия
³ 1-е отделение усовершенствования хирургов, Военно-медицинская академия им. С.М. Кирова, Санкт-Петербург, Россия
⁴ Санкт-Петербургский политехнический университет Петра Великого, Санкт-Петербург, Россия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(911) "

¹ Отдел челюстно-лицевой хирургии НИИ стоматологии и челюстно-лицевой хирургии, Санкт-Петербург, Россия
² Кафедра челюстно-лицевой хирургии, Первый Санкт-Петербургский государственный медицинский университет им. акад. И. П. Павлова, Санкт-Петербург, Россия
³ 1-е отделение усовершенствования хирургов, Военно-медицинская академия им. С.М. Кирова, Санкт-Петербург, Россия
⁴ Санкт-Петербургский политехнический университет Петра Великого, Санкт-Петербург, Россия

" } } } [8]=> array(49) { ["IBLOCK_SECTION_ID"]=> string(3) "214" ["~IBLOCK_SECTION_ID"]=> string(3) "214" ["ID"]=> string(4) "2068" ["~ID"]=> string(4) "2068" ["IBLOCK_ID"]=> string(1) "2" ["~IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(162) "Подавление in vitro пролиферации и миграции клеток линии MDA-MB-231 новыми производными тиазола" ["~NAME"]=> string(162) "Подавление in vitro пролиферации и миграции клеток линии MDA-MB-231 новыми производными тиазола" ["ACTIVE_FROM"]=> NULL ["~ACTIVE_FROM"]=> NULL ["TIMESTAMP_X"]=> string(22) "08/11/2022 10:54:25 am" ["~TIMESTAMP_X"]=> string(22) "08/11/2022 10:54:25 am" ["DETAIL_PAGE_URL"]=> string(156) "/en/archive/tom-11-nomer-2/eksperimentalnye-issledovaniya/podavlenie-in-vitro-proliferatsii-i-migratsii-kletok-linii-mda-mb-231-novymi-proizvodnymi-tiazola/" ["~DETAIL_PAGE_URL"]=> string(156) "/en/archive/tom-11-nomer-2/eksperimentalnye-issledovaniya/podavlenie-in-vitro-proliferatsii-i-migratsii-kletok-linii-mda-mb-231-novymi-proizvodnymi-tiazola/" ["LIST_PAGE_URL"]=> string(12) "/en/archive/" ["~LIST_PAGE_URL"]=> string(12) "/en/archive/" ["DETAIL_TEXT"]=> string(27128) "

Introduction

Breast cancer is the most common cancer among women and a leading cause of cancer death worldwide. In 2020, for the first time, breast cancer has overtaken lung cancer as the most common malignancy, representing 11.7% of all cancer cases worldwide – according to the International Agency for Research on Cancer (IARC) [1]. Since metastatic diseases accounts for more than 90% of mortality in this cancer, the treatment is complemented with drugs that inhibiting the capacity of cancer cells to invade through the extracellular matrix (ECM) and establish secondary tumors [2]. Breast cancer is a heterogeneous disease with several biological subtypes. E.g., TNBC, triple-negative breast cancer, is the most aggressive subtype of breast cancer and known for its high recurrence rates. Thus, the mortality rate is higher in TNBC patients than among patients with other types of breast cancer [3].

Common therapeutic options are limited for TNBC, as neither hormone therapy nor HER2 targeting drugs do not work. The response to available antitumor drugs is gradually decreasing among patients with metastatic breast cancer, possibly due to the tumor’s resistance to a wide range of cancer drugs [3]. Additionally, most antitumor agents exhibit high toxicity [4]. In order to decrease toxicity levels of breast cancer treatment and increasing patients’ survival rates, a search for researchers are working to develop more safe and selective anticancer drugs is underway [3, 5].

Thiazole derivatives have been reported to inhibit cancer cell growth and proliferation as well as neoangiogenesis through a variety of mechanisms and therapeutic targets [6]. E.g., incorporation of thiazole ring into different molecules have demonstrated a promising approach to design more potent and safer antitumor drugs [5]. Modifications on aminothiazole were found to cause antitumor activity against particular cell lines [7]. Adding an aromatic ring to 1,3-thiazole-2-amines provided a tubulin inhibitor with potent antiproliferative activity [8]. A series of substituted benzaldehydes exerted an inhibitory effect of MDA-MB-231 cell migration and proliferation [9]. Imidazolidine-2,4-dione moiety exhibited a potent anticancer activity [10].

Due to the known antioxidant effect, we tested the effect of 5-nitro-1,3-thiazol-2-amine (compound 1), on the growth and the migration of MDA-MB-231 cell line. Moreover, we used it as initial compound for structural modifications. According to Rockwell et al. study, the nitro heterocyclic compound 2-amino-5-nitrothiazole (ANT) was evaluated as a hypoxic radiosensitizer. Experiments with bacteria showed that this agent was similar to misonidazole in radiosensitizing activity, but was less cytotoxic and less mutagenic than misonidazole [11].

Compound2, 4-{(E)-[(5-nitro-1,3-thiazol-2-yl)imino]methyl}benzaldehyde, was prepared by adding benzaldehyde group in compound 1 structure. Compound 3, (5E)-5-(4-{(E)-[(5-nitro-1,3-thiazol-2-yl)imino]methyl}benzylidene)imidazolidine-2,4-dione, was prepared by addition of Imi- dazolidine-2,4-dione moiety (Fig. 1).

Figure 1. Chemical structures for compounds 1, 2, and 3

The heterocycles constitute a common structural unit of most marketed drugs, thus drawing special attention to molecules containing sulfur heterocycles [5]. Thiazole, a 5-membered unique heterocyclic motif-containing sulfur and nitrogen, serves as an essential core scaffold in many medicinally important compounds [12].

Thiazole ring is a basic part of some clinically applied anticancer drugs, such as dasatinib, dabrafenib, bleomycin, thiazofurine, and epothilone [5, 12]. Its derivatives exhibit excellent pharmacological profiles, making this skeleton an ideal scaffold to develop more potent and safer drug candidates [5].

Purposes of the present study was to evaluate the effect of these compounds on the viability and migration of MDA-MB-231 cancer cells aiming for design of more safe and selective anticancer drugs.

Materials and methods

Cell source and reagents

The breast cancer cell line MDA-MB-231 was obtained from The European Collection of Authenticated Cell Cultures (ECACC), Sigma-Aldrich (USA). Roswell Park Memorial Institute (RPMI)-1640 medium media (lot numbers: ECB9006L) and Fetal Bovine Serum (FBS) (lot number: ECS0180L) were acquired from EuroClone (Italy). The penicillin-streptomycin antibiotics (lot number: S11943L0022) were purchased from Biowest (USA). {3-(4,5-dimethyl- thiazol-2-yl)-2,5-diphenyltetrazolium bromide} (MTT) reagent and cell culture grade dimethyl sulfoxide (DMSO) were available from Sigma-Aldrich (USA).

Thiazole Derivatives

2-amino, 5-nitrothiazole derivatives were designed by the Faculty of Science-Department of Chemistry at the Damascus University by changing the substitution groups on the thiazole ring (Fig. 1). The Compound 1 was obtained from Sigma-Aldrich (USA) [13], and used as an initial chemical compound to prepare 4-{(E)-[(5-nitro-1,3-thiazol-2-yl)imino]methyl}benzaldehyde (Compound 2), and (5E)-5-(4-{(E)-[(5-nitro-1,3-thiazol-2-yl)imino]methyl}benzylidene) imidazolidine-2,4-dione (Compound 3). The drug samples were prepared as follows: the powder of each compound was dissolved in dimethyl sulfoxide (DMSO), and the final dilutions of 1 µM/L, 5 µM/L, 10 µM/L, 25 µM/L, 50 µM/L, 100 µM/L were prepared.

Cell-line characteristics and culture

For this research, we used the MDA-MB-231 cell line, since the triple negative breast cancer (TNBC) can be perfectly modeled using this cell line. The cells of this line are distinguished by invasive phenotype and high proliferation rate.

The MDA-MB-231 cell line was cultured in RPMI1640 media supplemented with 10% heat-inactivated FBS and 1% penicillin-streptomycin antibiotics. Cells were cultured in 25 cm³ flasks and kept in a 5% CO₂ incubator at 37°C.

MTT assay

Tetrazolium salt is the first and most commonly used indicator dye for cell cultures, i.e., MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) introduced by Mosmann to evaluate proliferation and cytotoxicity of malignant cells.

Due to its lipophilic side groups and positive charge, MTT may pass the cell membranes and is reduced in viable cells by mitochondrial or cell plasma enzymes like dehydrogenases to the water-insoluble formazan [14].

Viable cells with active metabolism convert MTT into a purple-colored formazan product with maximal light absorbance of ca. 570 nm after solving the formazan crystals with DMSO. Meanwhile, dead cells lose the capacity to convert MTT to formazan, thus allowing the color development to be a useful marker of viable cell population only [15].

Hence, the cytotoxicity of the tested compounds on the MDA-MB-231 cancer cell line was evaluated in 96-well flasks by using the MTT colorimetric assay. The growing cells were harvested, counted with a haemocytometer, and plated in a 96-well plate at a cell density of 12,000 cells per 100 µL per well. After overnight incubation, the medium was removed and 100 uL of fresh medium was added at different concentrations of the compounds (1, 5, 10, 25, 50, and 100 µM/L). The cells have been treated with compounds for different time periods (24, 48, and 72h). Following the incubation period, 10 uL MTT (5 mg/mL) was added to each well and incubated for a further 4-hrs period. Media was removed from each well and 100 μL of DMSO was added to each well to solubilize formazan crystals. Viable cells were estimated by measuring the absorbance at 540 nm using a microplate ELISA reader (HumaReader HS, Human, Germany) [16].

Scratch assay

Cell migration is a fundamental process that controls morphogenesis and inflammation. Its deregulation is central to tumor cell dissemination and metastasis [17].

To determine the possible effects of the synthesized thiazole derivatives on cancer cell migration, we performed a scratch assay using an invasive MDA-MB-231 breast cancer cell line [6].

The scratch assay is a simple, reproducible assay commonly used to measure basic cell migration parameters, e.g., its speed, persistence, and polarity. The cells are grown to confluence and a thin "scratch" is introduced by incision with a scratcher. Cells at the scratch edge become polarized and migrate into the scratch space [17].

Briefly, the MDA-MB-231 cells (3×10⁶ cells/well) were plated onto 6-well plates for 24 h at a confluence of about 80% and then wounded with a scratcher. Thereafter, the debris was removed by rinsing the cells once with 1 mL of PBS.

The cells were then incubated with RPMI medium containing 10% FBS and treated with 10 μM/L of each compound. The control sample contained the cells and a standard medium without any active agents. The video images were taken at specific intervals, retrieved and embedded by ScopeImage software (version 9.00, Bioimager Inc. Company, Canada). The area of the initial scratch was measured, followed by gap area measurements after 24-h and 48-h incubation. The inhibition rate was presented as the gap area value over the initial scratch area [3].

Statistical Analysis

The results were analyzed using GraphPad Prism (version 7.00). All results are expressed as means ± SD and were obtained from separate experiments. A p.value was calculated using a one-way ANOVA test and a p-value less than 0.05 was considered statistically significant in all analytic series. Dunn's multiple comparisons test was used to compare the difference in the sum of ranks between two columns, comparing the effects at different drug concentrations with control sample.

Results

MTT assay

All tested compounds did not show any effect on the cytotoxicity of the MDA-MB-231 cancer cell line after incubation periods of 24 and 48 h when using concentrations ranging from 1 to 100 μM/L (data not shown). Figure 2 shows the effect of Compounds 1, 2, and 3 after the 72-h incubation period.

Figure 2. Viability effects of three thiazole compounds using different concentrations after 72 h incubation period on the breast cancer cell line MDA-MB-231 using MTT assay

The results were presented as a mean and standard deviation of three independent experiments (**significant difference vs. control, P ≤ 0.01).
(a): Compound 1, (b): Compound 2, (c): Compound 3.

Compounds 1 and 2 showed no effect on the cytotoxicity of the MDA-MB-231 cancer cell line using different concentrations of the compounds (1, 5, 10, 25, 50, and 100 μM/L) after incubation for 72 hours (with p. value=0.1076 and 0.8171 respectively). Compound 3 showed a significant effect on the cytotoxicity of the MDA-MB- 231 cell line at the concentration of 100 μM/L after incubation for 72 hours (p. value=0.0079). Meanwhile, no significant effect was observed using concentrations (1, 5, 10, 25, and 50 μM/L) after the 72-h incubation period.

Scratch assay

The results of the scratch assay are presented in Figure 3. In the control group, cell migration was very extensive with no evidence of the scratch after 24 h. For all of the studied compounds, an inhibitory effect was shown upon MDA-MB- 231 cell migration in vitro. Using a 10 µM dose, compound 1 inhibited the motility of the MDA-MB-231 cells line. The inhibition rate was 64.52% after 24 hours and 28.19% after 48 h later.

Compound 2 showed the minimal migration inhibitory effect among the three studied compounds with an inhibition rate of 36.87% after 24 h and 18.93% after 48 h of treatment.

Meanwhile the inhibition rate with compound 3 was 41.30% after 24 h and 16.19% after 48 h.

Figure 3. Effects of compounds on the migratory capacity of MDA-MB-231 (a), Statistical analysis of migration inhibition rate of MDA-MB-231 after incubation with compounds 1, 2, and 3 (b). Comparison between these three compounds shows that compound 1 has a greater influence on cell migration inhibition in MDA-MB-231 than compounds 2 and 3 treatment with a dose of 10 μM.

Discussion

Research for new anticancer therapies is prompted by cancers’ high mortality rate.

Our study was performed with MDA-MB-231 being one of the most studied breast cancer cell lines in medical research laboratories [18]. It is a highly aggressive and invasive TNBC cell line due to the lack of expression of estrogen receptor (ER) and progesterone receptor (PR), as well as the absence of HER2 (human epidermal growth factor receptor 2) overexpression [19].

The drugs containing thiazole rings are considered new effective medicines have taken their place in the research field. Hence, several studies have been conducted aiming to synthesize thiazole derivatives with different biological activities.

In 2013, Zheng et al. results demonstrated that the synthetic thiazole derivatives are effective migration inhibitors [6]. Later on, in 2014, the study of Grozav et al. have shown arylidene-hydrazinyl-thiazole derivatives significant anti-proliferative activity on the MDA-MB-231 cancer cell line[20]. Furthermore, Sbenati et al. (2011-2020) studied a series of new imidazo[2,1-b]thiazole-based aryl hydrazones. These compounds were designed and synthesized to evaluate their anti-tumor activity on some human cancer cell lines. The agents exhibited high cytotoxicity of these derivatives against the MDA-MB-231 cell line [21].

The structure-activity relationship (SAR) study revealed that the antitumor and antimigration activity was significantly affected by the substituents on the thiazole ring [22]. This indicated the importance of understanding the structure-activity relationships for further optimization of a pharmacological index for the thiazole derivatives [7].

To our knowledge, this study presents the first results of testing the 2-amino, 5-nitrothiazole derivatives in the field of cancer. We compared the cytotoxic properties of the three compounds (by MTT assay) against MDA-MB-231 cells using different concentrations of the test drugs and different incubation periods. All tested compounds showed no effect on the cytotoxicity of the MDA-MB-231 cancer cell line after incubation periods of 24 and 48 h using a range of concentrations from 1 to 100 μM/L. This effect was cell line-dependent as our compounds showed an inhibition effect on the growth of myelogenous leukemia cell line K562 which was used as a positive control (data not shown). A significant effect on the cytotoxicity of the MDA-MB-231 cell line was observed specifically with compound 3 at a concentration of 100 μM/L after incubation for 72 hours.

The concentration of 10 μM/L was chosen for the cellular migration test since it did not show any effect upon cell growth and, therefore, doesn’t affect the results. All the studied compounds showed an inhibitory effect of cellular migration of MDA-MB-231 in vitro.

Our results show that the thiazole derivatives produced by modification on (2-amino, 5-nitro thiazole) exert inhibition of MDA-MB-231 cancer cell growth and/or migration. These effects depend on replacement of functional groups at site-2 within the thiazole ring.

The addition of the benzaldehyde (Compound 2) to the thiazole ring does not affect the cytotoxic effect, whereas it decreases the anti-migration effect of the compound towards the MDA-MB-231 cancer cell line. The addition of the imidazole ring (compound 3) provided with the thiazole ring causes cytotoxic effect towards the MDA-MB-231 cell line as it keeps the anti-migration effect associated with addition of this ring. Our results are in line with the study by Petrou et al. (2021), who observed that hybrid derivatives of thiazole with different heterocyclic rings such as piperazine, pyridine, thiophen, imidazole, triazine, coumarin etc. as well as hydrazonyl thiazole derivatives are responsible for the anticancer activity [4].

Our results were consistent with Zheng et al. study that showed that synthetic thiazole derivatives are effective inhibitors of MDA-MB-231 cell migration at a concentration of 10 µmol/L [6].

Furthermore, these compounds exhibited low to negligible cytotoxicity, whereas they inhibited the in vitro ability of cancer cells to migrate. Thus, our study provides a novel type of small molecule therapeutic agents that aim to block cancer cell migration without exerting cell toxicity [6].

Conclusion

The derivatives of 2-amino, 5-nitrothiazole are considered as an excellent starting point to synthesize future drug candidates to treat breast cancer. Compound 3 is the most active molecule among our compounds against MDA-MB-231 cell growth. Using the compound 1 results in deeper inhibition of MDA-MB-231 cell migration when compared to other compounds.

These findings are helpful for the development of new potent anticancer agents using thiazole scaffold.

Therefore, additional in vitro and in vivo investigation into the mechanism of action, potential drug interactions, and adverse effects of these compounds allow us to evaluate the possibility of using these agents in breast cancer treatment in the future.

Acknowledgment

The authors gratefully acknowledge Prof. Hossam Murad (Atomic Energy Commission of Syria, Damascus) for providing MDA-MB-231 and K562 and sharing his valuable experience, and Prof. Farouk Kandil (Department of chemistry, Faculty of science, University of Damascus, Syria) for providing thiazole derivatives. Authors also extend their gratitude to Prof. Chadi Soukkarieh, Postgraduate studies laboratory, Department of Animal Biology, Faculty of Sciences, Damascus University, for providing access to equipment used in this study.

Funding statement

This research was partially supported by the University of Damascus.

Competing interest

The authors declare no conflict of interest.

References

1. Worcester S. Most Common Cancer Diagnosis Globally: Breast Surpasses Lung. Medscape [Internet]. 2020; Available from: https://www.medscape.com/viewarticle/942808?src=soc_fb_201219_mscpedt_news_onc_bcsm&faf=1&fbclid=IwAR0zdLml0D5kPhKu1sWUiN-5dGpyW7d6gDpsFtmIM_sew3ey4Ks0D94rEDo
2. Gandalovičová A, Rosel D, Fernandes M, Veselý P, Heneberg P, Čermák V, et al. Migrastatics – Anti-metastatic and Anti-invasion Drugs: Promises and Challenges. Trends Cancer. 2017;3(6):391-406. doi: 10.1016/j.trecan.2017.04.008
3. Kabala-Dzik A, Rzepecka-Stojko A, Kubina R, Jastrzębska-Stojko Ż, Stojko R, Wojtyczka RD, et al. Migration rate inhibition of breast cancer cells treated by caffeic acid and caffeic acid phenethyl ester: An in vitro comparison study. Nutrients. 2017; 9(10):1-19.
   doi: 10.3390/nu9101144
4. Petrou A, Fesatidou M, Geronikaki A. Thiazole Ring – A biologically active scaffold. molecule. 2021; 26(11):1-75.
   doi: 10.3390/MOLECULES26113166
5. Ramos-Inza S, Aydillo C, Sanmartín C, Plano D. Thiazole Moiety: An Interesting Scaffold for Developing New Antitumoral Compounds. Heterocycles – Synth Biol Act. 2020 Jan 17;1-12. doi: 10.5772/intechopen.82741
6. Zheng S, Zhong Q, Jiang Q, Mottamal M, Zhang Q, Zhu N, et al. Discovery of a series of thiazole derivatives as novel inhibitors of metastatic cancer cell migration and invasion. ACS Med Chem Lett. 2013 Feb 14;4(2):1-7. doi: 10.1021/ml300322n
7. Zheng S, Zhong Q, Xi Y, Mottamal M, Zhang Q, Schroeder RL, et al. Modification and biological evaluation of thiazole derivatives as novel inhibitors of metastatic cancer cell migration and invasion. J Med Chem [Internet]. 2014;57(15):6653-6667. doi: 10.1021/jm500724x
8. Sun M, Xu Q, Xu J, Wu Y, Wang Y, Zuo D, et al. Synthesis and bioevaluation of N,4-diaryl-1,3-thiazole-2-amines as tubulin inhibitors with potent antiproliferative activity. PLoS One. 2017;12(3):1-15. doi: 10.1371/journal.pone.0174006
9. Sallam AA, Mohyeldin MM, Foudah AI, Akl MR, Nazzal S, Meyer SA, et al. Marine natural products-inspired phenylmethylene hydantoins with potent in vitro and in vivo antitumor activities via suppression of Brk and FAK signaling. Org Biomol Chem. 2014;12(28):5295-5303. doi: 10.1039/c4ob00553h
10. Mostafa AA, Al-Rahmah AN, Surendra Kumar R, Manilal A, Idhayadhulla A. Biological evaluation of some imidazolidine-2,4-dione and 2-thioxoimidazolidin-4-one derivatives as anticoagulant agents and inhibition of MCF-7 breast cancer cell line. Int J Pharmacol. 2016;12(4):290-303. doi: 10.3923/ijp.2016.290.303
11. Rockwell S, Mroczkowski Z, Rupp WD. Evaluation of 2-Amino-5-Nitrothiazole as a hypoxic cell radiosensitizer. Radiat Res. 1982; 90(3):575-585. doi: 10.2307/3575735
12. Sharma PC, Bansal KK, Sharma A, Sharma D, Deep A. Thiazole-containing compounds as therapeutic targets for cancer therapy. Eur J Med Chem. 2020;188:1-47. doi: 10.1016/j.ejmech.2019.112016
13. PubChem. 2-Amino-5-nitrothiazole. 2022; Available from: https://pubchem.ncbi.nlm.nih.gov/compound/2-Amino-5-nitrothiazole
14. Daniel F. Gilbert OF. Cell Viability Assays: Methods and Protocols. Konstantin Präbst, Hannes Engelhardt, Stefan Ringgeler and HH, editor. Humana Press. 1st ed. 2017;1601:1-6.
15. Sittampalam G, Coussens N, Arkin M, Auld D, Austin C, Bejcek B, et al. Assay Guidance Manual. Assay Guid Man. 2016;(Md):305-36. PMID: 22553881
16. Mirza S, Asma Naqvi S, Mohammed Khan K, Salar U, Choudhary MI. Facile synthesis of novel substituted aryl-thiazole (SAT) analogs via one-pot multi-component reaction as potent cytotoxic agents against cancer cell lines. Bioorg Chem. 2017;70:133-143. doi: 10.1016/j.bioorg.2016.12.003
17. Vagima Y, Lapid K. Stem cell migration: Methods in Molecular Biology. Humana Press. 2011;277-289.
18. Masters JRW, Palsson B. Human Cell Culture. Hum Cell Cult. 2002;II:79-85.
19. European College of Authenticated Cell cultures. Cell line profile MDA-MB-231. Eur Collect Authenticated Cell Cult. 2017;231(92020424):1-3.
20. Grozav A, Găină LI, Pileczki V, Crisan O, Silaghi-Dumitrescu L, Therrien B, et al. The synthesis and antiproliferative activities of new arylidene-hydrazinyl-thiazole derivatives. Int J Mol Sci. 2014;15(12):22059-22072. doi: 10.3390/ijms151222059
21. Sbenati RM, Semreen MH, Semreen AM, Shehata MK, Alsaghir FM, El-Gamal MI. Evaluation of imidazo[2,1-b]thiazole-based anticancer agents in one decade (2011-2020): Current status and future prospects. Bioorganic Med Chem. 2021;29:1-32.
    doi: 10.1016/j.bmc.2020.115897
22. Omar AM, Bajorath J, Ihmaid S, Mohamed HM, El-agrody AM, Mora A, et al. Bioorganic Chemistry Novel molecular discovery of promising amidine-based thiazole analogues as potent dual Matrix Metalloproteinase-2 and 9 inhibitors : Anticancer activity data with prominent cell cycle arrest and DNA fragmentation analysis effects. Bioorg Chem. 2020;101(April):1-14. doi: 10.1016/j.bioorg.2020.103992

" ["~DETAIL_TEXT"]=> string(27128) "

Introduction

Breast cancer is the most common cancer among women and a leading cause of cancer death worldwide. In 2020, for the first time, breast cancer has overtaken lung cancer as the most common malignancy, representing 11.7% of all cancer cases worldwide – according to the International Agency for Research on Cancer (IARC) [1]. Since metastatic diseases accounts for more than 90% of mortality in this cancer, the treatment is complemented with drugs that inhibiting the capacity of cancer cells to invade through the extracellular matrix (ECM) and establish secondary tumors [2]. Breast cancer is a heterogeneous disease with several biological subtypes. E.g., TNBC, triple-negative breast cancer, is the most aggressive subtype of breast cancer and known for its high recurrence rates. Thus, the mortality rate is higher in TNBC patients than among patients with other types of breast cancer [3].

Common therapeutic options are limited for TNBC, as neither hormone therapy nor HER2 targeting drugs do not work. The response to available antitumor drugs is gradually decreasing among patients with metastatic breast cancer, possibly due to the tumor’s resistance to a wide range of cancer drugs [3]. Additionally, most antitumor agents exhibit high toxicity [4]. In order to decrease toxicity levels of breast cancer treatment and increasing patients’ survival rates, a search for researchers are working to develop more safe and selective anticancer drugs is underway [3, 5].

Thiazole derivatives have been reported to inhibit cancer cell growth and proliferation as well as neoangiogenesis through a variety of mechanisms and therapeutic targets [6]. E.g., incorporation of thiazole ring into different molecules have demonstrated a promising approach to design more potent and safer antitumor drugs [5]. Modifications on aminothiazole were found to cause antitumor activity against particular cell lines [7]. Adding an aromatic ring to 1,3-thiazole-2-amines provided a tubulin inhibitor with potent antiproliferative activity [8]. A series of substituted benzaldehydes exerted an inhibitory effect of MDA-MB-231 cell migration and proliferation [9]. Imidazolidine-2,4-dione moiety exhibited a potent anticancer activity [10].

Due to the known antioxidant effect, we tested the effect of 5-nitro-1,3-thiazol-2-amine (compound 1), on the growth and the migration of MDA-MB-231 cell line. Moreover, we used it as initial compound for structural modifications. According to Rockwell et al. study, the nitro heterocyclic compound 2-amino-5-nitrothiazole (ANT) was evaluated as a hypoxic radiosensitizer. Experiments with bacteria showed that this agent was similar to misonidazole in radiosensitizing activity, but was less cytotoxic and less mutagenic than misonidazole [11].

Compound2, 4-{(E)-[(5-nitro-1,3-thiazol-2-yl)imino]methyl}benzaldehyde, was prepared by adding benzaldehyde group in compound 1 structure. Compound 3, (5E)-5-(4-{(E)-[(5-nitro-1,3-thiazol-2-yl)imino]methyl}benzylidene)imidazolidine-2,4-dione, was prepared by addition of Imi- dazolidine-2,4-dione moiety (Fig. 1).

Figure 1. Chemical structures for compounds 1, 2, and 3

The heterocycles constitute a common structural unit of most marketed drugs, thus drawing special attention to molecules containing sulfur heterocycles [5]. Thiazole, a 5-membered unique heterocyclic motif-containing sulfur and nitrogen, serves as an essential core scaffold in many medicinally important compounds [12].

Thiazole ring is a basic part of some clinically applied anticancer drugs, such as dasatinib, dabrafenib, bleomycin, thiazofurine, and epothilone [5, 12]. Its derivatives exhibit excellent pharmacological profiles, making this skeleton an ideal scaffold to develop more potent and safer drug candidates [5].

Purposes of the present study was to evaluate the effect of these compounds on the viability and migration of MDA-MB-231 cancer cells aiming for design of more safe and selective anticancer drugs.

Materials and methods

Cell source and reagents

The breast cancer cell line MDA-MB-231 was obtained from The European Collection of Authenticated Cell Cultures (ECACC), Sigma-Aldrich (USA). Roswell Park Memorial Institute (RPMI)-1640 medium media (lot numbers: ECB9006L) and Fetal Bovine Serum (FBS) (lot number: ECS0180L) were acquired from EuroClone (Italy). The penicillin-streptomycin antibiotics (lot number: S11943L0022) were purchased from Biowest (USA). {3-(4,5-dimethyl- thiazol-2-yl)-2,5-diphenyltetrazolium bromide} (MTT) reagent and cell culture grade dimethyl sulfoxide (DMSO) were available from Sigma-Aldrich (USA).

Thiazole Derivatives

2-amino, 5-nitrothiazole derivatives were designed by the Faculty of Science-Department of Chemistry at the Damascus University by changing the substitution groups on the thiazole ring (Fig. 1). The Compound 1 was obtained from Sigma-Aldrich (USA) [13], and used as an initial chemical compound to prepare 4-{(E)-[(5-nitro-1,3-thiazol-2-yl)imino]methyl}benzaldehyde (Compound 2), and (5E)-5-(4-{(E)-[(5-nitro-1,3-thiazol-2-yl)imino]methyl}benzylidene) imidazolidine-2,4-dione (Compound 3). The drug samples were prepared as follows: the powder of each compound was dissolved in dimethyl sulfoxide (DMSO), and the final dilutions of 1 µM/L, 5 µM/L, 10 µM/L, 25 µM/L, 50 µM/L, 100 µM/L were prepared.

Cell-line characteristics and culture

For this research, we used the MDA-MB-231 cell line, since the triple negative breast cancer (TNBC) can be perfectly modeled using this cell line. The cells of this line are distinguished by invasive phenotype and high proliferation rate.

The MDA-MB-231 cell line was cultured in RPMI1640 media supplemented with 10% heat-inactivated FBS and 1% penicillin-streptomycin antibiotics. Cells were cultured in 25 cm³ flasks and kept in a 5% CO₂ incubator at 37°C.

MTT assay

Tetrazolium salt is the first and most commonly used indicator dye for cell cultures, i.e., MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) introduced by Mosmann to evaluate proliferation and cytotoxicity of malignant cells.

Due to its lipophilic side groups and positive charge, MTT may pass the cell membranes and is reduced in viable cells by mitochondrial or cell plasma enzymes like dehydrogenases to the water-insoluble formazan [14].

Viable cells with active metabolism convert MTT into a purple-colored formazan product with maximal light absorbance of ca. 570 nm after solving the formazan crystals with DMSO. Meanwhile, dead cells lose the capacity to convert MTT to formazan, thus allowing the color development to be a useful marker of viable cell population only [15].

Hence, the cytotoxicity of the tested compounds on the MDA-MB-231 cancer cell line was evaluated in 96-well flasks by using the MTT colorimetric assay. The growing cells were harvested, counted with a haemocytometer, and plated in a 96-well plate at a cell density of 12,000 cells per 100 µL per well. After overnight incubation, the medium was removed and 100 uL of fresh medium was added at different concentrations of the compounds (1, 5, 10, 25, 50, and 100 µM/L). The cells have been treated with compounds for different time periods (24, 48, and 72h). Following the incubation period, 10 uL MTT (5 mg/mL) was added to each well and incubated for a further 4-hrs period. Media was removed from each well and 100 μL of DMSO was added to each well to solubilize formazan crystals. Viable cells were estimated by measuring the absorbance at 540 nm using a microplate ELISA reader (HumaReader HS, Human, Germany) [16].

Scratch assay

Cell migration is a fundamental process that controls morphogenesis and inflammation. Its deregulation is central to tumor cell dissemination and metastasis [17].

To determine the possible effects of the synthesized thiazole derivatives on cancer cell migration, we performed a scratch assay using an invasive MDA-MB-231 breast cancer cell line [6].

The scratch assay is a simple, reproducible assay commonly used to measure basic cell migration parameters, e.g., its speed, persistence, and polarity. The cells are grown to confluence and a thin "scratch" is introduced by incision with a scratcher. Cells at the scratch edge become polarized and migrate into the scratch space [17].

Briefly, the MDA-MB-231 cells (3×10⁶ cells/well) were plated onto 6-well plates for 24 h at a confluence of about 80% and then wounded with a scratcher. Thereafter, the debris was removed by rinsing the cells once with 1 mL of PBS.

The cells were then incubated with RPMI medium containing 10% FBS and treated with 10 μM/L of each compound. The control sample contained the cells and a standard medium without any active agents. The video images were taken at specific intervals, retrieved and embedded by ScopeImage software (version 9.00, Bioimager Inc. Company, Canada). The area of the initial scratch was measured, followed by gap area measurements after 24-h and 48-h incubation. The inhibition rate was presented as the gap area value over the initial scratch area [3].

Statistical Analysis

The results were analyzed using GraphPad Prism (version 7.00). All results are expressed as means ± SD and were obtained from separate experiments. A p.value was calculated using a one-way ANOVA test and a p-value less than 0.05 was considered statistically significant in all analytic series. Dunn's multiple comparisons test was used to compare the difference in the sum of ranks between two columns, comparing the effects at different drug concentrations with control sample.

Results

MTT assay

All tested compounds did not show any effect on the cytotoxicity of the MDA-MB-231 cancer cell line after incubation periods of 24 and 48 h when using concentrations ranging from 1 to 100 μM/L (data not shown). Figure 2 shows the effect of Compounds 1, 2, and 3 after the 72-h incubation period.

Figure 2. Viability effects of three thiazole compounds using different concentrations after 72 h incubation period on the breast cancer cell line MDA-MB-231 using MTT assay

The results were presented as a mean and standard deviation of three independent experiments (**significant difference vs. control, P ≤ 0.01).
(a): Compound 1, (b): Compound 2, (c): Compound 3.

Compounds 1 and 2 showed no effect on the cytotoxicity of the MDA-MB-231 cancer cell line using different concentrations of the compounds (1, 5, 10, 25, 50, and 100 μM/L) after incubation for 72 hours (with p. value=0.1076 and 0.8171 respectively). Compound 3 showed a significant effect on the cytotoxicity of the MDA-MB- 231 cell line at the concentration of 100 μM/L after incubation for 72 hours (p. value=0.0079). Meanwhile, no significant effect was observed using concentrations (1, 5, 10, 25, and 50 μM/L) after the 72-h incubation period.

Scratch assay

The results of the scratch assay are presented in Figure 3. In the control group, cell migration was very extensive with no evidence of the scratch after 24 h. For all of the studied compounds, an inhibitory effect was shown upon MDA-MB- 231 cell migration in vitro. Using a 10 µM dose, compound 1 inhibited the motility of the MDA-MB-231 cells line. The inhibition rate was 64.52% after 24 hours and 28.19% after 48 h later.

Compound 2 showed the minimal migration inhibitory effect among the three studied compounds with an inhibition rate of 36.87% after 24 h and 18.93% after 48 h of treatment.

Meanwhile the inhibition rate with compound 3 was 41.30% after 24 h and 16.19% after 48 h.

Figure 3. Effects of compounds on the migratory capacity of MDA-MB-231 (a), Statistical analysis of migration inhibition rate of MDA-MB-231 after incubation with compounds 1, 2, and 3 (b). Comparison between these three compounds shows that compound 1 has a greater influence on cell migration inhibition in MDA-MB-231 than compounds 2 and 3 treatment with a dose of 10 μM.

Discussion

Research for new anticancer therapies is prompted by cancers’ high mortality rate.

Our study was performed with MDA-MB-231 being one of the most studied breast cancer cell lines in medical research laboratories [18]. It is a highly aggressive and invasive TNBC cell line due to the lack of expression of estrogen receptor (ER) and progesterone receptor (PR), as well as the absence of HER2 (human epidermal growth factor receptor 2) overexpression [19].

The drugs containing thiazole rings are considered new effective medicines have taken their place in the research field. Hence, several studies have been conducted aiming to synthesize thiazole derivatives with different biological activities.

In 2013, Zheng et al. results demonstrated that the synthetic thiazole derivatives are effective migration inhibitors [6]. Later on, in 2014, the study of Grozav et al. have shown arylidene-hydrazinyl-thiazole derivatives significant anti-proliferative activity on the MDA-MB-231 cancer cell line[20]. Furthermore, Sbenati et al. (2011-2020) studied a series of new imidazo[2,1-b]thiazole-based aryl hydrazones. These compounds were designed and synthesized to evaluate their anti-tumor activity on some human cancer cell lines. The agents exhibited high cytotoxicity of these derivatives against the MDA-MB-231 cell line [21].

The structure-activity relationship (SAR) study revealed that the antitumor and antimigration activity was significantly affected by the substituents on the thiazole ring [22]. This indicated the importance of understanding the structure-activity relationships for further optimization of a pharmacological index for the thiazole derivatives [7].

To our knowledge, this study presents the first results of testing the 2-amino, 5-nitrothiazole derivatives in the field of cancer. We compared the cytotoxic properties of the three compounds (by MTT assay) against MDA-MB-231 cells using different concentrations of the test drugs and different incubation periods. All tested compounds showed no effect on the cytotoxicity of the MDA-MB-231 cancer cell line after incubation periods of 24 and 48 h using a range of concentrations from 1 to 100 μM/L. This effect was cell line-dependent as our compounds showed an inhibition effect on the growth of myelogenous leukemia cell line K562 which was used as a positive control (data not shown). A significant effect on the cytotoxicity of the MDA-MB-231 cell line was observed specifically with compound 3 at a concentration of 100 μM/L after incubation for 72 hours.

The concentration of 10 μM/L was chosen for the cellular migration test since it did not show any effect upon cell growth and, therefore, doesn’t affect the results. All the studied compounds showed an inhibitory effect of cellular migration of MDA-MB-231 in vitro.

Our results show that the thiazole derivatives produced by modification on (2-amino, 5-nitro thiazole) exert inhibition of MDA-MB-231 cancer cell growth and/or migration. These effects depend on replacement of functional groups at site-2 within the thiazole ring.

The addition of the benzaldehyde (Compound 2) to the thiazole ring does not affect the cytotoxic effect, whereas it decreases the anti-migration effect of the compound towards the MDA-MB-231 cancer cell line. The addition of the imidazole ring (compound 3) provided with the thiazole ring causes cytotoxic effect towards the MDA-MB-231 cell line as it keeps the anti-migration effect associated with addition of this ring. Our results are in line with the study by Petrou et al. (2021), who observed that hybrid derivatives of thiazole with different heterocyclic rings such as piperazine, pyridine, thiophen, imidazole, triazine, coumarin etc. as well as hydrazonyl thiazole derivatives are responsible for the anticancer activity [4].

Our results were consistent with Zheng et al. study that showed that synthetic thiazole derivatives are effective inhibitors of MDA-MB-231 cell migration at a concentration of 10 µmol/L [6].

Furthermore, these compounds exhibited low to negligible cytotoxicity, whereas they inhibited the in vitro ability of cancer cells to migrate. Thus, our study provides a novel type of small molecule therapeutic agents that aim to block cancer cell migration without exerting cell toxicity [6].

Conclusion

The derivatives of 2-amino, 5-nitrothiazole are considered as an excellent starting point to synthesize future drug candidates to treat breast cancer. Compound 3 is the most active molecule among our compounds against MDA-MB-231 cell growth. Using the compound 1 results in deeper inhibition of MDA-MB-231 cell migration when compared to other compounds.

These findings are helpful for the development of new potent anticancer agents using thiazole scaffold.

Therefore, additional in vitro and in vivo investigation into the mechanism of action, potential drug interactions, and adverse effects of these compounds allow us to evaluate the possibility of using these agents in breast cancer treatment in the future.

Acknowledgment

The authors gratefully acknowledge Prof. Hossam Murad (Atomic Energy Commission of Syria, Damascus) for providing MDA-MB-231 and K562 and sharing his valuable experience, and Prof. Farouk Kandil (Department of chemistry, Faculty of science, University of Damascus, Syria) for providing thiazole derivatives. Authors also extend their gratitude to Prof. Chadi Soukkarieh, Postgraduate studies laboratory, Department of Animal Biology, Faculty of Sciences, Damascus University, for providing access to equipment used in this study.

Funding statement

This research was partially supported by the University of Damascus.

Competing interest

The authors declare no conflict of interest.

References

1. Worcester S. Most Common Cancer Diagnosis Globally: Breast Surpasses Lung. Medscape [Internet]. 2020; Available from: https://www.medscape.com/viewarticle/942808?src=soc_fb_201219_mscpedt_news_onc_bcsm&faf=1&fbclid=IwAR0zdLml0D5kPhKu1sWUiN-5dGpyW7d6gDpsFtmIM_sew3ey4Ks0D94rEDo
2. Gandalovičová A, Rosel D, Fernandes M, Veselý P, Heneberg P, Čermák V, et al. Migrastatics – Anti-metastatic and Anti-invasion Drugs: Promises and Challenges. Trends Cancer. 2017;3(6):391-406. doi: 10.1016/j.trecan.2017.04.008
3. Kabala-Dzik A, Rzepecka-Stojko A, Kubina R, Jastrzębska-Stojko Ż, Stojko R, Wojtyczka RD, et al. Migration rate inhibition of breast cancer cells treated by caffeic acid and caffeic acid phenethyl ester: An in vitro comparison study. Nutrients. 2017; 9(10):1-19.
   doi: 10.3390/nu9101144
4. Petrou A, Fesatidou M, Geronikaki A. Thiazole Ring – A biologically active scaffold. molecule. 2021; 26(11):1-75.
   doi: 10.3390/MOLECULES26113166
5. Ramos-Inza S, Aydillo C, Sanmartín C, Plano D. Thiazole Moiety: An Interesting Scaffold for Developing New Antitumoral Compounds. Heterocycles – Synth Biol Act. 2020 Jan 17;1-12. doi: 10.5772/intechopen.82741
6. Zheng S, Zhong Q, Jiang Q, Mottamal M, Zhang Q, Zhu N, et al. Discovery of a series of thiazole derivatives as novel inhibitors of metastatic cancer cell migration and invasion. ACS Med Chem Lett. 2013 Feb 14;4(2):1-7. doi: 10.1021/ml300322n
7. Zheng S, Zhong Q, Xi Y, Mottamal M, Zhang Q, Schroeder RL, et al. Modification and biological evaluation of thiazole derivatives as novel inhibitors of metastatic cancer cell migration and invasion. J Med Chem [Internet]. 2014;57(15):6653-6667. doi: 10.1021/jm500724x
8. Sun M, Xu Q, Xu J, Wu Y, Wang Y, Zuo D, et al. Synthesis and bioevaluation of N,4-diaryl-1,3-thiazole-2-amines as tubulin inhibitors with potent antiproliferative activity. PLoS One. 2017;12(3):1-15. doi: 10.1371/journal.pone.0174006
9. Sallam AA, Mohyeldin MM, Foudah AI, Akl MR, Nazzal S, Meyer SA, et al. Marine natural products-inspired phenylmethylene hydantoins with potent in vitro and in vivo antitumor activities via suppression of Brk and FAK signaling. Org Biomol Chem. 2014;12(28):5295-5303. doi: 10.1039/c4ob00553h
10. Mostafa AA, Al-Rahmah AN, Surendra Kumar R, Manilal A, Idhayadhulla A. Biological evaluation of some imidazolidine-2,4-dione and 2-thioxoimidazolidin-4-one derivatives as anticoagulant agents and inhibition of MCF-7 breast cancer cell line. Int J Pharmacol. 2016;12(4):290-303. doi: 10.3923/ijp.2016.290.303
11. Rockwell S, Mroczkowski Z, Rupp WD. Evaluation of 2-Amino-5-Nitrothiazole as a hypoxic cell radiosensitizer. Radiat Res. 1982; 90(3):575-585. doi: 10.2307/3575735
12. Sharma PC, Bansal KK, Sharma A, Sharma D, Deep A. Thiazole-containing compounds as therapeutic targets for cancer therapy. Eur J Med Chem. 2020;188:1-47. doi: 10.1016/j.ejmech.2019.112016
13. PubChem. 2-Amino-5-nitrothiazole. 2022; Available from: https://pubchem.ncbi.nlm.nih.gov/compound/2-Amino-5-nitrothiazole
14. Daniel F. Gilbert OF. Cell Viability Assays: Methods and Protocols. Konstantin Präbst, Hannes Engelhardt, Stefan Ringgeler and HH, editor. Humana Press. 1st ed. 2017;1601:1-6.
15. Sittampalam G, Coussens N, Arkin M, Auld D, Austin C, Bejcek B, et al. Assay Guidance Manual. Assay Guid Man. 2016;(Md):305-36. PMID: 22553881
16. Mirza S, Asma Naqvi S, Mohammed Khan K, Salar U, Choudhary MI. Facile synthesis of novel substituted aryl-thiazole (SAT) analogs via one-pot multi-component reaction as potent cytotoxic agents against cancer cell lines. Bioorg Chem. 2017;70:133-143. doi: 10.1016/j.bioorg.2016.12.003
17. Vagima Y, Lapid K. Stem cell migration: Methods in Molecular Biology. Humana Press. 2011;277-289.
18. Masters JRW, Palsson B. Human Cell Culture. Hum Cell Cult. 2002;II:79-85.
19. European College of Authenticated Cell cultures. Cell line profile MDA-MB-231. Eur Collect Authenticated Cell Cult. 2017;231(92020424):1-3.
20. Grozav A, Găină LI, Pileczki V, Crisan O, Silaghi-Dumitrescu L, Therrien B, et al. The synthesis and antiproliferative activities of new arylidene-hydrazinyl-thiazole derivatives. Int J Mol Sci. 2014;15(12):22059-22072. doi: 10.3390/ijms151222059
21. Sbenati RM, Semreen MH, Semreen AM, Shehata MK, Alsaghir FM, El-Gamal MI. Evaluation of imidazo[2,1-b]thiazole-based anticancer agents in one decade (2011-2020): Current status and future prospects. Bioorganic Med Chem. 2021;29:1-32.
    doi: 10.1016/j.bmc.2020.115897
22. Omar AM, Bajorath J, Ihmaid S, Mohamed HM, El-agrody AM, Mora A, et al. Bioorganic Chemistry Novel molecular discovery of promising amidine-based thiazole analogues as potent dual Matrix Metalloproteinase-2 and 9 inhibitors : Anticancer activity data with prominent cell cycle arrest and DNA fragmentation analysis effects. Bioorg Chem. 2020;101(April):1-14. doi: 10.1016/j.bioorg.2020.103992

" ["DETAIL_TEXT_TYPE"]=> string(4) "html" ["~DETAIL_TEXT_TYPE"]=> string(4) "html" ["PREVIEW_TEXT"]=> string(0) "" ["~PREVIEW_TEXT"]=> string(0) "" ["PREVIEW_TEXT_TYPE"]=> string(4) "text" ["~PREVIEW_TEXT_TYPE"]=> string(4) "text" ["PREVIEW_PICTURE"]=> NULL ["~PREVIEW_PICTURE"]=> NULL ["LANG_DIR"]=> string(4) "/ru/" ["~LANG_DIR"]=> string(4) "/ru/" ["SORT"]=> string(2) "50" ["~SORT"]=> string(2) "50" ["CODE"]=> string(97) "podavlenie-in-vitro-proliferatsii-i-migratsii-kletok-linii-mda-mb-231-novymi-proizvodnymi-tiazola" ["~CODE"]=> string(97) "podavlenie-in-vitro-proliferatsii-i-migratsii-kletok-linii-mda-mb-231-novymi-proizvodnymi-tiazola" ["EXTERNAL_ID"]=> string(4) "2068" ["~EXTERNAL_ID"]=> string(4) "2068" ["IBLOCK_TYPE_ID"]=> string(7) "journal" ["~IBLOCK_TYPE_ID"]=> string(7) "journal" ["IBLOCK_CODE"]=> string(7) "volumes" ["~IBLOCK_CODE"]=> string(7) "volumes" ["IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["~IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["LID"]=> string(2) "s2" ["~LID"]=> string(2) "s2" ["EDIT_LINK"]=> NULL ["DELETE_LINK"]=> NULL ["DISPLAY_ACTIVE_FROM"]=> string(0) "" ["IPROPERTY_VALUES"]=> array(18) { ["ELEMENT_META_TITLE"]=> string(162) "Подавление in vitro пролиферации и миграции клеток линии MDA-MB-231 новыми производными тиазола" ["ELEMENT_META_KEYWORDS"]=> string(0) "" ["ELEMENT_META_DESCRIPTION"]=> string(272) "Подавление in vitro пролиферации и миграции клеток линии MDA-MB-231 новыми производными тиазолаIn-vitro antiproliferative and antimigration activity against MDA-MB-231 cell line of new thiazole derivatives" ["ELEMENT_PREVIEW_PICTURE_FILE_ALT"]=> string(3666) "<p style="text-align: justify;"> Проведены обширные исследования по разработке более безопасных и избирательных противораковых препаратов для снижения токсичности, связанной с терапией. Особое внимание уделяется молекулам, содержащих серусодержащие гетероциклы, так как они рассматриваются как важная структурная единица многих коммерческих препаратов. В нашем университете был разработан ряд производных 2-амино, 5-нитротиазола. Нашей целью было тестирование <i>in vitro</i> трех подобных соединений на темпы роста клеточной линии MDA-MB-231 и на ее способность к миграции. </p> <h3>Материалы и методы</h3> <p style="text-align: justify;">С помощью МТТ-теста определяли цитотоксичность указанных соединений. Скрэтч (scratch)-тест применяли для оценки возможных эффектов этих соединений на миграционную активность клеток линии MDA-MB-231.</p> <h3>Результаты</h3> <p style="text-align: justify;">Два соединения, а именно: 5-нитро-1,3-тиазол-2-амин и 4-{(E)-[(5-нитро-1,3-тиазол-2-ил)имино]метил}бензальдегид, проявили ингибирующий эффект на миграцию раковых клеток, не оказывая при этом влияния на цитотоксичность в отношении линии MDA-MB-231 при использовании их в возрастающих концентрациях (1, 5, 10, 25, 50 и 100 мкМ/л) после 72 часов инкубации (p=0,11 и 0,83, соответственно).</p> <p style="text-align: justify;">Наряду с подавлением клеточной миграции, добавление к клеткам соединения (5E)-5-(4-{(E)-[(5-ниторо-1,3-тиазол-2-ил)имино]метил}бензилиден)имидазолидин-2,4-дион вызывало статистически достоверный цитотоксический эффект на клетках MDA-MB-231 после 72 часов инкубации при концентрации препарата 100 мкМ/л (p=0,016).</p> <h3>Выводы</h3> <p style="text-align: justify;">Производные 2-амино, 5-нитротиазола можно рассматриваться в качестве перспективного исходного вещества для синтеза последующих кандидатных препаратов для лечения метастатического рака молочной железы.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Производные тиазола, рак молочной железы, трижды негативный, линия клеток, MDA-MB-231, подавление роста, подавление миграции.</p>" ["ELEMENT_PREVIEW_PICTURE_FILE_TITLE"]=> string(162) "Подавление in vitro пролиферации и миграции клеток линии MDA-MB-231 новыми производными тиазола" ["ELEMENT_DETAIL_PICTURE_FILE_ALT"]=> string(162) "Подавление in vitro пролиферации и миграции клеток линии MDA-MB-231 новыми производными тиазола" ["ELEMENT_DETAIL_PICTURE_FILE_TITLE"]=> string(162) "Подавление in vitro пролиферации и миграции клеток линии MDA-MB-231 новыми производными тиазола" ["SECTION_META_TITLE"]=> string(162) "Подавление in vitro пролиферации и миграции клеток линии MDA-MB-231 новыми производными тиазола" ["SECTION_META_KEYWORDS"]=> string(162) "Подавление in vitro пролиферации и миграции клеток линии MDA-MB-231 новыми производными тиазола" ["SECTION_META_DESCRIPTION"]=> string(162) "Подавление in vitro пролиферации и миграции клеток линии MDA-MB-231 новыми производными тиазола" ["SECTION_PICTURE_FILE_ALT"]=> string(162) "Подавление in vitro пролиферации и миграции клеток линии MDA-MB-231 новыми производными тиазола" ["SECTION_PICTURE_FILE_TITLE"]=> string(162) "Подавление in vitro пролиферации и миграции клеток линии MDA-MB-231 новыми производными тиазола" ["SECTION_PICTURE_FILE_NAME"]=> string(100) "podavlenie-in-vitro-proliferatsii-i-migratsii-kletok-linii-mda-mb-231-novymi-proizvodnymi-tiazola-im" ["SECTION_DETAIL_PICTURE_FILE_ALT"]=> string(162) "Подавление in vitro пролиферации и миграции клеток линии MDA-MB-231 новыми производными тиазола" ["SECTION_DETAIL_PICTURE_FILE_TITLE"]=> string(162) "Подавление in vitro пролиферации и миграции клеток линии MDA-MB-231 новыми производными тиазола" ["SECTION_DETAIL_PICTURE_FILE_NAME"]=> string(100) "podavlenie-in-vitro-proliferatsii-i-migratsii-kletok-linii-mda-mb-231-novymi-proizvodnymi-tiazola-im" ["ELEMENT_PREVIEW_PICTURE_FILE_NAME"]=> string(100) "podavlenie-in-vitro-proliferatsii-i-migratsii-kletok-linii-mda-mb-231-novymi-proizvodnymi-tiazola-im" ["ELEMENT_DETAIL_PICTURE_FILE_NAME"]=> string(100) "podavlenie-in-vitro-proliferatsii-i-migratsii-kletok-linii-mda-mb-231-novymi-proizvodnymi-tiazola-im" } ["FIELDS"]=> array(1) { ["IBLOCK_SECTION_ID"]=> string(3) "214" } ["PROPERTIES"]=> array(18) { ["KEYWORDS"]=> array(36) { ["ID"]=> string(2) "19" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:46:01" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(27) "Ключевые слова" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "KEYWORDS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "19" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "4" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "Y" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "Y" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(27) "Ключевые слова" ["~DEFAULT_VALUE"]=> string(0) "" } ["SUBMITTED"]=> array(36) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28722" ["VALUE"]=> string(22) "05/10/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "05/10/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL } ["ACCEPTED"]=> array(36) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28723" ["VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL } ["PUBLISHED"]=> array(36) { ["ID"]=> string(2) "22" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Дата публикации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "PUBLISHED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "22" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Дата публикации" ["~DEFAULT_VALUE"]=> NULL } ["CONTACT"]=> array(36) { ["ID"]=> string(2) "23" ["TIMESTAMP_X"]=> string(19) "2015-09-03 14:43:05" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(14) "Контакт" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "CONTACT" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "23" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(14) "Контакт" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHORS"]=> array(36) { ["ID"]=> string(2) "24" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:45:07" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "AUTHORS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "24" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_RU"]=> array(36) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28724" ["VALUE"]=> array(2) { ["TEXT"]=> string(70) "<p>Луна аль-Накуд, Рамез Ваннуз</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(58) "

Луна аль-Накуд, Рамез Ваннуз

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_RU"]=> array(36) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28725" ["VALUE"]=> array(2) { ["TEXT"]=> string(105) "<p>Факультет фармации, университет Дамаска, Сирия</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(93) "

Факультет фармации, университет Дамаска, Сирия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_RU"]=> array(36) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28726" ["VALUE"]=> array(2) { ["TEXT"]=> string(3666) "<p style="text-align: justify;"> Проведены обширные исследования по разработке более безопасных и избирательных противораковых препаратов для снижения токсичности, связанной с терапией. Особое внимание уделяется молекулам, содержащих серусодержащие гетероциклы, так как они рассматриваются как важная структурная единица многих коммерческих препаратов. В нашем университете был разработан ряд производных 2-амино, 5-нитротиазола. Нашей целью было тестирование <i>in vitro</i> трех подобных соединений на темпы роста клеточной линии MDA-MB-231 и на ее способность к миграции. </p> <h3>Материалы и методы</h3> <p style="text-align: justify;">С помощью МТТ-теста определяли цитотоксичность указанных соединений. Скрэтч (scratch)-тест применяли для оценки возможных эффектов этих соединений на миграционную активность клеток линии MDA-MB-231.</p> <h3>Результаты</h3> <p style="text-align: justify;">Два соединения, а именно: 5-нитро-1,3-тиазол-2-амин и 4-{(E)-[(5-нитро-1,3-тиазол-2-ил)имино]метил}бензальдегид, проявили ингибирующий эффект на миграцию раковых клеток, не оказывая при этом влияния на цитотоксичность в отношении линии MDA-MB-231 при использовании их в возрастающих концентрациях (1, 5, 10, 25, 50 и 100 мкМ/л) после 72 часов инкубации (p=0,11 и 0,83, соответственно).</p> <p style="text-align: justify;">Наряду с подавлением клеточной миграции, добавление к клеткам соединения (5E)-5-(4-{(E)-[(5-ниторо-1,3-тиазол-2-ил)имино]метил}бензилиден)имидазолидин-2,4-дион вызывало статистически достоверный цитотоксический эффект на клетках MDA-MB-231 после 72 часов инкубации при концентрации препарата 100 мкМ/л (p=0,016).</p> <h3>Выводы</h3> <p style="text-align: justify;">Производные 2-амино, 5-нитротиазола можно рассматриваться в качестве перспективного исходного вещества для синтеза последующих кандидатных препаратов для лечения метастатического рака молочной железы.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Производные тиазола, рак молочной железы, трижды негативный, линия клеток, MDA-MB-231, подавление роста, подавление миграции.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(3474) "

Проведены обширные исследования по разработке более безопасных и избирательных противораковых препаратов для снижения токсичности, связанной с терапией. Особое внимание уделяется молекулам, содержащих серусодержащие гетероциклы, так как они рассматриваются как важная структурная единица многих коммерческих препаратов. В нашем университете был разработан ряд производных 2-амино, 5-нитротиазола. Нашей целью было тестирование in vitro трех подобных соединений на темпы роста клеточной линии MDA-MB-231 и на ее способность к миграции.

Материалы и методы

С помощью МТТ-теста определяли цитотоксичность указанных соединений. Скрэтч (scratch)-тест применяли для оценки возможных эффектов этих соединений на миграционную активность клеток линии MDA-MB-231.

Результаты

Два соединения, а именно: 5-нитро-1,3-тиазол-2-амин и 4-{(E)-[(5-нитро-1,3-тиазол-2-ил)имино]метил}бензальдегид, проявили ингибирующий эффект на миграцию раковых клеток, не оказывая при этом влияния на цитотоксичность в отношении линии MDA-MB-231 при использовании их в возрастающих концентрациях (1, 5, 10, 25, 50 и 100 мкМ/л) после 72 часов инкубации (p=0,11 и 0,83, соответственно).

Наряду с подавлением клеточной миграции, добавление к клеткам соединения (5E)-5-(4-{(E)-[(5-ниторо-1,3-тиазол-2-ил)имино]метил}бензилиден)имидазолидин-2,4-дион вызывало статистически достоверный цитотоксический эффект на клетках MDA-MB-231 после 72 часов инкубации при концентрации препарата 100 мкМ/л (p=0,016).

Выводы

Производные 2-амино, 5-нитротиазола можно рассматриваться в качестве перспективного исходного вещества для синтеза последующих кандидатных препаратов для лечения метастатического рака молочной железы.

Ключевые слова

Производные тиазола, рак молочной железы, трижды негативный, линия клеток, MDA-MB-231, подавление роста, подавление миграции.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["DOI"]=> array(36) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28727" ["VALUE"]=> string(39) "10.18620/ctt-1866-8836-2022-11-2-99-106" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(39) "10.18620/ctt-1866-8836-2022-11-2-99-106" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_EN"]=> array(36) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28730" ["VALUE"]=> array(2) { ["TEXT"]=> string(49) "<p>Luna Al-Nackoud, Ramez Wannous</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(37) "

Luna Al-Nackoud, Ramez Wannous

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_EN"]=> array(36) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28731" ["VALUE"]=> array(2) { ["TEXT"]=> string(560) "<p>Faculty of Pharmacy, Damascus University, Damascus, Syria</p> <p><b>Correspondence:</b><br> Prof. Ramez Wannous, Department of Pharmacology, Faculty of Pharmacy, Damascus University, Damascus, Syria<br> Phone: 00963937804281<br> E-mail: r.wannous@gmail.com</p><br> <p><b>Citation:</b> Al-Nackoud L, Wannous R. In vitro antiproliferative and antimigration activity against MDA-MB-231 cell line of new thiazole derivatives. Cell Ther Transplant 2022; 11(2): 99-106.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(476) "

Faculty of Pharmacy, Damascus University, Damascus, Syria

Correspondence:
Prof. Ramez Wannous, Department of Pharmacology, Faculty of Pharmacy, Damascus University, Damascus, Syria
Phone: 00963937804281
E-mail: r.wannous@gmail.com

Citation: Al-Nackoud L, Wannous R. In vitro antiproliferative and antimigration activity against MDA-MB-231 cell line of new thiazole derivatives. Cell Ther Transplant 2022; 11(2): 99-106.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_EN"]=> array(36) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28732" ["VALUE"]=> array(2) { ["TEXT"]=> string(2154) "<p style="text-align: justify;"> Extensive studies are performed in order to develop more safe and selective anticancer drugs in terms of decreasing treatment-associated toxicity. Special attention has been paid to molecules containing sulfur heterocycles as they consider an important structural unit of many marketed drugs. A series of 2-amino, 5-nitrothiazole derivatives were designed by our University. We aimed for <i>in vitro</i> testing of three compounds upon growth rates of MDA-MB-231 cell line and its ability for migration. </p> <h3>Materials and methods</h3> <p style="text-align: justify;">Cytotoxicity of the mentioned compounds against the MDA-MB-231 cell line was assessed using MTT assay. Scratch assay was used to determine the possible effects of compounds on the migratory capacity of MDA-MB-231.</p> <h3>Results</h3> <p style="text-align: justify;">Two compounds, i.e., 5-nitro-1,3-thiazol-2-amine and 4-{(E)-[(5-nitro-1,3-thiazol-2-yl)imino]methyl}<br>benzaldehyde showed an inhibitory effect upon cancer cell migration while showing, no effect on the cytotoxicity of the MDA-MB-231 cancer cell line at increasing concentrations (1, 5, 10, 25, 50, and 100 μM/L) after 72 hours of incubation (with p.value=0.1076 and 0.8171 respectively). In addition to cell migration inhibition, the derivate compound (5E)-5-(4-{(E)-[(5-nitro-1,3-thiazol-2-yl)imino]methyl}benzylidene)imidazolidine-2,4-dione showed a statistically significant cytotoxic effect upon MDA-MB-231 cell line following 72-h incubation at the drug concentration of 100 μM/L (p=0.0164).</p> <h3>Conclusion</h3> <p style="text-align: justify;">The derivatives of 2-amino, 5-nitrothiazole are considered a promising starting point to synthesize further drug candidates to treat metastatic breast cancer.</p> <h2>Keywords</h2> <p style="text-align: justify;">Thiazole derivatives, breast cancer, triple negative, cell line, MDA-MB-231, growth suppression, anti-migratory effect.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1978) "

Extensive studies are performed in order to develop more safe and selective anticancer drugs in terms of decreasing treatment-associated toxicity. Special attention has been paid to molecules containing sulfur heterocycles as they consider an important structural unit of many marketed drugs. A series of 2-amino, 5-nitrothiazole derivatives were designed by our University. We aimed for in vitro testing of three compounds upon growth rates of MDA-MB-231 cell line and its ability for migration.

Materials and methods

Cytotoxicity of the mentioned compounds against the MDA-MB-231 cell line was assessed using MTT assay. Scratch assay was used to determine the possible effects of compounds on the migratory capacity of MDA-MB-231.

Results

Two compounds, i.e., 5-nitro-1,3-thiazol-2-amine and 4-{(E)-[(5-nitro-1,3-thiazol-2-yl)imino]methyl}
benzaldehyde showed an inhibitory effect upon cancer cell migration while showing, no effect on the cytotoxicity of the MDA-MB-231 cancer cell line at increasing concentrations (1, 5, 10, 25, 50, and 100 μM/L) after 72 hours of incubation (with p.value=0.1076 and 0.8171 respectively). In addition to cell migration inhibition, the derivate compound (5E)-5-(4-{(E)-[(5-nitro-1,3-thiazol-2-yl)imino]methyl}benzylidene)imidazolidine-2,4-dione showed a statistically significant cytotoxic effect upon MDA-MB-231 cell line following 72-h incubation at the drug concentration of 100 μM/L (p=0.0164).

Conclusion

The derivatives of 2-amino, 5-nitrothiazole are considered a promising starting point to synthesize further drug candidates to treat metastatic breast cancer.

Keywords

Thiazole derivatives, breast cancer, triple negative, cell line, MDA-MB-231, growth suppression, anti-migratory effect.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["NAME_EN"]=> array(36) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28728" ["VALUE"]=> string(110) "In-vitro antiproliferative and antimigration activity against MDA-MB-231 cell line of new thiazole derivatives" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(110) "In-vitro antiproliferative and antimigration activity against MDA-MB-231 cell line of new thiazole derivatives" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" } ["FULL_TEXT_RU"]=> &array(36) { ["ID"]=> string(2) "42" ["TIMESTAMP_X"]=> string(19) "2015-09-07 20:29:18" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(23) "Полный текст" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(12) "FULL_TEXT_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "42" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(23) "Полный текст" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["PDF_RU"]=> array(36) { ["ID"]=> string(2) "43" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF RUS" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_RU" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "43" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28729" ["VALUE"]=> string(4) "2901" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2901" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF RUS" ["~DEFAULT_VALUE"]=> string(0) "" } ["PDF_EN"]=> array(36) { ["ID"]=> string(2) "44" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF ENG" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "44" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28733" ["VALUE"]=> string(4) "2902" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2902" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF ENG" ["~DEFAULT_VALUE"]=> string(0) "" } ["NAME_LONG"]=> array(36) { ["ID"]=> string(2) "45" ["TIMESTAMP_X"]=> string(19) "2023-04-13 00:55:00" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(72) "Название (для очень длинных заголовков)" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "NAME_LONG" ["DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "45" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(80) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(72) "Название (для очень длинных заголовков)" ["~DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } } } ["DISPLAY_PROPERTIES"]=> array(10) { ["AUTHOR_EN"]=> array(37) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28730" ["VALUE"]=> array(2) { ["TEXT"]=> string(49) "<p>Luna Al-Nackoud, Ramez Wannous</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(37) "

Luna Al-Nackoud, Ramez Wannous

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(37) "

Luna Al-Nackoud, Ramez Wannous

" } ["SUMMARY_EN"]=> array(37) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28732" ["VALUE"]=> array(2) { ["TEXT"]=> string(2154) "<p style="text-align: justify;"> Extensive studies are performed in order to develop more safe and selective anticancer drugs in terms of decreasing treatment-associated toxicity. Special attention has been paid to molecules containing sulfur heterocycles as they consider an important structural unit of many marketed drugs. A series of 2-amino, 5-nitrothiazole derivatives were designed by our University. We aimed for <i>in vitro</i> testing of three compounds upon growth rates of MDA-MB-231 cell line and its ability for migration. </p> <h3>Materials and methods</h3> <p style="text-align: justify;">Cytotoxicity of the mentioned compounds against the MDA-MB-231 cell line was assessed using MTT assay. Scratch assay was used to determine the possible effects of compounds on the migratory capacity of MDA-MB-231.</p> <h3>Results</h3> <p style="text-align: justify;">Two compounds, i.e., 5-nitro-1,3-thiazol-2-amine and 4-{(E)-[(5-nitro-1,3-thiazol-2-yl)imino]methyl}<br>benzaldehyde showed an inhibitory effect upon cancer cell migration while showing, no effect on the cytotoxicity of the MDA-MB-231 cancer cell line at increasing concentrations (1, 5, 10, 25, 50, and 100 μM/L) after 72 hours of incubation (with p.value=0.1076 and 0.8171 respectively). In addition to cell migration inhibition, the derivate compound (5E)-5-(4-{(E)-[(5-nitro-1,3-thiazol-2-yl)imino]methyl}benzylidene)imidazolidine-2,4-dione showed a statistically significant cytotoxic effect upon MDA-MB-231 cell line following 72-h incubation at the drug concentration of 100 μM/L (p=0.0164).</p> <h3>Conclusion</h3> <p style="text-align: justify;">The derivatives of 2-amino, 5-nitrothiazole are considered a promising starting point to synthesize further drug candidates to treat metastatic breast cancer.</p> <h2>Keywords</h2> <p style="text-align: justify;">Thiazole derivatives, breast cancer, triple negative, cell line, MDA-MB-231, growth suppression, anti-migratory effect.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1978) "

Extensive studies are performed in order to develop more safe and selective anticancer drugs in terms of decreasing treatment-associated toxicity. Special attention has been paid to molecules containing sulfur heterocycles as they consider an important structural unit of many marketed drugs. A series of 2-amino, 5-nitrothiazole derivatives were designed by our University. We aimed for in vitro testing of three compounds upon growth rates of MDA-MB-231 cell line and its ability for migration.

Materials and methods

Cytotoxicity of the mentioned compounds against the MDA-MB-231 cell line was assessed using MTT assay. Scratch assay was used to determine the possible effects of compounds on the migratory capacity of MDA-MB-231.

Results

Two compounds, i.e., 5-nitro-1,3-thiazol-2-amine and 4-{(E)-[(5-nitro-1,3-thiazol-2-yl)imino]methyl}
benzaldehyde showed an inhibitory effect upon cancer cell migration while showing, no effect on the cytotoxicity of the MDA-MB-231 cancer cell line at increasing concentrations (1, 5, 10, 25, 50, and 100 μM/L) after 72 hours of incubation (with p.value=0.1076 and 0.8171 respectively). In addition to cell migration inhibition, the derivate compound (5E)-5-(4-{(E)-[(5-nitro-1,3-thiazol-2-yl)imino]methyl}benzylidene)imidazolidine-2,4-dione showed a statistically significant cytotoxic effect upon MDA-MB-231 cell line following 72-h incubation at the drug concentration of 100 μM/L (p=0.0164).

Conclusion

The derivatives of 2-amino, 5-nitrothiazole are considered a promising starting point to synthesize further drug candidates to treat metastatic breast cancer.

Keywords

Thiazole derivatives, breast cancer, triple negative, cell line, MDA-MB-231, growth suppression, anti-migratory effect.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(1978) "

Extensive studies are performed in order to develop more safe and selective anticancer drugs in terms of decreasing treatment-associated toxicity. Special attention has been paid to molecules containing sulfur heterocycles as they consider an important structural unit of many marketed drugs. A series of 2-amino, 5-nitrothiazole derivatives were designed by our University. We aimed for in vitro testing of three compounds upon growth rates of MDA-MB-231 cell line and its ability for migration.

Materials and methods

Cytotoxicity of the mentioned compounds against the MDA-MB-231 cell line was assessed using MTT assay. Scratch assay was used to determine the possible effects of compounds on the migratory capacity of MDA-MB-231.

Results

Two compounds, i.e., 5-nitro-1,3-thiazol-2-amine and 4-{(E)-[(5-nitro-1,3-thiazol-2-yl)imino]methyl}
benzaldehyde showed an inhibitory effect upon cancer cell migration while showing, no effect on the cytotoxicity of the MDA-MB-231 cancer cell line at increasing concentrations (1, 5, 10, 25, 50, and 100 μM/L) after 72 hours of incubation (with p.value=0.1076 and 0.8171 respectively). In addition to cell migration inhibition, the derivate compound (5E)-5-(4-{(E)-[(5-nitro-1,3-thiazol-2-yl)imino]methyl}benzylidene)imidazolidine-2,4-dione showed a statistically significant cytotoxic effect upon MDA-MB-231 cell line following 72-h incubation at the drug concentration of 100 μM/L (p=0.0164).

Conclusion

The derivatives of 2-amino, 5-nitrothiazole are considered a promising starting point to synthesize further drug candidates to treat metastatic breast cancer.

Keywords

Thiazole derivatives, breast cancer, triple negative, cell line, MDA-MB-231, growth suppression, anti-migratory effect.

" } ["DOI"]=> array(37) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28727" ["VALUE"]=> string(39) "10.18620/ctt-1866-8836-2022-11-2-99-106" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(39) "10.18620/ctt-1866-8836-2022-11-2-99-106" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(39) "10.18620/ctt-1866-8836-2022-11-2-99-106" } ["NAME_EN"]=> array(37) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28728" ["VALUE"]=> string(110) "In-vitro antiproliferative and antimigration activity against MDA-MB-231 cell line of new thiazole derivatives" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(110) "In-vitro antiproliferative and antimigration activity against MDA-MB-231 cell line of new thiazole derivatives" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(110) "In-vitro antiproliferative and antimigration activity against MDA-MB-231 cell line of new thiazole derivatives" } ["ORGANIZATION_EN"]=> array(37) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28731" ["VALUE"]=> array(2) { ["TEXT"]=> string(560) "<p>Faculty of Pharmacy, Damascus University, Damascus, Syria</p> <p><b>Correspondence:</b><br> Prof. Ramez Wannous, Department of Pharmacology, Faculty of Pharmacy, Damascus University, Damascus, Syria<br> Phone: 00963937804281<br> E-mail: r.wannous@gmail.com</p><br> <p><b>Citation:</b> Al-Nackoud L, Wannous R. In vitro antiproliferative and antimigration activity against MDA-MB-231 cell line of new thiazole derivatives. Cell Ther Transplant 2022; 11(2): 99-106.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(476) "

Faculty of Pharmacy, Damascus University, Damascus, Syria

Correspondence:
Prof. Ramez Wannous, Department of Pharmacology, Faculty of Pharmacy, Damascus University, Damascus, Syria
Phone: 00963937804281
E-mail: r.wannous@gmail.com

Citation: Al-Nackoud L, Wannous R. In vitro antiproliferative and antimigration activity against MDA-MB-231 cell line of new thiazole derivatives. Cell Ther Transplant 2022; 11(2): 99-106.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(476) "

Faculty of Pharmacy, Damascus University, Damascus, Syria

Correspondence:
Prof. Ramez Wannous, Department of Pharmacology, Faculty of Pharmacy, Damascus University, Damascus, Syria
Phone: 00963937804281
E-mail: r.wannous@gmail.com

Citation: Al-Nackoud L, Wannous R. In vitro antiproliferative and antimigration activity against MDA-MB-231 cell line of new thiazole derivatives. Cell Ther Transplant 2022; 11(2): 99-106.

" } ["AUTHOR_RU"]=> array(37) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28724" ["VALUE"]=> array(2) { ["TEXT"]=> string(70) "<p>Луна аль-Накуд, Рамез Ваннуз</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(58) "

Луна аль-Накуд, Рамез Ваннуз

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(58) "

Луна аль-Накуд, Рамез Ваннуз

" } ["SUBMITTED"]=> array(37) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28722" ["VALUE"]=> string(22) "05/10/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "05/10/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "05/10/2022 12:00:00 am" } ["ACCEPTED"]=> array(37) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28723" ["VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "06/24/2022 12:00:00 am" } ["SUMMARY_RU"]=> array(37) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28726" ["VALUE"]=> array(2) { ["TEXT"]=> string(3666) "<p style="text-align: justify;"> Проведены обширные исследования по разработке более безопасных и избирательных противораковых препаратов для снижения токсичности, связанной с терапией. Особое внимание уделяется молекулам, содержащих серусодержащие гетероциклы, так как они рассматриваются как важная структурная единица многих коммерческих препаратов. В нашем университете был разработан ряд производных 2-амино, 5-нитротиазола. Нашей целью было тестирование <i>in vitro</i> трех подобных соединений на темпы роста клеточной линии MDA-MB-231 и на ее способность к миграции. </p> <h3>Материалы и методы</h3> <p style="text-align: justify;">С помощью МТТ-теста определяли цитотоксичность указанных соединений. Скрэтч (scratch)-тест применяли для оценки возможных эффектов этих соединений на миграционную активность клеток линии MDA-MB-231.</p> <h3>Результаты</h3> <p style="text-align: justify;">Два соединения, а именно: 5-нитро-1,3-тиазол-2-амин и 4-{(E)-[(5-нитро-1,3-тиазол-2-ил)имино]метил}бензальдегид, проявили ингибирующий эффект на миграцию раковых клеток, не оказывая при этом влияния на цитотоксичность в отношении линии MDA-MB-231 при использовании их в возрастающих концентрациях (1, 5, 10, 25, 50 и 100 мкМ/л) после 72 часов инкубации (p=0,11 и 0,83, соответственно).</p> <p style="text-align: justify;">Наряду с подавлением клеточной миграции, добавление к клеткам соединения (5E)-5-(4-{(E)-[(5-ниторо-1,3-тиазол-2-ил)имино]метил}бензилиден)имидазолидин-2,4-дион вызывало статистически достоверный цитотоксический эффект на клетках MDA-MB-231 после 72 часов инкубации при концентрации препарата 100 мкМ/л (p=0,016).</p> <h3>Выводы</h3> <p style="text-align: justify;">Производные 2-амино, 5-нитротиазола можно рассматриваться в качестве перспективного исходного вещества для синтеза последующих кандидатных препаратов для лечения метастатического рака молочной железы.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Производные тиазола, рак молочной железы, трижды негативный, линия клеток, MDA-MB-231, подавление роста, подавление миграции.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(3474) "

Проведены обширные исследования по разработке более безопасных и избирательных противораковых препаратов для снижения токсичности, связанной с терапией. Особое внимание уделяется молекулам, содержащих серусодержащие гетероциклы, так как они рассматриваются как важная структурная единица многих коммерческих препаратов. В нашем университете был разработан ряд производных 2-амино, 5-нитротиазола. Нашей целью было тестирование in vitro трех подобных соединений на темпы роста клеточной линии MDA-MB-231 и на ее способность к миграции.

Материалы и методы

С помощью МТТ-теста определяли цитотоксичность указанных соединений. Скрэтч (scratch)-тест применяли для оценки возможных эффектов этих соединений на миграционную активность клеток линии MDA-MB-231.

Результаты

Два соединения, а именно: 5-нитро-1,3-тиазол-2-амин и 4-{(E)-[(5-нитро-1,3-тиазол-2-ил)имино]метил}бензальдегид, проявили ингибирующий эффект на миграцию раковых клеток, не оказывая при этом влияния на цитотоксичность в отношении линии MDA-MB-231 при использовании их в возрастающих концентрациях (1, 5, 10, 25, 50 и 100 мкМ/л) после 72 часов инкубации (p=0,11 и 0,83, соответственно).

Наряду с подавлением клеточной миграции, добавление к клеткам соединения (5E)-5-(4-{(E)-[(5-ниторо-1,3-тиазол-2-ил)имино]метил}бензилиден)имидазолидин-2,4-дион вызывало статистически достоверный цитотоксический эффект на клетках MDA-MB-231 после 72 часов инкубации при концентрации препарата 100 мкМ/л (p=0,016).

Выводы

Производные 2-амино, 5-нитротиазола можно рассматриваться в качестве перспективного исходного вещества для синтеза последующих кандидатных препаратов для лечения метастатического рака молочной железы.

Ключевые слова

Производные тиазола, рак молочной железы, трижды негативный, линия клеток, MDA-MB-231, подавление роста, подавление миграции.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(3474) "

Проведены обширные исследования по разработке более безопасных и избирательных противораковых препаратов для снижения токсичности, связанной с терапией. Особое внимание уделяется молекулам, содержащих серусодержащие гетероциклы, так как они рассматриваются как важная структурная единица многих коммерческих препаратов. В нашем университете был разработан ряд производных 2-амино, 5-нитротиазола. Нашей целью было тестирование in vitro трех подобных соединений на темпы роста клеточной линии MDA-MB-231 и на ее способность к миграции.

Материалы и методы

С помощью МТТ-теста определяли цитотоксичность указанных соединений. Скрэтч (scratch)-тест применяли для оценки возможных эффектов этих соединений на миграционную активность клеток линии MDA-MB-231.

Результаты

Два соединения, а именно: 5-нитро-1,3-тиазол-2-амин и 4-{(E)-[(5-нитро-1,3-тиазол-2-ил)имино]метил}бензальдегид, проявили ингибирующий эффект на миграцию раковых клеток, не оказывая при этом влияния на цитотоксичность в отношении линии MDA-MB-231 при использовании их в возрастающих концентрациях (1, 5, 10, 25, 50 и 100 мкМ/л) после 72 часов инкубации (p=0,11 и 0,83, соответственно).

Наряду с подавлением клеточной миграции, добавление к клеткам соединения (5E)-5-(4-{(E)-[(5-ниторо-1,3-тиазол-2-ил)имино]метил}бензилиден)имидазолидин-2,4-дион вызывало статистически достоверный цитотоксический эффект на клетках MDA-MB-231 после 72 часов инкубации при концентрации препарата 100 мкМ/л (p=0,016).

Выводы

Производные 2-амино, 5-нитротиазола можно рассматриваться в качестве перспективного исходного вещества для синтеза последующих кандидатных препаратов для лечения метастатического рака молочной железы.

Ключевые слова

Производные тиазола, рак молочной железы, трижды негативный, линия клеток, MDA-MB-231, подавление роста, подавление миграции.

" } ["ORGANIZATION_RU"]=> array(37) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28725" ["VALUE"]=> array(2) { ["TEXT"]=> string(105) "<p>Факультет фармации, университет Дамаска, Сирия</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(93) "

Факультет фармации, университет Дамаска, Сирия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(93) "

Факультет фармации, университет Дамаска, Сирия

" } } } [9]=> array(49) { ["IBLOCK_SECTION_ID"]=> string(3) "214" ["~IBLOCK_SECTION_ID"]=> string(3) "214" ["ID"]=> string(4) "2066" ["~ID"]=> string(4) "2066" ["IBLOCK_ID"]=> string(1) "2" ["~IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(269) "Терапевтический потенциал среды, кондиционированной стволовыми клетками костного мозга для ослабления повреждения печени у мышей, вызванного CCl4" ["~NAME"]=> string(269) "Терапевтический потенциал среды, кондиционированной стволовыми клетками костного мозга для ослабления повреждения печени у мышей, вызванного CCl4" ["ACTIVE_FROM"]=> NULL ["~ACTIVE_FROM"]=> NULL ["TIMESTAMP_X"]=> string(22) "08/11/2022 09:11:38 am" ["~TIMESTAMP_X"]=> string(22) "08/11/2022 09:11:38 am" ["DETAIL_PAGE_URL"]=> string(159) "/en/archive/tom-11-nomer-2/eksperimentalnye-issledovaniya/terapevticheskiy-potentsial-sredy-konditsionirovannoy-stvolovymi-kletkami-kostnogo-mozga-dlya-oslabl/" ["~DETAIL_PAGE_URL"]=> string(159) "/en/archive/tom-11-nomer-2/eksperimentalnye-issledovaniya/terapevticheskiy-potentsial-sredy-konditsionirovannoy-stvolovymi-kletkami-kostnogo-mozga-dlya-oslabl/" ["LIST_PAGE_URL"]=> string(12) "/en/archive/" ["~LIST_PAGE_URL"]=> string(12) "/en/archive/" ["DETAIL_TEXT"]=> string(32410) "

Introduction

Following their discovery over 50 years ago, mesenchymal stromal cells (MSCs) have become one of the most studied cellular therapeutic products [1]. A large number of research have shown the beneficial effects of MSCs-based therapies to treat different diseases [2]. Several mechanisms have been proposed to explain the therapeutic effect of mesenchymal stromal cells in repairing damaged tissues.

Yet, many reports do not support the MSCs differentiation to replace injured tissue [3]. Various studies on growth factors derived from mesenchymal stromal cells have shown that the secreted factor alone without the mesenchymal stromal cell itself may cause tissue repair under various conditions including tissue/organ damage [4]. The medium in which mesenchymal stromal cells are cultured and secrete different growth factors and cytokines is called conditioned medium (CM). CM is a promising alternative that can overcome the poor engraftment of the transplanted mesenchymal stromal cells and potential risk of cancer development [5]. It may present a better option in the field of the future regenerative medicine [6]. As compared to cell-based therapies, MSC-CM (non-cell-based) therapies are generally preferred because they are less likely to trigger immune response, thus suggesting their safer usage. They are also more amenable to reformulation to support different routes of administration [7]. In addition, preparation of CM is more economical since it can be produced at large scale from available MSC populations under current good manufacturing practice (cGMP) conditions. Moreover, CM can be stored for a relatively long period without any toxic cryoprotectants, such as dimethyl sulfoxide (DMSO) [6]. Thus, it may be manufactured, freeze-dried, packaged, and transported more easily than mesenchymal stromal cells [5]. However, CM should be administered more frequently because the half-life of cytokines and growth factors are mostly shorter [8]. Therefore, recent studies have used the secreted factors rather than direct application of MSCs [9].

The present study aimed to investigate therapeutic effect of conditioned medium derived from bone marrow mesenchymal stromal cells co-cultured with hepatocytes in alleviation of CCl₄-induced liver damage in mice.

Materials and methods

Animals

Healthy male Balb/c mice (6-8 weeks) were housed in plastic cages, in the room with controlled temperature (24±2°C) and light regimen (12:12 h light/dark cycle), provided with food and water ad libitum. All experimental procedures were performed according to the Guide for the Care and Use of Laboratory Animals and the ethical standards of our institution.

Hepatocyte isolation

Hepatocytes were isolated using a modified two-step ethylenediaminetetraacetic acid (EDTA)/collagenase protocol, according to [10] with slight modifications. The mouse was deeply anesthetized with Isoflurane (Fig. 1). After sterilizing the skin, the abdomen was opened via an upper abdominal transverse incision, and the intestines were pushed to the left of the animal’s torso, to expose the hepatic portal vein (HPV) and the inferior vena cava (IVC). A sterile cannula was inserted into the portal vein for the antegrade perfusion. The cannula was secured using 6-0 silk ties and then was connected to the perfusate tube, avoiding introduction of air. The flow rate (5 mL/min), was controlled by a peristaltic pump. The liver was first perfused with calcium and magnesium-free Hank’s balanced salt solution (Sigma-Aldrich, USA), containing 0.5 mM EDTA at 5 mL/min for 7 min. Once the solution begins to perfuse the liver, the vena cava was cut for blood/fluid drainage. The liver was then perfused with calcium and magnesium-free Hank’s balanced salt solution, containing 1 mg/mL collagenase (Sigma-Aldrich, USA), and 5 mmol/L CaCl₂ at 5 mL/min for 7 min.

Figure 1. Mouse hepatocytes isolation (perfusion method). (I): Pictorial representation of perfusion system setup (A: surgical table, B: anesthesia machine, C: perfusion tube, D: perfusion solution, E: water bath for warming perfusion media, F: peristaltic pump), (a): Gas anesthesia with Isoflurane. (b): The abdomen was opened, exposing the hepatic portal vein (HPV) and the inferior vena cava (IVC). (c): Silk ties were used to secure the catheter. (d): IV catheter inserted into the portal vein, and connected to the perfusion tube (e): The vena cava was cut for blood/fluid drainage. (f): The liver should blanch while the blood is flushed out.

All the perfusion solutions were pre-warmed and maintained at 37°C. The perfusion was considered successful when the whole organ was completely blanched and the endpoint when the tissue was visibly digested and the capsule started to separate from the organ surface. The liver was removed and placed in a petri dish with RPMI (37°C), and the Glisson’s capsule enclosing the liver was carefully separated using a pair of forceps, in order to disperse the hepatocytes. The resulting cell suspension was passed through a 65-µm nylon mesh to remove cell clumps. The suspension was then centrifuged at 1000 rpm for 2-3 min. The supernatant was discarded, and the remaining cell suspension was washed three times with RPMI. The hepatocyte pellet was gently resuspended in RPMI, and the viability was determined by trypan blue exclusion method.

Co-culture of mouse BMSCs and hepatocytes

BMSCs were isolated from the tibias and femurs of intact BALB/c mice using flushing method. For co-culture of BMSCs and hepatocytes, 1.5×10⁶ BMSCs (at passage 0 (P0)) were cultured in serum-free RPMI medium in order to exclude possible effects on liver regeneration caused by fetal bovine serum (FBS), and incubated at 37°C with 5% humidified CO₂ for 4 h. Once BMSCs were attached to the flask, the culture medium was discarded and 1.5×10⁶ of freshly isolated hepatocytes were added to the culture.

Following ca. 20 hours of hepatocyte-BMSCs co-culture, the conditioned medium was collected and centrifuged at 1000 rpm for 10 min, then filtered (0.22 µm pore size) and kept at -80°C until use.

Experimental Protocol

The model liver injury was induced by CCl₄. The mice were injected intraperitoneally with CCl₄ (1 mL/kg body weight) dissolved in olive oil, twice a week for 7 weeks. Then, the mice were injected into the tail vein with 0.2 ml of conditioned medium (CM) from the co-culture of hepatocytes and BMSC (CM group), or with (0.2 ml) of serum-free RPMI medium as vehicle control (RPMI group). Four weeks after CM treatment, all animals were sacrificed, and their livers and venous blood were collected.

The body mass and liver weight in the mice were determined at the end of the experiment. The liver-to-body weight ratio was calculated as follows: Liver-to-body ratio = (liver weight (g)/(mouse body weight (g)-liver weight (g) *100.

Biochemical indices, cytokines and histopathology

At the time of sacrificing, venous blood samples were collected and centrifuged at 3000 rpm for 5 minutes to separate blood serum. The levels of albumin, alanine aminotransferase (ALT), aspartate transaminase (AST) and alkaline phosphatase (ALP) in the serum were detected. Serum interleukin-4 (IL-4) and IFN-γ levels were detected by ELISA kits (Sun Red, China) according to the manufacturer’s instructions.

Liver tissue samples were collected and fixed in 10% formalin. The specimens were then processed to form paraffin sections and stained with hematoxylin and eosin (H&E). The sections were examined for histopathological changes under light microscope.

Statistical analysis

All values were presented as mean ± SD. The statistical difference was analyzed using t-test for independent samples (SPSS 17 software). P<0.05 was considered statistically significant.

Results

Isolation and culture of hepatocytes

The yield of viable hepatocytes was (83.46×10⁶), and their viability was 78%. Isolated hepatocytes were examined under an inverted microscope (Fig. 2). Freshly isolated hepatocytes were round-shaped and suffered from stress, presumably, due to the isolation process. With time, the cells gradually recovered from the stress. 24 hours later, the hepatocytes showed a cubic morphology that resembles the organization of liver tissue, with clear and distinct nuclei (some of them are bi-nucleated).

Figure 2. Light-microscopic pictures of cultured mouse hepatocytes. Hepatocytes show a cubic morphology and a clear and distinct nucleus. Some bi-nucleated cells were found

Distribution of murine BMSCs and hepatocytes in co-culture

The hepatocytes in co-culture appeared in small cell clusters, with the presence of BMSCs intermingled throughout the hepatocyte culture (Fig. 3). Most BMSCs attached to the culture flask surface, and hepatocytes attached to the BMSCs layer.

Figure 3. Light-microscopic pictures of mouse of BMSC/hepatocytes co-culture

Effects of CM treatment on liver and body weight

The results of this study showed non-significant differences in the liver weight to body weight ratio in CM treated group compared to the RPMI group (Table 1).

Table 1. Body weights, liver weights and liver-to-body weight ratios of the studied groups

All values are represented as mean ± SD. Mean values with different letters over the same column are significantly different at (P<0.05).

Biochemical serum indexes

CM treated group showed significantly decreased serum levels of ALT and AST compared to RPMI group. The levels of albumin and ALP were not significantly different (Table 2).

Table 2. Serum levels of ALT, AST, ALP, and albumin in the studied groups

All values are represented as mean ± SD. Mean values with different letters over the same column are significantly different at (P<0.05).

Histopathology

The liver in the RPMI-treated group exposed to CCl₄ demonstrated irregular surface upon morphologic examination. They had rough surface with necrotic spots. The livers were slightly swollen, and showed decreased glossiness, with a pale brown color. In the mice receiving CM treatment, the surface of the liver was slightly rough, less swollen, more reddish, and lustrous than in those from the RPMI group. Necrotic spots on the surface were noticeably reduced (Fig. 4).

Figure 4. Morphologic examination of the livers. (A) In the RPMI group, the liver had irregular surface with necrotic spots and showed pale brown color. (B) In the mice receiving CM-treatment, the liver surface was slightly coarse, less swollen, more reddish, and lustrous than those of the RPMI group

The results of histological analysis are shown in Fig. 5. In the CCl₄-exposed RPMI group, the livers showed loss of normal architecture. The cord-like arrangement of hepatocytes was disrupted. The main histopathologic findings were marked hepatocellular necrosis, hepatocytes were swollen with vacuolated cytoplasm. In some specimens we observed severe infiltration with inflammatory cells, vascular dilatation and congestion. Dilated blood sinusoids were also observed in some parts.

These histopathological changes were remarkably alleviated in histological sections of CM-treated group. The sections showed nearly normal organization of hepatic lobules. The cord-like arrangement of hepatocytes was restored, as well as minimal disruption of hepatic cellular structure, well-preserved cytoplasm, reduced inflammation with low presence of inflammatory cells.

Figure 5. H&E-stained sections in the livers of the experimental groups. (A, F). RPMI group. A-B. Marked affection with disorganization of hepatic architecture, hepatocytes necrosis (N) can be seen. C, D. severe infiltration of inflammatory cells. E. hepatocytes with vacuolated cytoplasm (arrows). F. Vascular congestion (arrows). (G, H). CM treated group. Nearly normal organization of hepatic lobules. Hepatocytes appeared nearly similar to that of the normal mouse.

Detection of cytokines

Serum IL-4 and IFN-γ levels were detected by ELISA. IL-4 level considerably increased in CM treated group compared with the RPMI group. CM treatment did not affect the level of IFN-γ compared to RPMI group (Fig. 6).

Figure 6. Serum levels of IL-4 (pg/ml), and IFN-γ (pg/ml) cytokines. Serum were collected one month after CM treatment, and cytokines were measured with ELISA assay

Discussion

Bone marrow mesenchymal stromal cells MSC(M) were isolated, cultured, and characterized in our previous study [11].

In the current study, the conditioned medium was prepared by co-culture of hepatocytes with BMSCs at passage 0 (P0 BMSCs), in order to avoid the decline in cell functions with further passaging [12].

Various methods have been employed in attempt to isolate hepatocytes. These include mechanical, chemical, and enzymatic methods [13]. In this study, two-step EDTA/collagenase protocol was used to isolate hepatocytes. Collagenase perfusion of the liver to obtain hepatocytes has been performed since the early 1950s and has been permanently improved [14]. In this study, the liver was perfused via the portal vein instead of vena cava due to its ease of access within abdomen and that this vein feeds directly into the liver [14]. The whole isolation procedure, from the animal anesthesia to cell seeding, was completed as quickly as possible (in 40-50 min) to obtain sufficient number of viable cells, and we obtained a high cellular yield with good viability.

At the first step, removal of calcium ions by EDTA from epithelial cells is essential to disrupt the Ca²⁺dependent E-cadherin molecules between adjacent hepatocytes which results in rapid destruction of intercellular junctions resulting in loss of cell-to-cell contacts, and thus improving quantity and quality of the dispersed hepatocytes. At the second step, we introduced collagenase into the liver lobes thus causing disruption of the supporting extracellular matrix. Ca²⁺ is added to the perfusion medium with collagenase, since the presence of Ca²⁺ is required for enzymatic activity of collagenase during the perfusion [15]. Low-speed centrifugation was used to isolate hepatocytes since the viable hepatocytes have higher density and can be easily purified from the non-parenchymal cells and dead hepatocytes [14].

Liver diseases affect approximately 17.5% of the population. According to World Health Organization statistics, more than a hundred million people worldwide are suffering from liver disease [16]. The limited half-life of transplanted cells, potential tumorigenic risk, and other risks of MSCs have led to the further development of acellular therapies [17]. Therapy with conditioned medium derived from mesenchymal stromal cells is a rapidly advancing field that may exert substantial impact on the treatment of different diseases/conditions [5]. Various mesenchymal stromal cell-derived conditioned media were produced by different approaches and processing, and tested in various diseases, mostly showing good results [4]. Hepatocytes and mesenchymal stromal cells (MSCs) are attractive sources of cell-based therapies for the liver diseases. The co-transplantation of hepatocytes and MSCs may improve therapeutic efficiency for the treatment of liver injury. In this study, we have tested the synergistic effect of the factors or secretome produced by hepatocytes and BMSCs in enhancing the regenerative capacity of liver.

To induce liver injury in mice, CCl₄ was used. Carbon tetrachloride is one of the most commonly used hepatotoxins as an experimental model of liver disease [18]. CCl₄ is metabolized in the liver via mitochondrial cytochrome P450 (CYP450), and the resulting free radicals damage the lipid membranes of hepatocytes by lipid peroxidation, thus leading to the release of cellular contents into the extracellular matrix (ECM), which generates a myriad of inflammatory signals in the liver. High level of inflammation leads to apoptosis and further liver damage [19].

Our results showed a marked decrease in the levels of ALT and AST enzymes in the CM-treated group compared to the RPMI group (controls). Serum ALT and AST are usually elevated in liver damage [20]. ALT and AST are enzymes basically located within hepatocytes. Hence, when liver cells are damaged or die, the transaminases are released into bloodstream, where they can be measured. Therefore, their levels reflect the degree of liver injury [18]. However, the decrease in ALT and AST levels after CM treatment suggests that H/BMSCs CM may promote regenerative capacity of the liver and improve injured liver tissue. On the other hand, no improvement was observed in hepatocyte functions in terms of albumin secretion.

The therapeutic effect of CM in the liver damage caused by CCl₄ was evident by comparing the histological sections of the liver in the studied groups. Histological study results were in consistent with biochemical results (alleviation of Alt and AST levels). The liver in the RPMI group demonstrated irregular morphology at morphologic examination. Microscopical examination also showed several histopathological changes induced by CCl₄. These results supported that 7 weeks of CCl₄ administration clearly altered the liver structure and health, causing liver damage and changes to macroscopic pattern of the mouse liver. A considerable improvement in external morphology and histopathological changes and in the hepatic lobular architecture was observed after CM treatment of mice.

Serum IFN-γ and IL-4 levels were detected by ELISA. The serum IL-4 level considerably increased after CM treatment. This result proves the therapeutic effect of H/BMSCs CM. IL-4 is one of the widely acknowledged immune regulatory cytokines able to suppress inflammation [21]. This cytokine commonly represents Th2 responses [22]. However, the results indicated that CM treatment did not affect the release of IFN-γ.

In summary, H/BMSCs CM treatment was effective in alleviation of CCl₄-induced liver damage in mice. This treatment may present a novel adjunctive therapy in drug-induced liver toxicity. CM is mediating this effect, probably, through maintaining the liver homeostasis which primarily includes induction of hepatocyte regeneration [7].

It is shown that MSC-conditioned media (MSC-CM) contain a variety of cytokines, chemokines, and growth factors, such as vascular endothelial growth factor (VEGF), epidermal growth factor (EGF), keratinocyte growth factor (KGF), angiopoietin-1, erythropoietin, and stromal derived factor-1 (SDF-1), which have multiple positive impacts on tissue regeneration [3]. The liver trophic factors secreted by MSCs, in particular, hepatocyte growth factor (HGF) could be the crucial player in liver regeneration [9].

Hepatocytes also secrete various cytokines that modulate both hepatocyte metabolism and liver inflammation [23]. Previous study identified over 200 proteins in the conditioned medium of rat hepatocyte including plasma, extracellular, and intracellular proteins [24]. Another report identified 691 secreted proteins in the conditioned medium of primary human hepatocytes, such as alpha-1-antitrypsin, alpha-1-antichymotrypsin, alpha-1-acid glycoprotein 1, and albumin. Different factors in CM derived from hypatocytes cocultured with BMSCs act together to promote regeneration [25]. Previous study showed that the culture of human hepatocytes (HCs) in medium previously conditioned by cocultured HCs and MSCs demonstrated improved function, whereas no effect was observed when HCs cultured in medium conditioned by MSCs alone, which indicates that the presence of HCs is needed to stimulate MSCs to produce the relevant factors/cytokines in the culture medium [26].

Further studies are required to evaluate efficacy and safety of CM therapy, and to determine optimal cell source, culture conditions, duration of medium conditioning, the optimal injection route and dosage which can profoundly affect clinical outcome, and to elucidate the exact mechanism of action. Hence, the intended therapeutic effect may be translated and optimized, in order to develop standardized methods for production of various conditioned media and validation of their usage in various diseases.

Conclusion

Our results indicate that H/BMSCs CM is effective in stimulating liver regeneration after CCl₄-induced injury. Despite great number of promising results with mesenchymal stromal cell-conditioned media, and the need for efficient treatment of the patients suffering from liver diseases, the use of CM in human clinical trials needs more studies to analyze and characterize the cytokines and growth factors secreted in CM in order to understand the effects of these compositions on different body tissues, and to make sure that this CM does not have the potential to cause severe adverse effects in humans. We also need to try CM of different mesenchymal stromal cells to achieve maximal healing effect in different diseases. We hope that this research will stimulate and encourage such efforts towards harnessing the therapeutic potential of the CM.

Conflict of interest

None declared.

Acknowledgments

The authors are grateful to the Leishmania center of Epidemiological and Biological Studies, Dr. Ruba Joujeh, Dr. Hassan Alkhoury, Dr. Ahmad Kanameh for their help and support. This research was funded by the University of Aleppo.

References

1. Wright A, Arthaud-day ML, Weiss ML. Therapeutic Use of Mesenchymal Stromal Cells: The Need for Inclusive Characterization Guidelines to Accommodate All Tissue Sources and Species, Front. Cell Dev. Biol, 9, 1-18 (2021).
2. Hmadcha A, Martin-Montalvo A, Gauthier BR, Soria B, Capilla-Gonzalez V. Therapeutic Potential of Mesenchymal Stem Cells for Cancer Therapy, Front. Bioeng. Biotechnol, 8(43), 1-13 (2020).
3. Saheli M, Bayat M, Ganji R, Hendudari F, Kheirjou R, Pakzad M, Najar B, Piryaei A. Human mesenchymal stem cells-conditioned medium improves diabetic wound healing mainly through modulating fibroblast behaviors. Arch Dermatol Res. 2020; 312(5):325-336. doi: 10.1007/s00403-019-02016-6
4. Pawitan JA. Prospect of stem cell conditioned medium in regenerative medicine. Biomed Res Int. 2014;2014:965849.
   doi: 10.1155/2014/965849
5. Mehling BM, Manvelyan M, Benesh G, Wu DC. Characterization of human umbilical cord mesenchymal stem cells-derived conditioned medium. J. Stem Cell Res. Ther. 2016; 1(6): 218-220. doi: 10.15406/jsrt.2016.01.00038
6. Pokrovskaya LA, Zubareva EV, Nadezhdin SV, Lysenko AS, Litovkina TI. Biological activity of mesenchymal stem cells secretome as a basis for cell-free therapeutic approach. Res Results Pharmacol. 2020; 6, 57-68. doi: 10.3897/rrpharmacology.6.49413
7. Tan CY, Lai RC, Wong W, Dan YY, Lim SK, Ho HK. Mesenchymal stem cell-derived exosomes promote hepatic regeneration in drug-induced liver injury models. Stem Cell Res Ther. 2014; 5(3):76. doi: 10.1186/scrt465. PMID: 24915963
8. Aal SA, Abdelrahman SA, Raafat N. Comparative therapeutic effects of mesenchymal stem cells versus their conditioned media in alleviation of CCL4-induced liver fibrosis in rats: Histological and biochemical study. JMH. 2019; 3(1):1-20.
   doi: 10.21608/jmh.2019.10310.1051
9. Azhdari Tafti Z, Mahmoodi M, Hajizadeh MR, Ezzatizadeh V, Baharvand H, Vosough M, Piryaei A. Conditioned media derived from human adipose tissue mesenchymal stromal cells improves primary hepatocyte maintenance. Cell J. 2018; 20(3):377-387.
   doi: 10.22074/cellj.2018.5288
10. Weglarz TC, Degen JL, Sandgren EP. Hepatocyte transplantation into diseased mouse liver. Kinetics of parenchymal repopulation and identification of the proliferative capacity of tetraploid and octaploid hepatocytes. Am J Pathol. 2000; 157(6):1963-1974.
    doi: 10.1016/S0002-9440(10)64835-3
11. Joujeh D, Ghrewaty A, Soukkarieh C, Almarrawi A and Darwicha J. An optimized protocol for mouse bone marrow mesenchymal stromal cells isolation and culture. Cell Ther Transplant,10(3-4): 61-70 (2021).
12. Jiang T, Xu G, Wang Q, Yang L, Zheng L, Zhao J, Zhang X. In vitro expansion impaired the stemness of early passage mesenchymal stem cells for treatment of cartilage defects. Cell Death Dis. 2017; 8:2851. doi: 10.1038/cddis.2017.215
13. Lee D, Lee K. Hepatocyte isolation, culture, and its clinical applications. Hanyang Med Rev 2014; 34(4):165-172.
    doi: 10.7599/hmr.2014.34.4.165
14. Cabral F, Miller CM, Kudrna KM, Hass BE, Daubendiek JG, Kellar BM, Harris EN. Purification of hepatocytes and sinusoidal endothelial cells from mouse liver perfusion. J Vis Exp. 2018 Feb 12;(132):56993. doi: 10.3791/56993
15. Li WC, Ralphs KL, Tosh D. Isolation and culture of adult mouse hepatocytes. Methods Mol Biol. 2010; 633:185-196.
    doi: 10.1007/978-1-59745-019-5_13
16. Sarvandi SS, Joghataei MT, Parivar K, Khosravi M, Sarveazad A, Sanadgol N. In vitro differentiation of rat mesenchymal stem cells to hepatocyte lineage. Iran J Basic Med Sci. 18(1), 89-97. PMID: 25810881
17. Driscoll J, Patel T. The mesenchymal stem cell secretome as an acellular regenerative therapy for liver disease. J Gastroenterol. 2019; 54(9):763-773. doi: 10.1007/s00535-019-01599-1
18. Moharib M, Hammam O, Salman F, El-naggar M, Sherif S. Transplantation of Modified and Fresh Hepatocyte Reduces Hepatotoxicity Induced by Carbon Tetrachloride. Life Sci J. 2014; 11(8): 641-652.
19. Mishra AP, Siva AB, Gurunathan C, Komala Y, Lakshmi BJ. Impaired liver regeneration and lipid homeostasis in CCl4 treated WDR13 deficient mice. Lab Anim Res. 2020;36(1):41. doi: 10.1186/s42826-020-00076-8
20. Gaim K, Gebru G, Abba S. The effect of arsenic on liver tissue of experimental animals (fishes and mice) – A review article. Int J Sci Res Publ. 2015; 5(1), 1-9.
21. Ma K, Gong T, Ao Q, Yan Y, Song B, Huang H, et al. Intracerebral transplantation of adipose-derived mesenchymal stem cells alternatively activates microglia and ameliorates neuropathological deficits in Alzheimer’ s disease mice. Cell Transplant. 2013; 22(1):113-126. doi: 10.3727/096368913X672181
22. Njoku DB. Suppressive and pro-inflammatory roles for IL-4 in the pathogenesis of experimental drug-induced liver injury: a review. Expert Opin Drug Metab Toxicol. 2010; 6(5):519-531. doi: 10.1517/17425251003601979
23. Sheng L, Jiang B, Rui L. Intracellular lipid content is a key intrinsic determinant for hepatocyte viability and metabolic and inflammatory states in mice. Am J Physiol Endocrinol Metab. 2013; 305(9):E1115-23. doi: 10.1152/ajpendo.00401.2013
24. Farkas D, Bhat VB, Mandapati S, Wishnok JS, Tannenbaum SR. Characterization of the secreted proteome of rat hepatocytes cultured in collagen sandwiches. Chem Res Toxicol. 2005; 18(7):1132-1139. doi: 10.1021/tx0500225
25. Franko A, Hartwig S, Kotzka J, Ruoß M, Nüssler AK, Königsrainer A, et al. Identification of the secreted proteins originated from primary human hepatocytes and HepG2 cells. Nutrients. 2019; 11(8):1795. doi: 10.3390/nu11081795
26. Fitzpatrick E, Wu Y, Dhadda P, Hughes RD, Mitry RR, Qin H, et al. Coculture with mesenchymal stem cells results in improved viability and function of human hepatocytes. Cell Transplant. 2015; 24(1):73-83. doi: 10.3727/096368913X674080

" ["~DETAIL_TEXT"]=> string(32410) "

Introduction

Following their discovery over 50 years ago, mesenchymal stromal cells (MSCs) have become one of the most studied cellular therapeutic products [1]. A large number of research have shown the beneficial effects of MSCs-based therapies to treat different diseases [2]. Several mechanisms have been proposed to explain the therapeutic effect of mesenchymal stromal cells in repairing damaged tissues.

Yet, many reports do not support the MSCs differentiation to replace injured tissue [3]. Various studies on growth factors derived from mesenchymal stromal cells have shown that the secreted factor alone without the mesenchymal stromal cell itself may cause tissue repair under various conditions including tissue/organ damage [4]. The medium in which mesenchymal stromal cells are cultured and secrete different growth factors and cytokines is called conditioned medium (CM). CM is a promising alternative that can overcome the poor engraftment of the transplanted mesenchymal stromal cells and potential risk of cancer development [5]. It may present a better option in the field of the future regenerative medicine [6]. As compared to cell-based therapies, MSC-CM (non-cell-based) therapies are generally preferred because they are less likely to trigger immune response, thus suggesting their safer usage. They are also more amenable to reformulation to support different routes of administration [7]. In addition, preparation of CM is more economical since it can be produced at large scale from available MSC populations under current good manufacturing practice (cGMP) conditions. Moreover, CM can be stored for a relatively long period without any toxic cryoprotectants, such as dimethyl sulfoxide (DMSO) [6]. Thus, it may be manufactured, freeze-dried, packaged, and transported more easily than mesenchymal stromal cells [5]. However, CM should be administered more frequently because the half-life of cytokines and growth factors are mostly shorter [8]. Therefore, recent studies have used the secreted factors rather than direct application of MSCs [9].

The present study aimed to investigate therapeutic effect of conditioned medium derived from bone marrow mesenchymal stromal cells co-cultured with hepatocytes in alleviation of CCl₄-induced liver damage in mice.

Materials and methods

Animals

Healthy male Balb/c mice (6-8 weeks) were housed in plastic cages, in the room with controlled temperature (24±2°C) and light regimen (12:12 h light/dark cycle), provided with food and water ad libitum. All experimental procedures were performed according to the Guide for the Care and Use of Laboratory Animals and the ethical standards of our institution.

Hepatocyte isolation

Hepatocytes were isolated using a modified two-step ethylenediaminetetraacetic acid (EDTA)/collagenase protocol, according to [10] with slight modifications. The mouse was deeply anesthetized with Isoflurane (Fig. 1). After sterilizing the skin, the abdomen was opened via an upper abdominal transverse incision, and the intestines were pushed to the left of the animal’s torso, to expose the hepatic portal vein (HPV) and the inferior vena cava (IVC). A sterile cannula was inserted into the portal vein for the antegrade perfusion. The cannula was secured using 6-0 silk ties and then was connected to the perfusate tube, avoiding introduction of air. The flow rate (5 mL/min), was controlled by a peristaltic pump. The liver was first perfused with calcium and magnesium-free Hank’s balanced salt solution (Sigma-Aldrich, USA), containing 0.5 mM EDTA at 5 mL/min for 7 min. Once the solution begins to perfuse the liver, the vena cava was cut for blood/fluid drainage. The liver was then perfused with calcium and magnesium-free Hank’s balanced salt solution, containing 1 mg/mL collagenase (Sigma-Aldrich, USA), and 5 mmol/L CaCl₂ at 5 mL/min for 7 min.

Figure 1. Mouse hepatocytes isolation (perfusion method). (I): Pictorial representation of perfusion system setup (A: surgical table, B: anesthesia machine, C: perfusion tube, D: perfusion solution, E: water bath for warming perfusion media, F: peristaltic pump), (a): Gas anesthesia with Isoflurane. (b): The abdomen was opened, exposing the hepatic portal vein (HPV) and the inferior vena cava (IVC). (c): Silk ties were used to secure the catheter. (d): IV catheter inserted into the portal vein, and connected to the perfusion tube (e): The vena cava was cut for blood/fluid drainage. (f): The liver should blanch while the blood is flushed out.

All the perfusion solutions were pre-warmed and maintained at 37°C. The perfusion was considered successful when the whole organ was completely blanched and the endpoint when the tissue was visibly digested and the capsule started to separate from the organ surface. The liver was removed and placed in a petri dish with RPMI (37°C), and the Glisson’s capsule enclosing the liver was carefully separated using a pair of forceps, in order to disperse the hepatocytes. The resulting cell suspension was passed through a 65-µm nylon mesh to remove cell clumps. The suspension was then centrifuged at 1000 rpm for 2-3 min. The supernatant was discarded, and the remaining cell suspension was washed three times with RPMI. The hepatocyte pellet was gently resuspended in RPMI, and the viability was determined by trypan blue exclusion method.

Co-culture of mouse BMSCs and hepatocytes

BMSCs were isolated from the tibias and femurs of intact BALB/c mice using flushing method. For co-culture of BMSCs and hepatocytes, 1.5×10⁶ BMSCs (at passage 0 (P0)) were cultured in serum-free RPMI medium in order to exclude possible effects on liver regeneration caused by fetal bovine serum (FBS), and incubated at 37°C with 5% humidified CO₂ for 4 h. Once BMSCs were attached to the flask, the culture medium was discarded and 1.5×10⁶ of freshly isolated hepatocytes were added to the culture.

Following ca. 20 hours of hepatocyte-BMSCs co-culture, the conditioned medium was collected and centrifuged at 1000 rpm for 10 min, then filtered (0.22 µm pore size) and kept at -80°C until use.

Experimental Protocol

The model liver injury was induced by CCl₄. The mice were injected intraperitoneally with CCl₄ (1 mL/kg body weight) dissolved in olive oil, twice a week for 7 weeks. Then, the mice were injected into the tail vein with 0.2 ml of conditioned medium (CM) from the co-culture of hepatocytes and BMSC (CM group), or with (0.2 ml) of serum-free RPMI medium as vehicle control (RPMI group). Four weeks after CM treatment, all animals were sacrificed, and their livers and venous blood were collected.

The body mass and liver weight in the mice were determined at the end of the experiment. The liver-to-body weight ratio was calculated as follows: Liver-to-body ratio = (liver weight (g)/(mouse body weight (g)-liver weight (g) *100.

Biochemical indices, cytokines and histopathology

At the time of sacrificing, venous blood samples were collected and centrifuged at 3000 rpm for 5 minutes to separate blood serum. The levels of albumin, alanine aminotransferase (ALT), aspartate transaminase (AST) and alkaline phosphatase (ALP) in the serum were detected. Serum interleukin-4 (IL-4) and IFN-γ levels were detected by ELISA kits (Sun Red, China) according to the manufacturer’s instructions.

Liver tissue samples were collected and fixed in 10% formalin. The specimens were then processed to form paraffin sections and stained with hematoxylin and eosin (H&E). The sections were examined for histopathological changes under light microscope.

Statistical analysis

All values were presented as mean ± SD. The statistical difference was analyzed using t-test for independent samples (SPSS 17 software). P<0.05 was considered statistically significant.

Results

Isolation and culture of hepatocytes

The yield of viable hepatocytes was (83.46×10⁶), and their viability was 78%. Isolated hepatocytes were examined under an inverted microscope (Fig. 2). Freshly isolated hepatocytes were round-shaped and suffered from stress, presumably, due to the isolation process. With time, the cells gradually recovered from the stress. 24 hours later, the hepatocytes showed a cubic morphology that resembles the organization of liver tissue, with clear and distinct nuclei (some of them are bi-nucleated).

Figure 2. Light-microscopic pictures of cultured mouse hepatocytes. Hepatocytes show a cubic morphology and a clear and distinct nucleus. Some bi-nucleated cells were found

Distribution of murine BMSCs and hepatocytes in co-culture

The hepatocytes in co-culture appeared in small cell clusters, with the presence of BMSCs intermingled throughout the hepatocyte culture (Fig. 3). Most BMSCs attached to the culture flask surface, and hepatocytes attached to the BMSCs layer.

Figure 3. Light-microscopic pictures of mouse of BMSC/hepatocytes co-culture

Effects of CM treatment on liver and body weight

The results of this study showed non-significant differences in the liver weight to body weight ratio in CM treated group compared to the RPMI group (Table 1).

Table 1. Body weights, liver weights and liver-to-body weight ratios of the studied groups

All values are represented as mean ± SD. Mean values with different letters over the same column are significantly different at (P<0.05).

Biochemical serum indexes

CM treated group showed significantly decreased serum levels of ALT and AST compared to RPMI group. The levels of albumin and ALP were not significantly different (Table 2).

Table 2. Serum levels of ALT, AST, ALP, and albumin in the studied groups

All values are represented as mean ± SD. Mean values with different letters over the same column are significantly different at (P<0.05).

Histopathology

The liver in the RPMI-treated group exposed to CCl₄ demonstrated irregular surface upon morphologic examination. They had rough surface with necrotic spots. The livers were slightly swollen, and showed decreased glossiness, with a pale brown color. In the mice receiving CM treatment, the surface of the liver was slightly rough, less swollen, more reddish, and lustrous than in those from the RPMI group. Necrotic spots on the surface were noticeably reduced (Fig. 4).

Figure 4. Morphologic examination of the livers. (A) In the RPMI group, the liver had irregular surface with necrotic spots and showed pale brown color. (B) In the mice receiving CM-treatment, the liver surface was slightly coarse, less swollen, more reddish, and lustrous than those of the RPMI group

The results of histological analysis are shown in Fig. 5. In the CCl₄-exposed RPMI group, the livers showed loss of normal architecture. The cord-like arrangement of hepatocytes was disrupted. The main histopathologic findings were marked hepatocellular necrosis, hepatocytes were swollen with vacuolated cytoplasm. In some specimens we observed severe infiltration with inflammatory cells, vascular dilatation and congestion. Dilated blood sinusoids were also observed in some parts.

These histopathological changes were remarkably alleviated in histological sections of CM-treated group. The sections showed nearly normal organization of hepatic lobules. The cord-like arrangement of hepatocytes was restored, as well as minimal disruption of hepatic cellular structure, well-preserved cytoplasm, reduced inflammation with low presence of inflammatory cells.

Figure 5. H&E-stained sections in the livers of the experimental groups. (A, F). RPMI group. A-B. Marked affection with disorganization of hepatic architecture, hepatocytes necrosis (N) can be seen. C, D. severe infiltration of inflammatory cells. E. hepatocytes with vacuolated cytoplasm (arrows). F. Vascular congestion (arrows). (G, H). CM treated group. Nearly normal organization of hepatic lobules. Hepatocytes appeared nearly similar to that of the normal mouse.

Detection of cytokines

Serum IL-4 and IFN-γ levels were detected by ELISA. IL-4 level considerably increased in CM treated group compared with the RPMI group. CM treatment did not affect the level of IFN-γ compared to RPMI group (Fig. 6).

Figure 6. Serum levels of IL-4 (pg/ml), and IFN-γ (pg/ml) cytokines. Serum were collected one month after CM treatment, and cytokines were measured with ELISA assay

Discussion

Bone marrow mesenchymal stromal cells MSC(M) were isolated, cultured, and characterized in our previous study [11].

In the current study, the conditioned medium was prepared by co-culture of hepatocytes with BMSCs at passage 0 (P0 BMSCs), in order to avoid the decline in cell functions with further passaging [12].

Various methods have been employed in attempt to isolate hepatocytes. These include mechanical, chemical, and enzymatic methods [13]. In this study, two-step EDTA/collagenase protocol was used to isolate hepatocytes. Collagenase perfusion of the liver to obtain hepatocytes has been performed since the early 1950s and has been permanently improved [14]. In this study, the liver was perfused via the portal vein instead of vena cava due to its ease of access within abdomen and that this vein feeds directly into the liver [14]. The whole isolation procedure, from the animal anesthesia to cell seeding, was completed as quickly as possible (in 40-50 min) to obtain sufficient number of viable cells, and we obtained a high cellular yield with good viability.

At the first step, removal of calcium ions by EDTA from epithelial cells is essential to disrupt the Ca²⁺dependent E-cadherin molecules between adjacent hepatocytes which results in rapid destruction of intercellular junctions resulting in loss of cell-to-cell contacts, and thus improving quantity and quality of the dispersed hepatocytes. At the second step, we introduced collagenase into the liver lobes thus causing disruption of the supporting extracellular matrix. Ca²⁺ is added to the perfusion medium with collagenase, since the presence of Ca²⁺ is required for enzymatic activity of collagenase during the perfusion [15]. Low-speed centrifugation was used to isolate hepatocytes since the viable hepatocytes have higher density and can be easily purified from the non-parenchymal cells and dead hepatocytes [14].

Liver diseases affect approximately 17.5% of the population. According to World Health Organization statistics, more than a hundred million people worldwide are suffering from liver disease [16]. The limited half-life of transplanted cells, potential tumorigenic risk, and other risks of MSCs have led to the further development of acellular therapies [17]. Therapy with conditioned medium derived from mesenchymal stromal cells is a rapidly advancing field that may exert substantial impact on the treatment of different diseases/conditions [5]. Various mesenchymal stromal cell-derived conditioned media were produced by different approaches and processing, and tested in various diseases, mostly showing good results [4]. Hepatocytes and mesenchymal stromal cells (MSCs) are attractive sources of cell-based therapies for the liver diseases. The co-transplantation of hepatocytes and MSCs may improve therapeutic efficiency for the treatment of liver injury. In this study, we have tested the synergistic effect of the factors or secretome produced by hepatocytes and BMSCs in enhancing the regenerative capacity of liver.

To induce liver injury in mice, CCl₄ was used. Carbon tetrachloride is one of the most commonly used hepatotoxins as an experimental model of liver disease [18]. CCl₄ is metabolized in the liver via mitochondrial cytochrome P450 (CYP450), and the resulting free radicals damage the lipid membranes of hepatocytes by lipid peroxidation, thus leading to the release of cellular contents into the extracellular matrix (ECM), which generates a myriad of inflammatory signals in the liver. High level of inflammation leads to apoptosis and further liver damage [19].

Our results showed a marked decrease in the levels of ALT and AST enzymes in the CM-treated group compared to the RPMI group (controls). Serum ALT and AST are usually elevated in liver damage [20]. ALT and AST are enzymes basically located within hepatocytes. Hence, when liver cells are damaged or die, the transaminases are released into bloodstream, where they can be measured. Therefore, their levels reflect the degree of liver injury [18]. However, the decrease in ALT and AST levels after CM treatment suggests that H/BMSCs CM may promote regenerative capacity of the liver and improve injured liver tissue. On the other hand, no improvement was observed in hepatocyte functions in terms of albumin secretion.

The therapeutic effect of CM in the liver damage caused by CCl₄ was evident by comparing the histological sections of the liver in the studied groups. Histological study results were in consistent with biochemical results (alleviation of Alt and AST levels). The liver in the RPMI group demonstrated irregular morphology at morphologic examination. Microscopical examination also showed several histopathological changes induced by CCl₄. These results supported that 7 weeks of CCl₄ administration clearly altered the liver structure and health, causing liver damage and changes to macroscopic pattern of the mouse liver. A considerable improvement in external morphology and histopathological changes and in the hepatic lobular architecture was observed after CM treatment of mice.

Serum IFN-γ and IL-4 levels were detected by ELISA. The serum IL-4 level considerably increased after CM treatment. This result proves the therapeutic effect of H/BMSCs CM. IL-4 is one of the widely acknowledged immune regulatory cytokines able to suppress inflammation [21]. This cytokine commonly represents Th2 responses [22]. However, the results indicated that CM treatment did not affect the release of IFN-γ.

In summary, H/BMSCs CM treatment was effective in alleviation of CCl₄-induced liver damage in mice. This treatment may present a novel adjunctive therapy in drug-induced liver toxicity. CM is mediating this effect, probably, through maintaining the liver homeostasis which primarily includes induction of hepatocyte regeneration [7].

It is shown that MSC-conditioned media (MSC-CM) contain a variety of cytokines, chemokines, and growth factors, such as vascular endothelial growth factor (VEGF), epidermal growth factor (EGF), keratinocyte growth factor (KGF), angiopoietin-1, erythropoietin, and stromal derived factor-1 (SDF-1), which have multiple positive impacts on tissue regeneration [3]. The liver trophic factors secreted by MSCs, in particular, hepatocyte growth factor (HGF) could be the crucial player in liver regeneration [9].

Hepatocytes also secrete various cytokines that modulate both hepatocyte metabolism and liver inflammation [23]. Previous study identified over 200 proteins in the conditioned medium of rat hepatocyte including plasma, extracellular, and intracellular proteins [24]. Another report identified 691 secreted proteins in the conditioned medium of primary human hepatocytes, such as alpha-1-antitrypsin, alpha-1-antichymotrypsin, alpha-1-acid glycoprotein 1, and albumin. Different factors in CM derived from hypatocytes cocultured with BMSCs act together to promote regeneration [25]. Previous study showed that the culture of human hepatocytes (HCs) in medium previously conditioned by cocultured HCs and MSCs demonstrated improved function, whereas no effect was observed when HCs cultured in medium conditioned by MSCs alone, which indicates that the presence of HCs is needed to stimulate MSCs to produce the relevant factors/cytokines in the culture medium [26].

Further studies are required to evaluate efficacy and safety of CM therapy, and to determine optimal cell source, culture conditions, duration of medium conditioning, the optimal injection route and dosage which can profoundly affect clinical outcome, and to elucidate the exact mechanism of action. Hence, the intended therapeutic effect may be translated and optimized, in order to develop standardized methods for production of various conditioned media and validation of their usage in various diseases.

Conclusion

Our results indicate that H/BMSCs CM is effective in stimulating liver regeneration after CCl₄-induced injury. Despite great number of promising results with mesenchymal stromal cell-conditioned media, and the need for efficient treatment of the patients suffering from liver diseases, the use of CM in human clinical trials needs more studies to analyze and characterize the cytokines and growth factors secreted in CM in order to understand the effects of these compositions on different body tissues, and to make sure that this CM does not have the potential to cause severe adverse effects in humans. We also need to try CM of different mesenchymal stromal cells to achieve maximal healing effect in different diseases. We hope that this research will stimulate and encourage such efforts towards harnessing the therapeutic potential of the CM.

Conflict of interest

None declared.

Acknowledgments

The authors are grateful to the Leishmania center of Epidemiological and Biological Studies, Dr. Ruba Joujeh, Dr. Hassan Alkhoury, Dr. Ahmad Kanameh for their help and support. This research was funded by the University of Aleppo.

References

1. Wright A, Arthaud-day ML, Weiss ML. Therapeutic Use of Mesenchymal Stromal Cells: The Need for Inclusive Characterization Guidelines to Accommodate All Tissue Sources and Species, Front. Cell Dev. Biol, 9, 1-18 (2021).
2. Hmadcha A, Martin-Montalvo A, Gauthier BR, Soria B, Capilla-Gonzalez V. Therapeutic Potential of Mesenchymal Stem Cells for Cancer Therapy, Front. Bioeng. Biotechnol, 8(43), 1-13 (2020).
3. Saheli M, Bayat M, Ganji R, Hendudari F, Kheirjou R, Pakzad M, Najar B, Piryaei A. Human mesenchymal stem cells-conditioned medium improves diabetic wound healing mainly through modulating fibroblast behaviors. Arch Dermatol Res. 2020; 312(5):325-336. doi: 10.1007/s00403-019-02016-6
4. Pawitan JA. Prospect of stem cell conditioned medium in regenerative medicine. Biomed Res Int. 2014;2014:965849.
   doi: 10.1155/2014/965849
5. Mehling BM, Manvelyan M, Benesh G, Wu DC. Characterization of human umbilical cord mesenchymal stem cells-derived conditioned medium. J. Stem Cell Res. Ther. 2016; 1(6): 218-220. doi: 10.15406/jsrt.2016.01.00038
6. Pokrovskaya LA, Zubareva EV, Nadezhdin SV, Lysenko AS, Litovkina TI. Biological activity of mesenchymal stem cells secretome as a basis for cell-free therapeutic approach. Res Results Pharmacol. 2020; 6, 57-68. doi: 10.3897/rrpharmacology.6.49413
7. Tan CY, Lai RC, Wong W, Dan YY, Lim SK, Ho HK. Mesenchymal stem cell-derived exosomes promote hepatic regeneration in drug-induced liver injury models. Stem Cell Res Ther. 2014; 5(3):76. doi: 10.1186/scrt465. PMID: 24915963
8. Aal SA, Abdelrahman SA, Raafat N. Comparative therapeutic effects of mesenchymal stem cells versus their conditioned media in alleviation of CCL4-induced liver fibrosis in rats: Histological and biochemical study. JMH. 2019; 3(1):1-20.
   doi: 10.21608/jmh.2019.10310.1051
9. Azhdari Tafti Z, Mahmoodi M, Hajizadeh MR, Ezzatizadeh V, Baharvand H, Vosough M, Piryaei A. Conditioned media derived from human adipose tissue mesenchymal stromal cells improves primary hepatocyte maintenance. Cell J. 2018; 20(3):377-387.
   doi: 10.22074/cellj.2018.5288
10. Weglarz TC, Degen JL, Sandgren EP. Hepatocyte transplantation into diseased mouse liver. Kinetics of parenchymal repopulation and identification of the proliferative capacity of tetraploid and octaploid hepatocytes. Am J Pathol. 2000; 157(6):1963-1974.
    doi: 10.1016/S0002-9440(10)64835-3
11. Joujeh D, Ghrewaty A, Soukkarieh C, Almarrawi A and Darwicha J. An optimized protocol for mouse bone marrow mesenchymal stromal cells isolation and culture. Cell Ther Transplant,10(3-4): 61-70 (2021).
12. Jiang T, Xu G, Wang Q, Yang L, Zheng L, Zhao J, Zhang X. In vitro expansion impaired the stemness of early passage mesenchymal stem cells for treatment of cartilage defects. Cell Death Dis. 2017; 8:2851. doi: 10.1038/cddis.2017.215
13. Lee D, Lee K. Hepatocyte isolation, culture, and its clinical applications. Hanyang Med Rev 2014; 34(4):165-172.
    doi: 10.7599/hmr.2014.34.4.165
14. Cabral F, Miller CM, Kudrna KM, Hass BE, Daubendiek JG, Kellar BM, Harris EN. Purification of hepatocytes and sinusoidal endothelial cells from mouse liver perfusion. J Vis Exp. 2018 Feb 12;(132):56993. doi: 10.3791/56993
15. Li WC, Ralphs KL, Tosh D. Isolation and culture of adult mouse hepatocytes. Methods Mol Biol. 2010; 633:185-196.
    doi: 10.1007/978-1-59745-019-5_13
16. Sarvandi SS, Joghataei MT, Parivar K, Khosravi M, Sarveazad A, Sanadgol N. In vitro differentiation of rat mesenchymal stem cells to hepatocyte lineage. Iran J Basic Med Sci. 18(1), 89-97. PMID: 25810881
17. Driscoll J, Patel T. The mesenchymal stem cell secretome as an acellular regenerative therapy for liver disease. J Gastroenterol. 2019; 54(9):763-773. doi: 10.1007/s00535-019-01599-1
18. Moharib M, Hammam O, Salman F, El-naggar M, Sherif S. Transplantation of Modified and Fresh Hepatocyte Reduces Hepatotoxicity Induced by Carbon Tetrachloride. Life Sci J. 2014; 11(8): 641-652.
19. Mishra AP, Siva AB, Gurunathan C, Komala Y, Lakshmi BJ. Impaired liver regeneration and lipid homeostasis in CCl4 treated WDR13 deficient mice. Lab Anim Res. 2020;36(1):41. doi: 10.1186/s42826-020-00076-8
20. Gaim K, Gebru G, Abba S. The effect of arsenic on liver tissue of experimental animals (fishes and mice) – A review article. Int J Sci Res Publ. 2015; 5(1), 1-9.
21. Ma K, Gong T, Ao Q, Yan Y, Song B, Huang H, et al. Intracerebral transplantation of adipose-derived mesenchymal stem cells alternatively activates microglia and ameliorates neuropathological deficits in Alzheimer’ s disease mice. Cell Transplant. 2013; 22(1):113-126. doi: 10.3727/096368913X672181
22. Njoku DB. Suppressive and pro-inflammatory roles for IL-4 in the pathogenesis of experimental drug-induced liver injury: a review. Expert Opin Drug Metab Toxicol. 2010; 6(5):519-531. doi: 10.1517/17425251003601979
23. Sheng L, Jiang B, Rui L. Intracellular lipid content is a key intrinsic determinant for hepatocyte viability and metabolic and inflammatory states in mice. Am J Physiol Endocrinol Metab. 2013; 305(9):E1115-23. doi: 10.1152/ajpendo.00401.2013
24. Farkas D, Bhat VB, Mandapati S, Wishnok JS, Tannenbaum SR. Characterization of the secreted proteome of rat hepatocytes cultured in collagen sandwiches. Chem Res Toxicol. 2005; 18(7):1132-1139. doi: 10.1021/tx0500225
25. Franko A, Hartwig S, Kotzka J, Ruoß M, Nüssler AK, Königsrainer A, et al. Identification of the secreted proteins originated from primary human hepatocytes and HepG2 cells. Nutrients. 2019; 11(8):1795. doi: 10.3390/nu11081795
26. Fitzpatrick E, Wu Y, Dhadda P, Hughes RD, Mitry RR, Qin H, et al. Coculture with mesenchymal stem cells results in improved viability and function of human hepatocytes. Cell Transplant. 2015; 24(1):73-83. doi: 10.3727/096368913X674080

" ["DETAIL_TEXT_TYPE"]=> string(4) "html" ["~DETAIL_TEXT_TYPE"]=> string(4) "html" ["PREVIEW_TEXT"]=> string(0) "" ["~PREVIEW_TEXT"]=> string(0) "" ["PREVIEW_TEXT_TYPE"]=> string(4) "text" ["~PREVIEW_TEXT_TYPE"]=> string(4) "text" ["PREVIEW_PICTURE"]=> NULL ["~PREVIEW_PICTURE"]=> NULL ["LANG_DIR"]=> string(4) "/ru/" ["~LANG_DIR"]=> string(4) "/ru/" ["SORT"]=> string(2) "30" ["~SORT"]=> string(2) "30" ["CODE"]=> string(100) "terapevticheskiy-potentsial-sredy-konditsionirovannoy-stvolovymi-kletkami-kostnogo-mozga-dlya-oslabl" ["~CODE"]=> string(100) "terapevticheskiy-potentsial-sredy-konditsionirovannoy-stvolovymi-kletkami-kostnogo-mozga-dlya-oslabl" ["EXTERNAL_ID"]=> string(4) "2066" ["~EXTERNAL_ID"]=> string(4) "2066" ["IBLOCK_TYPE_ID"]=> string(7) "journal" ["~IBLOCK_TYPE_ID"]=> string(7) "journal" ["IBLOCK_CODE"]=> string(7) "volumes" ["~IBLOCK_CODE"]=> string(7) "volumes" ["IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["~IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["LID"]=> string(2) "s2" ["~LID"]=> string(2) "s2" ["EDIT_LINK"]=> NULL ["DELETE_LINK"]=> NULL ["DISPLAY_ACTIVE_FROM"]=> string(0) "" ["IPROPERTY_VALUES"]=> array(18) { ["ELEMENT_META_TITLE"]=> string(269) "Терапевтический потенциал среды, кондиционированной стволовыми клетками костного мозга для ослабления повреждения печени у мышей, вызванного CCl4" ["ELEMENT_META_KEYWORDS"]=> string(0) "" ["ELEMENT_META_DESCRIPTION"]=> string(443) "Терапевтический потенциал среды, кондиционированной стволовыми клетками костного мозга для ослабления повреждения печени у мышей, вызванного CCl4Therapeutic potential of conditioned medium derived from bone marrow mesenchymal stromal cells cocultured with hepatocytes in alleviation of CCl4-induced liver damage in mice" ["ELEMENT_PREVIEW_PICTURE_FILE_ALT"]=> string(3769) "<p style="text-align: justify;">Терапия с применением сред, кондиционированных стволовыми клетками, является быстро развивающейся областью науки, которая может внести существенный вклад в лечения различных болезней. В настоящей работе изучался терапевтический эффект кондиционированной среды из культуры стволовых клеток костного мозга (СККМ), которые кокультивировали с гепатоцитами (КС ККМ) с целью ослабления CCl₄-индуцированного повреждения печени у мышей.</p> <h3>Материалы и методы</h3> <p style="text-align: justify;">Гепатоциты кокультивировали с СККМ в течение 20 час., затем собирали кондиционированную среду от них. Мышам экспериментальной группы вводили внутрибрюшинно CCl₄ дважды в неделю в течение 7 недель, после чего вводили кондиционированную среду от кокультур СККМ и гепатоцитов. Через 4 недели определяли уровни АЛТ, АСТ, ALP и альбумина в сыворотке, оценивали гистопатологию печени, и определяли уровни IL-4 и IFN-γ в сыворотке посредством ИФА.</p> <h3>Результаты</h3> <p style="text-align: justify;">Группа, леченная введением кондиционированной среды СККМ/гепатоцитов, имела значительно сниженные уровни АЛТ и АСТ по сравнению с мышами, которым вводили среду RPMI без существенных различий в уровнях ALP и альбумина. Гистологическое исследование показало выраженное ослабление патологической картины печени в группе, леченной кондиционированной средой от кокультур СККМ/гепатоцитов. Введение конционированной СККМ среды вызывало повышение продукции IL-4 и не нарушало выхода IFN-γ.</p> <h3>Выводы</h3> <p style="text-align: justify;">Наши результаты показали, что введение сред из кокультур СККМ/гепатоцитов сопровождается ослаблением повреждений печени, вызванных CCl₄. Необходимы дальнейшие исследования, чтобы выяснить механизм действия и достичь желаемого терапевтического эффекта, который может быть репродуцирован и оптимизирован.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Стволовые клетки, костный мозг, гепатоциты, кокультура, кондиционированная среда, печеночная патология.</p>" ["ELEMENT_PREVIEW_PICTURE_FILE_TITLE"]=> string(269) "Терапевтический потенциал среды, кондиционированной стволовыми клетками костного мозга для ослабления повреждения печени у мышей, вызванного CCl4" ["ELEMENT_DETAIL_PICTURE_FILE_ALT"]=> string(269) "Терапевтический потенциал среды, кондиционированной стволовыми клетками костного мозга для ослабления повреждения печени у мышей, вызванного CCl4" ["ELEMENT_DETAIL_PICTURE_FILE_TITLE"]=> string(269) "Терапевтический потенциал среды, кондиционированной стволовыми клетками костного мозга для ослабления повреждения печени у мышей, вызванного CCl4" ["SECTION_META_TITLE"]=> string(269) "Терапевтический потенциал среды, кондиционированной стволовыми клетками костного мозга для ослабления повреждения печени у мышей, вызванного CCl4" ["SECTION_META_KEYWORDS"]=> string(269) "Терапевтический потенциал среды, кондиционированной стволовыми клетками костного мозга для ослабления повреждения печени у мышей, вызванного CCl4" ["SECTION_META_DESCRIPTION"]=> string(269) "Терапевтический потенциал среды, кондиционированной стволовыми клетками костного мозга для ослабления повреждения печени у мышей, вызванного CCl4" ["SECTION_PICTURE_FILE_ALT"]=> string(269) "Терапевтический потенциал среды, кондиционированной стволовыми клетками костного мозга для ослабления повреждения печени у мышей, вызванного CCl4" ["SECTION_PICTURE_FILE_TITLE"]=> string(269) "Терапевтический потенциал среды, кондиционированной стволовыми клетками костного мозга для ослабления повреждения печени у мышей, вызванного CCl4" ["SECTION_PICTURE_FILE_NAME"]=> string(100) "terapevticheskiy-potentsial-sredy-konditsionirovannoy-stvolovymi-kletkami-kostnogo-mozga-dlya-oslabl" ["SECTION_DETAIL_PICTURE_FILE_ALT"]=> string(269) "Терапевтический потенциал среды, кондиционированной стволовыми клетками костного мозга для ослабления повреждения печени у мышей, вызванного CCl4" ["SECTION_DETAIL_PICTURE_FILE_TITLE"]=> string(269) "Терапевтический потенциал среды, кондиционированной стволовыми клетками костного мозга для ослабления повреждения печени у мышей, вызванного CCl4" ["SECTION_DETAIL_PICTURE_FILE_NAME"]=> string(100) "terapevticheskiy-potentsial-sredy-konditsionirovannoy-stvolovymi-kletkami-kostnogo-mozga-dlya-oslabl" ["ELEMENT_PREVIEW_PICTURE_FILE_NAME"]=> string(100) "terapevticheskiy-potentsial-sredy-konditsionirovannoy-stvolovymi-kletkami-kostnogo-mozga-dlya-oslabl" ["ELEMENT_DETAIL_PICTURE_FILE_NAME"]=> string(100) "terapevticheskiy-potentsial-sredy-konditsionirovannoy-stvolovymi-kletkami-kostnogo-mozga-dlya-oslabl" } ["FIELDS"]=> array(1) { ["IBLOCK_SECTION_ID"]=> string(3) "214" } ["PROPERTIES"]=> array(18) { ["KEYWORDS"]=> array(36) { ["ID"]=> string(2) "19" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:46:01" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(27) "Ключевые слова" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "KEYWORDS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "19" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "4" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "Y" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "Y" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(27) "Ключевые слова" ["~DEFAULT_VALUE"]=> string(0) "" } ["SUBMITTED"]=> array(36) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28698" ["VALUE"]=> string(22) "10/13/2021 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "10/13/2021 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL } ["ACCEPTED"]=> array(36) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28699" ["VALUE"]=> string(22) "01/28/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "01/28/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL } ["PUBLISHED"]=> array(36) { ["ID"]=> string(2) "22" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Дата публикации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "PUBLISHED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "22" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Дата публикации" ["~DEFAULT_VALUE"]=> NULL } ["CONTACT"]=> array(36) { ["ID"]=> string(2) "23" ["TIMESTAMP_X"]=> string(19) "2015-09-03 14:43:05" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(14) "Контакт" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "CONTACT" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "23" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(14) "Контакт" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHORS"]=> array(36) { ["ID"]=> string(2) "24" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:45:07" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "AUTHORS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "24" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_RU"]=> array(36) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28700" ["VALUE"]=> array(2) { ["TEXT"]=> string(311) "<p>Дима Джуджех¹, Aбдуджалил Гревати¹, Aднан Альмаррави¹, Чади Суккариех², Джамал Абдул Насер Дарвича³ </p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(239) "

Дима Джуджех¹, Aбдуджалил Гревати¹, Aднан Альмаррави¹, Чади Суккариех², Джамал Абдул Насер Дарвича³

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_RU"]=> array(36) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28701" ["VALUE"]=> array(2) { ["TEXT"]=> string(635) "<p>¹ Департамент биотехнологической инженерии, Факультет технической инженерии, Университет Алеппо, Сирия<br> ² Департамент биологии животных, Факультет наук, Университет Дамаска, Сирия<br> ³ Департамент фармакологии и токсикологии, Факультет фармации, Арабский международный университет, Сирия</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(575) "

¹ Департамент биотехнологической инженерии, Факультет технической инженерии, Университет Алеппо, Сирия
² Департамент биологии животных, Факультет наук, Университет Дамаска, Сирия
³ Департамент фармакологии и токсикологии, Факультет фармации, Арабский международный университет, Сирия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_RU"]=> array(36) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28702" ["VALUE"]=> array(2) { ["TEXT"]=> string(3769) "<p style="text-align: justify;">Терапия с применением сред, кондиционированных стволовыми клетками, является быстро развивающейся областью науки, которая может внести существенный вклад в лечения различных болезней. В настоящей работе изучался терапевтический эффект кондиционированной среды из культуры стволовых клеток костного мозга (СККМ), которые кокультивировали с гепатоцитами (КС ККМ) с целью ослабления CCl₄-индуцированного повреждения печени у мышей.</p> <h3>Материалы и методы</h3> <p style="text-align: justify;">Гепатоциты кокультивировали с СККМ в течение 20 час., затем собирали кондиционированную среду от них. Мышам экспериментальной группы вводили внутрибрюшинно CCl₄ дважды в неделю в течение 7 недель, после чего вводили кондиционированную среду от кокультур СККМ и гепатоцитов. Через 4 недели определяли уровни АЛТ, АСТ, ALP и альбумина в сыворотке, оценивали гистопатологию печени, и определяли уровни IL-4 и IFN-γ в сыворотке посредством ИФА.</p> <h3>Результаты</h3> <p style="text-align: justify;">Группа, леченная введением кондиционированной среды СККМ/гепатоцитов, имела значительно сниженные уровни АЛТ и АСТ по сравнению с мышами, которым вводили среду RPMI без существенных различий в уровнях ALP и альбумина. Гистологическое исследование показало выраженное ослабление патологической картины печени в группе, леченной кондиционированной средой от кокультур СККМ/гепатоцитов. Введение конционированной СККМ среды вызывало повышение продукции IL-4 и не нарушало выхода IFN-γ.</p> <h3>Выводы</h3> <p style="text-align: justify;">Наши результаты показали, что введение сред из кокультур СККМ/гепатоцитов сопровождается ослаблением повреждений печени, вызванных CCl₄. Необходимы дальнейшие исследования, чтобы выяснить механизм действия и достичь желаемого терапевтического эффекта, который может быть репродуцирован и оптимизирован.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Стволовые клетки, костный мозг, гепатоциты, кокультура, кондиционированная среда, печеночная патология.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(3575) "

Терапия с применением сред, кондиционированных стволовыми клетками, является быстро развивающейся областью науки, которая может внести существенный вклад в лечения различных болезней. В настоящей работе изучался терапевтический эффект кондиционированной среды из культуры стволовых клеток костного мозга (СККМ), которые кокультивировали с гепатоцитами (КС ККМ) с целью ослабления CCl₄-индуцированного повреждения печени у мышей.

Материалы и методы

Гепатоциты кокультивировали с СККМ в течение 20 час., затем собирали кондиционированную среду от них. Мышам экспериментальной группы вводили внутрибрюшинно CCl₄ дважды в неделю в течение 7 недель, после чего вводили кондиционированную среду от кокультур СККМ и гепатоцитов. Через 4 недели определяли уровни АЛТ, АСТ, ALP и альбумина в сыворотке, оценивали гистопатологию печени, и определяли уровни IL-4 и IFN-γ в сыворотке посредством ИФА.

Результаты

Группа, леченная введением кондиционированной среды СККМ/гепатоцитов, имела значительно сниженные уровни АЛТ и АСТ по сравнению с мышами, которым вводили среду RPMI без существенных различий в уровнях ALP и альбумина. Гистологическое исследование показало выраженное ослабление патологической картины печени в группе, леченной кондиционированной средой от кокультур СККМ/гепатоцитов. Введение конционированной СККМ среды вызывало повышение продукции IL-4 и не нарушало выхода IFN-γ.

Выводы

Наши результаты показали, что введение сред из кокультур СККМ/гепатоцитов сопровождается ослаблением повреждений печени, вызванных CCl₄. Необходимы дальнейшие исследования, чтобы выяснить механизм действия и достичь желаемого терапевтического эффекта, который может быть репродуцирован и оптимизирован.

Ключевые слова

Стволовые клетки, костный мозг, гепатоциты, кокультура, кондиционированная среда, печеночная патология.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["DOI"]=> array(36) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28703" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-84-92" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-84-92" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_EN"]=> array(36) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28706" ["VALUE"]=> array(2) { ["TEXT"]=> string(231) "<p>Dima Joujeh¹, Abduljalil Ghrewaty¹, Adnan Almarrawi¹, Chadi Soukkarieh², Jamal Abdul N. Darwicha³</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(159) "

Dima Joujeh¹, Abduljalil Ghrewaty¹, Adnan Almarrawi¹, Chadi Soukkarieh², Jamal Abdul N. Darwicha³

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_EN"]=> array(36) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28707" ["VALUE"]=> array(2) { ["TEXT"]=> string(996) "<p>¹ Department of Biotechnology Engineering, Faculty of Technical Engineering, University of Aleppo, Syria<br> ² Department of Animal Biology, Faculty of Sciences, Damascus University, Damascus, Syria<br> ³ Department of Pharmacology and Toxicology, Faculty of Pharmacy, Arab International University, Syria</p><br> <p><b>Correspondence:</b><br> Dr. Dima Joujeh, Department of Biotechnology Engineering, Faculty of Technical Engineering, University of Aleppo, Syria<br> Phone: (+963) 994046745<br> E-mail: dimajoujeh@gmail.com</p><br> <p><b>Citation:</b> Joujeh D, Ghrewaty J, Almarrawi A, et al. Therapeutic potential of conditioned medium derived from bone marrow mesenchymal stromal cells cocultured with hepatocytes in alleviation of CCl4-induced liver damage in mice. Cell Ther Transplant 2022; 11(2): 84-92.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(858) "

¹ Department of Biotechnology Engineering, Faculty of Technical Engineering, University of Aleppo, Syria
² Department of Animal Biology, Faculty of Sciences, Damascus University, Damascus, Syria
³ Department of Pharmacology and Toxicology, Faculty of Pharmacy, Arab International University, Syria

Correspondence:
Dr. Dima Joujeh, Department of Biotechnology Engineering, Faculty of Technical Engineering, University of Aleppo, Syria
Phone: (+963) 994046745
E-mail: dimajoujeh@gmail.com

Citation: Joujeh D, Ghrewaty J, Almarrawi A, et al. Therapeutic potential of conditioned medium derived from bone marrow mesenchymal stromal cells cocultured with hepatocytes in alleviation of CCl4-induced liver damage in mice. Cell Ther Transplant 2022; 11(2): 84-92.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_EN"]=> array(36) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28708" ["VALUE"]=> array(2) { ["TEXT"]=> string(2041) "<p style="text-align: justify;">Mesenchymal stromal cell-derived conditioned medium therapy is a rapidly developing field of research that seems to have a significant impact on the treatment of various diseases. In the present study, the therapeutic effect of conditioned medium derived from bone marrow mesenchymal stromal cells (BMSCs) co-cultured with hepatocytes (H/BMSCs CM) was investigated for alleviation of CCl₄-induced liver damage in mice.</p> <h3>Materials and methods</h3> <p style="text-align: justify;">Hepatocytes were co-cultured with BMSCs for 20 h. H/BMSCs CM were then collected. Mice were intraperitoneally injected with CCl₄ twice a week for 7 weeks, followed by injection of H/BMSCs CM. Four weeks after the CM treatment, serum levels of ALT, AST, alkaline phosphatase (ALP), and albumin were determined, liver histopathology was examined, and ELISA assay was performed to measure the serum levels of IL-4 and IFN-γ. </p> <h3>Results</h3> <p style="text-align: justify;">The CM-treated group demonstrated marked decrease in serum levels of ALT and AST compared to RPMI group, without significant differences in the levels of alkaline phosphatase and albumin. Histopathological study demonstrated noticeable improvement in CM treatment group. CM treatment caused an increase in IL-4 production compared to RPMI group, and did not affect the release of IFN-γ.</p> <p style="text-align: justify;">Our results have shown that H/BMSCs CM treatment attenuates CCl₄-induced injury. Further studies should be carried out to elucidate the mechanism of action in order to achieve intended therapeutic effect which can be translated and optimized.</p> <h2>Keywords</h2> <p style="text-align: justify;">Mesenchymal stromal cells, bone marrow, hepatocytes, co-culture, conditioned medium, liver damage.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1859) "

Mesenchymal stromal cell-derived conditioned medium therapy is a rapidly developing field of research that seems to have a significant impact on the treatment of various diseases. In the present study, the therapeutic effect of conditioned medium derived from bone marrow mesenchymal stromal cells (BMSCs) co-cultured with hepatocytes (H/BMSCs CM) was investigated for alleviation of CCl₄-induced liver damage in mice.

Materials and methods

Hepatocytes were co-cultured with BMSCs for 20 h. H/BMSCs CM were then collected. Mice were intraperitoneally injected with CCl₄ twice a week for 7 weeks, followed by injection of H/BMSCs CM. Four weeks after the CM treatment, serum levels of ALT, AST, alkaline phosphatase (ALP), and albumin were determined, liver histopathology was examined, and ELISA assay was performed to measure the serum levels of IL-4 and IFN-γ.

Results

The CM-treated group demonstrated marked decrease in serum levels of ALT and AST compared to RPMI group, without significant differences in the levels of alkaline phosphatase and albumin. Histopathological study demonstrated noticeable improvement in CM treatment group. CM treatment caused an increase in IL-4 production compared to RPMI group, and did not affect the release of IFN-γ.

Our results have shown that H/BMSCs CM treatment attenuates CCl₄-induced injury. Further studies should be carried out to elucidate the mechanism of action in order to achieve intended therapeutic effect which can be translated and optimized.

Keywords

Mesenchymal stromal cells, bone marrow, hepatocytes, co-culture, conditioned medium, liver damage.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["NAME_EN"]=> array(36) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28704" ["VALUE"]=> string(174) "Therapeutic potential of conditioned medium derived from bone marrow mesenchymal stromal cells cocultured with hepatocytes in alleviation of CCl4-induced liver damage in mice" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(174) "Therapeutic potential of conditioned medium derived from bone marrow mesenchymal stromal cells cocultured with hepatocytes in alleviation of CCl4-induced liver damage in mice" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" } ["FULL_TEXT_RU"]=> array(36) { ["ID"]=> string(2) "42" ["TIMESTAMP_X"]=> string(19) "2015-09-07 20:29:18" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(23) "Полный текст" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(12) "FULL_TEXT_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "42" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(23) "Полный текст" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["PDF_RU"]=> array(36) { ["ID"]=> string(2) "43" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF RUS" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_RU" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "43" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28705" ["VALUE"]=> string(4) "2893" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2893" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF RUS" ["~DEFAULT_VALUE"]=> string(0) "" } ["PDF_EN"]=> array(36) { ["ID"]=> string(2) "44" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF ENG" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "44" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28709" ["VALUE"]=> string(4) "2892" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2892" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF ENG" ["~DEFAULT_VALUE"]=> string(0) "" } ["NAME_LONG"]=> array(36) { ["ID"]=> string(2) "45" ["TIMESTAMP_X"]=> string(19) "2023-04-13 00:55:00" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(72) "Название (для очень длинных заголовков)" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "NAME_LONG" ["DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "45" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(80) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(72) "Название (для очень длинных заголовков)" ["~DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } } } ["DISPLAY_PROPERTIES"]=> array(10) { ["AUTHOR_EN"]=> array(37) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28706" ["VALUE"]=> array(2) { ["TEXT"]=> string(231) "<p>Dima Joujeh¹, Abduljalil Ghrewaty¹, Adnan Almarrawi¹, Chadi Soukkarieh², Jamal Abdul N. Darwicha³</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(159) "

Dima Joujeh¹, Abduljalil Ghrewaty¹, Adnan Almarrawi¹, Chadi Soukkarieh², Jamal Abdul N. Darwicha³

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(159) "

Dima Joujeh¹, Abduljalil Ghrewaty¹, Adnan Almarrawi¹, Chadi Soukkarieh², Jamal Abdul N. Darwicha³

" } ["SUMMARY_EN"]=> array(37) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28708" ["VALUE"]=> array(2) { ["TEXT"]=> string(2041) "<p style="text-align: justify;">Mesenchymal stromal cell-derived conditioned medium therapy is a rapidly developing field of research that seems to have a significant impact on the treatment of various diseases. In the present study, the therapeutic effect of conditioned medium derived from bone marrow mesenchymal stromal cells (BMSCs) co-cultured with hepatocytes (H/BMSCs CM) was investigated for alleviation of CCl₄-induced liver damage in mice.</p> <h3>Materials and methods</h3> <p style="text-align: justify;">Hepatocytes were co-cultured with BMSCs for 20 h. H/BMSCs CM were then collected. Mice were intraperitoneally injected with CCl₄ twice a week for 7 weeks, followed by injection of H/BMSCs CM. Four weeks after the CM treatment, serum levels of ALT, AST, alkaline phosphatase (ALP), and albumin were determined, liver histopathology was examined, and ELISA assay was performed to measure the serum levels of IL-4 and IFN-γ. </p> <h3>Results</h3> <p style="text-align: justify;">The CM-treated group demonstrated marked decrease in serum levels of ALT and AST compared to RPMI group, without significant differences in the levels of alkaline phosphatase and albumin. Histopathological study demonstrated noticeable improvement in CM treatment group. CM treatment caused an increase in IL-4 production compared to RPMI group, and did not affect the release of IFN-γ.</p> <p style="text-align: justify;">Our results have shown that H/BMSCs CM treatment attenuates CCl₄-induced injury. Further studies should be carried out to elucidate the mechanism of action in order to achieve intended therapeutic effect which can be translated and optimized.</p> <h2>Keywords</h2> <p style="text-align: justify;">Mesenchymal stromal cells, bone marrow, hepatocytes, co-culture, conditioned medium, liver damage.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1859) "

Mesenchymal stromal cell-derived conditioned medium therapy is a rapidly developing field of research that seems to have a significant impact on the treatment of various diseases. In the present study, the therapeutic effect of conditioned medium derived from bone marrow mesenchymal stromal cells (BMSCs) co-cultured with hepatocytes (H/BMSCs CM) was investigated for alleviation of CCl₄-induced liver damage in mice.

Materials and methods

Hepatocytes were co-cultured with BMSCs for 20 h. H/BMSCs CM were then collected. Mice were intraperitoneally injected with CCl₄ twice a week for 7 weeks, followed by injection of H/BMSCs CM. Four weeks after the CM treatment, serum levels of ALT, AST, alkaline phosphatase (ALP), and albumin were determined, liver histopathology was examined, and ELISA assay was performed to measure the serum levels of IL-4 and IFN-γ.

Results

The CM-treated group demonstrated marked decrease in serum levels of ALT and AST compared to RPMI group, without significant differences in the levels of alkaline phosphatase and albumin. Histopathological study demonstrated noticeable improvement in CM treatment group. CM treatment caused an increase in IL-4 production compared to RPMI group, and did not affect the release of IFN-γ.

Our results have shown that H/BMSCs CM treatment attenuates CCl₄-induced injury. Further studies should be carried out to elucidate the mechanism of action in order to achieve intended therapeutic effect which can be translated and optimized.

Keywords

Mesenchymal stromal cells, bone marrow, hepatocytes, co-culture, conditioned medium, liver damage.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(1859) "

Mesenchymal stromal cell-derived conditioned medium therapy is a rapidly developing field of research that seems to have a significant impact on the treatment of various diseases. In the present study, the therapeutic effect of conditioned medium derived from bone marrow mesenchymal stromal cells (BMSCs) co-cultured with hepatocytes (H/BMSCs CM) was investigated for alleviation of CCl₄-induced liver damage in mice.

Materials and methods

Hepatocytes were co-cultured with BMSCs for 20 h. H/BMSCs CM were then collected. Mice were intraperitoneally injected with CCl₄ twice a week for 7 weeks, followed by injection of H/BMSCs CM. Four weeks after the CM treatment, serum levels of ALT, AST, alkaline phosphatase (ALP), and albumin were determined, liver histopathology was examined, and ELISA assay was performed to measure the serum levels of IL-4 and IFN-γ.

Results

The CM-treated group demonstrated marked decrease in serum levels of ALT and AST compared to RPMI group, without significant differences in the levels of alkaline phosphatase and albumin. Histopathological study demonstrated noticeable improvement in CM treatment group. CM treatment caused an increase in IL-4 production compared to RPMI group, and did not affect the release of IFN-γ.

Our results have shown that H/BMSCs CM treatment attenuates CCl₄-induced injury. Further studies should be carried out to elucidate the mechanism of action in order to achieve intended therapeutic effect which can be translated and optimized.

Keywords

Mesenchymal stromal cells, bone marrow, hepatocytes, co-culture, conditioned medium, liver damage.

" } ["DOI"]=> array(37) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28703" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-84-92" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-84-92" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-84-92" } ["NAME_EN"]=> array(37) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28704" ["VALUE"]=> string(174) "Therapeutic potential of conditioned medium derived from bone marrow mesenchymal stromal cells cocultured with hepatocytes in alleviation of CCl4-induced liver damage in mice" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(174) "Therapeutic potential of conditioned medium derived from bone marrow mesenchymal stromal cells cocultured with hepatocytes in alleviation of CCl4-induced liver damage in mice" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(174) "Therapeutic potential of conditioned medium derived from bone marrow mesenchymal stromal cells cocultured with hepatocytes in alleviation of CCl4-induced liver damage in mice" } ["ORGANIZATION_EN"]=> array(37) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28707" ["VALUE"]=> array(2) { ["TEXT"]=> string(996) "<p>¹ Department of Biotechnology Engineering, Faculty of Technical Engineering, University of Aleppo, Syria<br> ² Department of Animal Biology, Faculty of Sciences, Damascus University, Damascus, Syria<br> ³ Department of Pharmacology and Toxicology, Faculty of Pharmacy, Arab International University, Syria</p><br> <p><b>Correspondence:</b><br> Dr. Dima Joujeh, Department of Biotechnology Engineering, Faculty of Technical Engineering, University of Aleppo, Syria<br> Phone: (+963) 994046745<br> E-mail: dimajoujeh@gmail.com</p><br> <p><b>Citation:</b> Joujeh D, Ghrewaty J, Almarrawi A, et al. Therapeutic potential of conditioned medium derived from bone marrow mesenchymal stromal cells cocultured with hepatocytes in alleviation of CCl4-induced liver damage in mice. Cell Ther Transplant 2022; 11(2): 84-92.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(858) "

¹ Department of Biotechnology Engineering, Faculty of Technical Engineering, University of Aleppo, Syria
² Department of Animal Biology, Faculty of Sciences, Damascus University, Damascus, Syria
³ Department of Pharmacology and Toxicology, Faculty of Pharmacy, Arab International University, Syria

Correspondence:
Dr. Dima Joujeh, Department of Biotechnology Engineering, Faculty of Technical Engineering, University of Aleppo, Syria
Phone: (+963) 994046745
E-mail: dimajoujeh@gmail.com

Citation: Joujeh D, Ghrewaty J, Almarrawi A, et al. Therapeutic potential of conditioned medium derived from bone marrow mesenchymal stromal cells cocultured with hepatocytes in alleviation of CCl4-induced liver damage in mice. Cell Ther Transplant 2022; 11(2): 84-92.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(858) "

¹ Department of Biotechnology Engineering, Faculty of Technical Engineering, University of Aleppo, Syria
² Department of Animal Biology, Faculty of Sciences, Damascus University, Damascus, Syria
³ Department of Pharmacology and Toxicology, Faculty of Pharmacy, Arab International University, Syria

Correspondence:
Dr. Dima Joujeh, Department of Biotechnology Engineering, Faculty of Technical Engineering, University of Aleppo, Syria
Phone: (+963) 994046745
E-mail: dimajoujeh@gmail.com

Citation: Joujeh D, Ghrewaty J, Almarrawi A, et al. Therapeutic potential of conditioned medium derived from bone marrow mesenchymal stromal cells cocultured with hepatocytes in alleviation of CCl4-induced liver damage in mice. Cell Ther Transplant 2022; 11(2): 84-92.

" } ["AUTHOR_RU"]=> array(37) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28700" ["VALUE"]=> array(2) { ["TEXT"]=> string(311) "<p>Дима Джуджех¹, Aбдуджалил Гревати¹, Aднан Альмаррави¹, Чади Суккариех², Джамал Абдул Насер Дарвича³ </p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(239) "

Дима Джуджех¹, Aбдуджалил Гревати¹, Aднан Альмаррави¹, Чади Суккариех², Джамал Абдул Насер Дарвича³

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(239) "

Дима Джуджех¹, Aбдуджалил Гревати¹, Aднан Альмаррави¹, Чади Суккариех², Джамал Абдул Насер Дарвича³

" } ["SUBMITTED"]=> array(37) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28698" ["VALUE"]=> string(22) "10/13/2021 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "10/13/2021 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "10/13/2021 12:00:00 am" } ["ACCEPTED"]=> array(37) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28699" ["VALUE"]=> string(22) "01/28/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "01/28/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "01/28/2022 12:00:00 am" } ["SUMMARY_RU"]=> array(37) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28702" ["VALUE"]=> array(2) { ["TEXT"]=> string(3769) "<p style="text-align: justify;">Терапия с применением сред, кондиционированных стволовыми клетками, является быстро развивающейся областью науки, которая может внести существенный вклад в лечения различных болезней. В настоящей работе изучался терапевтический эффект кондиционированной среды из культуры стволовых клеток костного мозга (СККМ), которые кокультивировали с гепатоцитами (КС ККМ) с целью ослабления CCl₄-индуцированного повреждения печени у мышей.</p> <h3>Материалы и методы</h3> <p style="text-align: justify;">Гепатоциты кокультивировали с СККМ в течение 20 час., затем собирали кондиционированную среду от них. Мышам экспериментальной группы вводили внутрибрюшинно CCl₄ дважды в неделю в течение 7 недель, после чего вводили кондиционированную среду от кокультур СККМ и гепатоцитов. Через 4 недели определяли уровни АЛТ, АСТ, ALP и альбумина в сыворотке, оценивали гистопатологию печени, и определяли уровни IL-4 и IFN-γ в сыворотке посредством ИФА.</p> <h3>Результаты</h3> <p style="text-align: justify;">Группа, леченная введением кондиционированной среды СККМ/гепатоцитов, имела значительно сниженные уровни АЛТ и АСТ по сравнению с мышами, которым вводили среду RPMI без существенных различий в уровнях ALP и альбумина. Гистологическое исследование показало выраженное ослабление патологической картины печени в группе, леченной кондиционированной средой от кокультур СККМ/гепатоцитов. Введение конционированной СККМ среды вызывало повышение продукции IL-4 и не нарушало выхода IFN-γ.</p> <h3>Выводы</h3> <p style="text-align: justify;">Наши результаты показали, что введение сред из кокультур СККМ/гепатоцитов сопровождается ослаблением повреждений печени, вызванных CCl₄. Необходимы дальнейшие исследования, чтобы выяснить механизм действия и достичь желаемого терапевтического эффекта, который может быть репродуцирован и оптимизирован.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Стволовые клетки, костный мозг, гепатоциты, кокультура, кондиционированная среда, печеночная патология.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(3575) "

Терапия с применением сред, кондиционированных стволовыми клетками, является быстро развивающейся областью науки, которая может внести существенный вклад в лечения различных болезней. В настоящей работе изучался терапевтический эффект кондиционированной среды из культуры стволовых клеток костного мозга (СККМ), которые кокультивировали с гепатоцитами (КС ККМ) с целью ослабления CCl₄-индуцированного повреждения печени у мышей.

Материалы и методы

Гепатоциты кокультивировали с СККМ в течение 20 час., затем собирали кондиционированную среду от них. Мышам экспериментальной группы вводили внутрибрюшинно CCl₄ дважды в неделю в течение 7 недель, после чего вводили кондиционированную среду от кокультур СККМ и гепатоцитов. Через 4 недели определяли уровни АЛТ, АСТ, ALP и альбумина в сыворотке, оценивали гистопатологию печени, и определяли уровни IL-4 и IFN-γ в сыворотке посредством ИФА.

Результаты

Группа, леченная введением кондиционированной среды СККМ/гепатоцитов, имела значительно сниженные уровни АЛТ и АСТ по сравнению с мышами, которым вводили среду RPMI без существенных различий в уровнях ALP и альбумина. Гистологическое исследование показало выраженное ослабление патологической картины печени в группе, леченной кондиционированной средой от кокультур СККМ/гепатоцитов. Введение конционированной СККМ среды вызывало повышение продукции IL-4 и не нарушало выхода IFN-γ.

Выводы

Наши результаты показали, что введение сред из кокультур СККМ/гепатоцитов сопровождается ослаблением повреждений печени, вызванных CCl₄. Необходимы дальнейшие исследования, чтобы выяснить механизм действия и достичь желаемого терапевтического эффекта, который может быть репродуцирован и оптимизирован.

Ключевые слова

Стволовые клетки, костный мозг, гепатоциты, кокультура, кондиционированная среда, печеночная патология.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(3575) "

Терапия с применением сред, кондиционированных стволовыми клетками, является быстро развивающейся областью науки, которая может внести существенный вклад в лечения различных болезней. В настоящей работе изучался терапевтический эффект кондиционированной среды из культуры стволовых клеток костного мозга (СККМ), которые кокультивировали с гепатоцитами (КС ККМ) с целью ослабления CCl₄-индуцированного повреждения печени у мышей.

Материалы и методы

Гепатоциты кокультивировали с СККМ в течение 20 час., затем собирали кондиционированную среду от них. Мышам экспериментальной группы вводили внутрибрюшинно CCl₄ дважды в неделю в течение 7 недель, после чего вводили кондиционированную среду от кокультур СККМ и гепатоцитов. Через 4 недели определяли уровни АЛТ, АСТ, ALP и альбумина в сыворотке, оценивали гистопатологию печени, и определяли уровни IL-4 и IFN-γ в сыворотке посредством ИФА.

Результаты

Группа, леченная введением кондиционированной среды СККМ/гепатоцитов, имела значительно сниженные уровни АЛТ и АСТ по сравнению с мышами, которым вводили среду RPMI без существенных различий в уровнях ALP и альбумина. Гистологическое исследование показало выраженное ослабление патологической картины печени в группе, леченной кондиционированной средой от кокультур СККМ/гепатоцитов. Введение конционированной СККМ среды вызывало повышение продукции IL-4 и не нарушало выхода IFN-γ.

Выводы

Наши результаты показали, что введение сред из кокультур СККМ/гепатоцитов сопровождается ослаблением повреждений печени, вызванных CCl₄. Необходимы дальнейшие исследования, чтобы выяснить механизм действия и достичь желаемого терапевтического эффекта, который может быть репродуцирован и оптимизирован.

Ключевые слова

Стволовые клетки, костный мозг, гепатоциты, кокультура, кондиционированная среда, печеночная патология.

" } ["ORGANIZATION_RU"]=> array(37) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28701" ["VALUE"]=> array(2) { ["TEXT"]=> string(635) "<p>¹ Департамент биотехнологической инженерии, Факультет технической инженерии, Университет Алеппо, Сирия<br> ² Департамент биологии животных, Факультет наук, Университет Дамаска, Сирия<br> ³ Департамент фармакологии и токсикологии, Факультет фармации, Арабский международный университет, Сирия</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(575) "

¹ Департамент биотехнологической инженерии, Факультет технической инженерии, Университет Алеппо, Сирия
² Департамент биологии животных, Факультет наук, Университет Дамаска, Сирия
³ Департамент фармакологии и токсикологии, Факультет фармации, Арабский международный университет, Сирия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(575) "

¹ Департамент биотехнологической инженерии, Факультет технической инженерии, Университет Алеппо, Сирия
² Департамент биологии животных, Факультет наук, Университет Дамаска, Сирия
³ Департамент фармакологии и токсикологии, Факультет фармации, Арабский международный университет, Сирия

" } } } [10]=> array(49) { ["IBLOCK_SECTION_ID"]=> string(3) "214" ["~IBLOCK_SECTION_ID"]=> string(3) "214" ["ID"]=> string(4) "2065" ["~ID"]=> string(4) "2065" ["IBLOCK_ID"]=> string(1) "2" ["~IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(270) "Кокультивирование кардиомиоцитов и эпителиальных стволовых клеток амниона человека в амниотическом двуслойном матриксе в целях кардиомиогенеза" ["~NAME"]=> string(270) "Кокультивирование кардиомиоцитов и эпителиальных стволовых клеток амниона человека в амниотическом двуслойном матриксе в целях кардиомиогенеза" ["ACTIVE_FROM"]=> NULL ["~ACTIVE_FROM"]=> NULL ["TIMESTAMP_X"]=> string(22) "08/10/2022 02:20:38 pm" ["~TIMESTAMP_X"]=> string(22) "08/10/2022 02:20:38 pm" ["DETAIL_PAGE_URL"]=> string(159) "/en/archive/tom-11-nomer-2/eksperimentalnye-issledovaniya/kokultivirovanie-kardiomiotsitov-i-epitelialnykh-stvolovykh-kletok-amniona-cheloveka-v-amniotichesko/" ["~DETAIL_PAGE_URL"]=> string(159) "/en/archive/tom-11-nomer-2/eksperimentalnye-issledovaniya/kokultivirovanie-kardiomiotsitov-i-epitelialnykh-stvolovykh-kletok-amniona-cheloveka-v-amniotichesko/" ["LIST_PAGE_URL"]=> string(12) "/en/archive/" ["~LIST_PAGE_URL"]=> string(12) "/en/archive/" ["DETAIL_TEXT"]=> string(56415) "

Introduction

Coronary artery diseases are the second deadly disease worldwide causing heart failure as the terminal condition, claiming one life every 36 seconds in the USA [1, 2]. American Heart Association (AHA) reports a trend of coronary heart disease among youngsters as early as 20 years old, up to 15.5 million people, and experienced myocardial infarction every 46 seconds [3]. Similarly, according to the Indonesian Basic Health Research, Indonesia also shows an increasing tendency with 1.5% of the coronary heart disease cases at 15 years old or above, with related causes of death, 8.1% of general mortality in 2010. Total obstruction of the coronary artery causes death of cardiomyocytes, myocardial heart muscle infarction, and progressive failure when the vascularization is not immediately recovered. This condition has eventually led to heart failure, thus requiring heart replacement. In the Netherlands, only about 50% of patients received heart transplantation after 2.6 years of waiting, while 15% died [4].

Normally, the rate of cardiomyocyte replacement after birth is 1% per year after 20 years old, and 0.5% per year in the elderly. In total, 39% ventricular cardiomyocytes have been replaced after birth, while 36% of those cells have been replaced by 10 years old [5, 6]. Therefore, studies to regenerate the infarcted heart muscles are quite necessary, since the demand for heart transplantation is always insufficient. Nowadays, different attempts to improve cardiac regeneration capacity such as cellular transplantation, using different cell types such as stem cells and cardiac progenitor cells delivered using various methods. Stem cell therapy is believed to repair infarcted tissue, since the self-organ progenitor has been depleted [7, 8].

The available studies of cardiac engineering in vitro or in vivo point to low levels of newly formed cardiac tissue [9]. Animal studies and clinical practices presume this finding is due to low retention of the transplanted cells. Hou et al. (2005) have shown it by injections of human peripheral mononuclears (107 cells) labeled with ¹¹¹Indium-oxine in a porcine myocardial infarction model via intracardial, intracoronary, or intracoronary retrograde venous injections (IRV). Only 11.3% of the cells retained in the infarction area after six days after intracardiac injection, only 2.6±0.3% (p<0.05) were revealed locally following intracoronary delivery, and 3.2%±1%, when introduced by IRV [10].

Along with cellular retention, the issues in cellular therapy also include cell source, either autologous or allogeneic cells, which may be of low viability. Recently, tissue engineering has been proposed to improve cellular retention by using scaffolds to deliver the cells. Cell transplantation into the infarcted organ matrix seems to be irrational, since the matrix was subject to deterioration, it becomes thinner and stiff due to avascular structure and cell loss. The extracellular matrix composition has been altered, and the cardiac histoarchitecture has been disoriented. These alterations cannot provide a proper microenvironment for the newly transplanted cells. Hence, the cells may be delivered within a 3-D scaffold, as a provisional microenvironment to support stem cell colonization and growth [11]. The current tissue engineering technique is a co-culture system approach using a scaffold containing cells that can be applied to the damaged heart, known as "scaffold-based cell therapy" [12].

This study used human amniotic epithelial stem cells (hAESC) as a stem cell source for cell therapy, part of the translational study to regenerate the infarcted myocardium. Our group studied this cell type extensively in vitro, and the current study of co-culture with human cardiomyocytes had shown to induce the cardiomyogenesis process. Moreover, the origin of the hAESC presumes anti-inflammatory activity that concerns the issue of allogeneic tissue rejection, providing less immunogenic reaction. In addition, this is a waste tissue obtained at surgery, thus avoiding ethical issues, getting abundance of cells, and these samples are easy to obtain [13].

Materials and methods

Sampling of biomaterials

This study was designed to assess the optimal ratio of hAESC and hCardio for the cardiomyogenesis process when seeded on an amnion bilayer as the 3-D scaffold. All donors for human amnion epithelial stem cells (hAESC) and the human cardiomyocytes (hCardio) were obtained from the National Hospital Cipto Mangunkusumo, Jakarta, Indonesia. Placenta was obtained from the compliant donors negative for HIV, hepatitis B, and cytomegalovirus, by means of elective caesarean procedure which proceeded without complications. Placenta was transported to the laboratory within 30 minutes in the transport medium at 4°C. The transport medium consisted of DMEM (Dulbecco's Modified Eagle's Medium) 4.5 g.L^-1 (Sigma-Aldrich, USA), containing 10% (v/v) human platelet rich plasma (PRP), 1% (v/v) Inviclot® heparin sodium (Fahrenheit, Indonesia), and 3% (v/v) Gibco™ antibiotic-antimycotic (ThermoFisher, USA). The donor heart tissues were obtained from pediatric patients, with consent from their parents. The ethical board had approved all protocols of the Faculty of Medicine, Universitas Indonesia, and the ethical clearance number was KET.483/UN2.F1/ETIK/PPM.00.02/2019. Any specimens obtained in this study had been taken from the compliant donors, with informed consent obtained before the procedures.

Cardiac tissues were transported in the transport medium (see above), to the lab at 37°C to obtain the optimum cell number [14], while others were at 4°C unless otherwise stated, transported to the laboratory within 30 minutes. All specimens were initially verified for the microbial burden once they arrived at the lab, using a serial dilution of total plate count (TPC), taking the transport medium, inoculated onto Tryptic Soy Broth (Sigma-Aldrich, USA) and Difco™ Columbia Blood Agar (BD, USA) and incubated at 37°C. Also, inoculation onto Difco™ Sabouraud Dextrose Agar (BD, USA) was made to detect potential fungal contamination, with incubation at room temperature. All procedures to generate single-cells and culture were performed under aseptic conditions.

Isolation of the single-cell cardiomyocytes

The excess heart tissue was collected from the patients with hypertrophy of the right ventricle undergoing total correction surgery to restore the volume of the heart chamber. According to the previous method developed, the protocol to isolate cardiomyocytes from heart tissue included enzymatic, thermal, and mechanical methods [15]. Briefly, once arrived at the lab, after the initial procedures stated above, the tissue was weighted, and only 500-1000 mg of tissue was taken. The sample was washed twice in Dulbecco's phosphate-buffered saline Ca⁺⁺Mg⁺⁺free (Sigma-Aldrich, USA), minced up to 2×2×2 mm³, and loaded into a C-tube gentleMACS™ C-Tubes (Miltenyi Biotec, Germany), added with Collagenase type V (250 U.mL^-1 Gibco™) (ThermoFisher, USA), and proteinase type XXIV (Sigma Aldrich, USA). The tube was then fitted to the sleeve of the gentle MACS™ Octo Dissociator with Heater (Miltenyi Biotec, Germany), incubated for 1 hour, 37°C. The digestion process was then neutralized using two volumes of AscleStem complete medium added with the supplement (Nacalai Tesque, Japan). The cells were harvested using a 70 μm cell strainer (Biologix, China) and pelleted at 600×g for 5 minutes at room temperature. The collected cells were stained with Trypan Blue dye to assess the cellular viability, counted in a Neubauer haemocytometer, and visualized using the Brightfield microscope AxioVert.A1 (Carl Zeiss, Germany). Further confirmation of cardiomyocyte by the cell shape was performed using Live/Dead assay (Invitrogen, USA) and visualized using LSM 900 (Carl Zeiss, Germany) [16].

Isolation of human amnion epithelial stem cells

The single-cell hAESC was isolated following the method described in several papers with modifications [17, 18]. After the bio-burden assay, the fetal membrane was spread on a sterile dish to separate the chorion. The amnion membrane was washed in 50 mL of Hank’s Balanced Salt Solutions/ HBSS (Gibco, USA), followed by 50 mL of Versene solution (Gibco, USA) twice, to remove blood residue. The amnion membrane was then spread with the fetal side upright, incubated with TripleSelect (Gibco, USA) 50 mL distributed evenly, for 1 hour, 37°C. Thereafter, the fetal side was scraped gently to remove the cell layer, followed by neutralization using DTI solution (1x volume). The cell suspension was separated from tissue debris using a 100 μm cell strainer (Biologix, China). The cells were then collected by centrifugation at 150 g for 10 minutes. The amnion membrane was flipped over to allow the maternal side to be upright, followed by incubation with 2 mg.mL^-1 Collagenase-1 (Gibco, USA) and Hyaluronidase 66IU.mL^-1 (Thermo Fisher, USA) in DMEM 4.5 g.L^-1 (Sigma-Aldrich) for 1 hour, 37°C. The cell suspension was then filtered using a 100 μm cell strainer (Biologix, China); the cells were then harvested by centrifugation of the filtrate at 150 g, 10 minutes. The digestion was stopped using AscleStem™ Cardiomyocyte Differentiation Medium (Nacalai Tesque, Japan) complete medium, and the isolated cells were then collected, as mentioned before.

Characterization of the isolated hAESC and hCardio

All primarily isolated single-cell preparations were characterized using flow cytometry, antibodies used to identify the specific cells according to the specific epitopes described in the literature review. The epitopes were identified using BD FACSAria™ III, and the data were analyzed using BD FACS Diva 8.0.2 (BD Bioscience, USA). The cells of interest were separated from the background noise according to the data from unstained reading; the cut-off lower limit of the interested populations was set to the highest limit of the corresponding isotype specific to each antibody.

Both cell types, i.e., hAESC and hCardio, were firstly labelled for mesenchymal stem cell identity [19] against CD73 (Biolegend, USA), CD90 (Biolegend, USA), and CD105 (Biolegend, USA), whereas the anti-human Lineage cocktail (CD3, CD14, CD16, CD19, CD20, CD56) or Lin- (Biolegend) was used as the negative index. Further immunomodulatory factors in hAESC were confirmed to their HLA-DR antibody (L243) PE (SantaCruz, USA) paired to the murine monoclonal IgG2a PE, and the HLA-A/B/C antibody (D-2) FITC (SantaCruz, USA) paired to the mouse monoclonal IgG1 FITC (SantaCruz, USA). The h-Cardio were identified by labeling for the cardiac Troponin (cTnT) FITC (SantaCruz, USA) [20] paired to the murine monoclonal IgG2a kappa (SantaCruz, USA), murine anti-human CD31/ PECAM-1 FITC (BioLegend, USA) [21], and murine IgG-FITC isotype (BioLegend, USA), anti-human CD106/ VCAM1 PE (Biolegend, USA) paired to mouse IgG1 kappa isotype (BioLegend, USA), CD117/ cKit PE (Miltenyi Biotec, Germany) with mouse IgG1 kappa PE isotype (BioLegend, USA), CD 54/ ICAM PE (SantaCruz, USA) with mouse monoclonal IgG1 kappa isotype (BioLegend, USA). The hAESC were determined to the Nanog (A-11) PE (SantaCruz, USA) paired to mouse monoclonal IgG1 kappa PE (SantaCruz, USA) [17], Oct-3/4 (C-10) FITC (SantaCruz, USA) paired to mouse monoclonal IgG2b FITC, TRA-1-60 PE (SantaCruz, USA) paired to the murine monoclonal IgM PE, and SSEA-4 (813-70) FITC (SantaCruz, USA) paired to mouse monoclonal IgG3 FITC [18].

The cells prepared for flow cytometric analysis were set at 10⁵ cells per reading. All antibodies were labelled using extracellular markers, except the c-TnT labelling, since these epitopes are located at the wall of the nucleus membrane. The intracellular labelling followed the protocol published elsewhere. Briefly, after 2x washes with Ca⁺⁺, Mg⁺⁺ free PBS (10,000 rpm 10 min, the cells were washed in detergent to disintegrate the cell membrane using BD Perm/Wash™ (1 ml) at 25°C for 15 minutes, followed by fixation using BD Cytofix™ Fixation Buffer (4 mL), at 25°C, 15 min, washed in PermWash (2x). Then the pellet was labelled against cTnT, incubated at 4°C, for one hour. The extracellular labelling was performed with PBS Ca⁺⁺ Mg⁺⁺ free consecutively after each treatment, labelled with all antibodies and isotypes stated above with 1 µl per 10⁶ cells, at 4°C for 1 hour. The cell population was counted using FACS BD Flow cytometer, designed to stop after 30,000 cells counting.

Co-culture of hAESC and h-Cardio on an amnion bilayer scaffold

Both cell types were seeded onto the amnion bilayer, with a seeding density of 5×10⁵ cell.cm^-1. The ratio of hAESC and h-Cardio seeded on the graft was prepared at a 5:1 ratio [22], as the maximum number of cells isolated from each harvest was about 106 cells; therefore, the optimum cell ratio was compared to the 1:6. The mixture cells were suspended in the complete AscleStem™ Cardiomyocyte Differentiation Medium (Nacalai Tesque, Japan). Briefly, the amnion bilayer scaffold was round in shape, sized 4 cm in diameter, blotted dry and placed inside-out, seeded with cell-mixture suspension at 5×10⁵ cell.cm^-1 diluted in the complete AscleStem™ Cardiomyocyte Differentiation Medium (Nacalai Tesque, Japan); with addition of Supplements A (Nacalai Tesque, Japan and B (Nacalai Tesque, Japan). The seeded graft was incubated at 37°C, 5% CO₂, for nine days, and the culture medium was refreshed every three days.

The seeded co-cultures of hAESC and h-Cardio were terminated after Day 2, Day 5, and Day 8 incubation for proliferation and cardiomyogenesis verifications.

Cellular proliferation

The proliferation of the seeded cells was counted by the ATP amounts generated by the cells, quantified using ATPLite assay (PerkinElmer, USA), and qualitatively using Live/Dead staining (Invitrogen, USA), and visualised using LSM 900 (Carl Zeiss, Germany). The ATP contents have been measured by counting the luminescence intensity per second using the plate-reader Varioskan™ LUX multimode microplate reader (Thermo, USA). Briefly, each graft was washed in DPBS 3x, then minced and digested in lysis buffer (Perkin Elmer, USA) for 10 min, with agitation at 25°C, the tissue was separated by centrifugation. 100µL of the suspension were aliquoted into each well of the Opti-Plate well (Thermo, USA), with replications, supplied with 100µL of Luminescence buffer and shaked at 300 rpm for 10 minutes in the dark.

Qualitative viability analysis was determined using Live/Dead staining (Invitrogen) [23]. Briefly, the specimens were washed three times in DPBS (Sigma, USA), and incubated in Calcein 4µM that will stain cytoplasm of viable cells, and Ethidium homodimer (2 µM) staining nuclei of the dead cells, for 30 minutes, 37°C, in dark, followed by DPBS (Sigma, USA) washes (three times). The specimens were placed on a microscope slide, added with DABCO™ mounting medium (Sigma, USA), and visualized under the confocal microscopy, LSM900 confocal microscope (Zeiss, Germany).

Real-time RT-qPCR

The cardiomyogenesis gene expression from the seeded co-culture of the h-Cardio and hAESC in a 3D amnion bilayer graft were analyzed using RNA extracted with TRIzol™ Reagent (ThermoFisher, USA). RNA samples (1 µg) were converted to the complementary matrix DNA using SensiFAST™ cDNA Synthesis Kit (Bioline, USA), then amplified using Techne Prime Pro 48 Real-time qPCR System (Techne, UK), SensiFAST™ SYBR Lo-ROX Kit (Bioline, USA). The α-actinin expression identified the specific feature of cardiomyogenesis process (at the Z-disc, this factor regulates transcription of the actin-binding protein, and contraction of myofibrillar actin filaments) [24]. The primers used were as follows: for actinin (ACTN2): F5'AGCCGAATTTGCCCGCATTA3', R5'TGAAGGATTGGAAGGTGACGG3'; for cTnT (cardiac regulatory proteins to coordinate the interaction between actin and myosin through the calcium channel) [25], the human cardiac troponin/ cTnT: F5'CAAGGAGCTGTGGCAGACGAT3', R5'GCTCCCCATTTCCAAACAGGA3', and for the myosin heavy chain/MHC (reflecting the contractility of cardiac muscle) [26] MHC: F5'ACCTGAAGGAGAACATCGCC3', R5’AAGCCCTTCGTGCCAATGTC3’. The reference gene was GAPDH detected with the following primers: F5’AACATCATCCCTGCCTCTACT3’, R5’CTCCGACGCCTGCTTCAC3’.

Data analysis of the RT-PCR was performed using the Livak method. Briefly, all ΔCT values were normalized to the Ct value of the reference gene, followed by normalization of the cardiomyogenesis genes (cTnT, MHC, α-actinin) to the cardiomyocytes of normal heart serving as controls, to obtain the ΔΔCT values.

TNFα measurement using ELISA

The measurement of TNFα cytokine released to the culture medium after incubation of the co-culture was made from Day 1, Day 5, Day 7, and Day 8. H9C2 cells (rat neonatal heart cells) seeded in each 96-well plate, 25,000 cells per well, after 24 hours incubation with DMEM containing 10% FBS (Gibco, LifeTechnologies), were replaced with the tested culture medium and allowed to incubate for 48 hours. The measurements were performed using ELISA kit (1-StepTM Ultra TMB-ELISA, Thermo Scientific).

Results and discussion

This study is a part of the translation study to regenerate an infarcted heart wall using scaffold-based cell therapy. Cell therapy using a co-culture of hAESC and h-Cardio delivered in an amnion bilayer as a vehicle and temporary media before the transplanted cells will adapt for the new microenvironment. Our aim was to derive the hAESC from becoming the self-cardiomyocytes. As cell therapy is considered a tool for regeneration of infarcted heart wall, this study aims for helping the physicians to decide which cell source is suitable for the patient, either autologous or allogeneic cells.

The 3-D matrix vehicle used in this study was an amnion bilayer (Fig. 1A), prepared using a decellularized amnion membrane after extensive washes in 0.05% SDS (w/v) and Triton X-100, 0.1% (v/v), then overlayed with fibrin. The acellularity was confirmed using H&E staining (Fig. 1B), since no nuclei were identified, and further DNA residue was validated using DAPI staining, with no blue fluorescence highlighting the double strain DNA (Fig. 1C). The graft was biocompatible as revealed by contact toxicity assay using human bone marrow-MSC, with cell growth into the matrix (Fig. 1D). Fig. 1E shows the waste tissue of the heart weighing about 500-1000 mg. The tissue was then processed to become a single cell, shown in Fig. 1F, as the rod-shaped cells reported in many papers [27]. Fig. 1G shows the single cell of hAESC with a cobblestone appearance.

The heart cells were then characterized using flow cytometry to identify the cardiomyocyte phenotypes, e.g., cTnT (10.7%), progenitor cell marker cKit (16%), the adhesion molecule ICAM (94%), the endothelial marker PECAM+/VCAM- (33%), as seen in Fig. 1H. The hAESC were shown to express pluripotent phenotypes: TRA-1-60 (82.4%), SSEA-4 (28.2%), Oct-3/4 (2.9%), Nanog (11.4%), with no detectable expression of immune antigens, such as HLA-DR (0%), HLA-ABC (0.2%). Expression of mesenchymal markers was low, i.e., CD73 (20.2%), CD90 (0.4%), CD105 (59.2%), while the Lin- (CD3, CD14, CD16, CD19, CD20, CD56) were undetectable (Fig. 1I, 1J). Many studies have already reported these expression patterns, among other embryonic stem cells markers SSEA-3, SSEA-4, TRA 1-60, TRA 1-81, Oct-4, and Nanog [18]. Therefore, the hAESC might be a suitable candidate for transplantation taken from allogeneic sources, because they had no expressed antigen that would induce immune-mediated rejection [28, 29]. Further investigations will show whether this cell candidate and the proposed culture system are suitable for deriving cardiomyogenesis.

Figure 1. The scaffold for 3-D culture (amnion bilayer) used in this study. (A) Macroscopic view of the scaffold, thickness of 500 µm. (B) Section of the amnion bilayer stained with H&E and (C) DAPI, showed no cell remnants, or traces of DNA, respectively. (E) The waste tissue taken from the excess heart wall. The single cells of the (F) hAESC and (G) hCardio following isolation from the human amnion membrane and cardiac samples, respectively. The cells were captured at 100x magnification.

The production of the pro-inflammation cytokine released from the transplant or donor tissue might hinder the transplant from integrating at the transplantation site. The proinflammatory cytokines TNF-α and IL-12 are released by cytotoxic M1 macrophages (CD68+ and CD80+) related to production of highly reactive oxygen intermediates and nitric oxide. These classic factors of inflammation method kill the pathogens; however, they sometimes cause the reverse effect to the host through massive fibrosis or scarring [30]. Some reports showed that elevation of TNF-α after transplantation correlates with fibrosis/scarring process in pulmonary fibrosis [31], and scarring trachoma [32]. Other workers also reported that primary cells from the hAESC at passage 0 until passage 5 suppressed the T cell proliferation by exerting immunosuppressive effects [33].

The current study showed that the co-culture of hAESC and h-Cardio at both ratios (1:5 and 1:6) caused only weak release of TNF-α into the culture medium (<1 pg/mL) after 1-5-7-8 days of cultivation. There were no differences between the both groups at any time point (Fig. 2B). The data on TNF-α serum levels among patients after liver transplantation showed that TNF-α was significantly higher among the patients with organ rejections (941±83 pg.mL^-1) compared to the patients in a stable clinical condition (240±6 pg.mL^-1; p=0.0001) [34]. Hence, the measurement of the culture medium of the co-culture hAESC and h-Cardio in the amnion bilayer graft suggests that the co-culture might not induce inflammation under the in vivo conditions.

The culture system in a custom-made 6-well plate to incubate the co-cultures in a 3-D construct is shown in Figure 2A. The Brightfield images of the co-culture constructs (Figure 2 C-G for the 1:5 ratio, and the Figure 2H-L for the 1:6 group; Day 1-3-5-7-8, respectively).

Figure 2. The images of 3D culture system. (A) the 6-well plate modified to incubate the seeded hAESC and hCardio on the amnion bilayer. (B) Measurement of TNFα and its standard; 3-D culture of hCardio and hAESC; (C,H) Day 1, (D,I) Day 3, (E,J) Day 5, (F,K) Day 7, (G,L) Day 8. The top row (C-G) shows the cultures at 5:1 ratio, and the bottom row (B-L) shows 6:1 ratio. D and I are made at 50x magnification, others show 100x magnification.

The confocal microscopy images (Figure 3A-C, 1:5 ratio, and Figure 3D-F, 1:6 ratio; Day 2-5-8, respectively) also demonstrate that the cell population had consistently expanded over time. The confocal images of the co-culture cells stained with Calcein AM were visualized using LSM700 Observer 2.1 (Zeiss, Germany), Z-stack every 10 µm. The initial culture on Day 2 showed that the cells were still solitary, rounded, and aggregated. The cells looked well distributed across the plane, although still sparse. These might indicate that the seeding method provided good distribution. On day 5, the cell population started to proliferate with increase of cellular population, and, apparently, some cell-to-cell connections were seen. The cells also migrated by ingrowth to the deeper layers, until 120 µm, compared to only 70 µm for the 1:5 group (Figure 3A, B, C), the 1:6 group (Figure 3D, E, F) also had migrated to the deeper plane. After 8 days of incubation, all experimental groups showed projections between cells (T-tunnel/ TNT) behaviour, and the population became very dense. It was unable to discern single cells. The 1:5 and the 1:6 images appeared as the cell colony (Fig. 3C and F, respectively). This cytoplasm projections are believed to facilitate cell-to-cell communications. Dupont et al. (2018) reported that the protrusion of the tunnelling nanotubes (TNT) is formed by the projection of the thin cell membrane to reach the distant cells, or through exosomes or vesicles [35]. Other reports showed that direct co-culture of mixed cells creates cell communications between different cell types through a gap junction and other means such as cytokine or hormone effects through specific receptors [36].

Figure 3. The 3-D images of hAESC co-culture with hCardio in amnion bilayer graft on Day 2 (A,D), Day 5 (B, E), and Day 8 (C, F). The A-C present the 1:5 seeding ratio, and the D-F were the 1:6 ratios

Viability assay was performed with Live/Dead staining, the images were taken using a confocal microscope 700 LSM Observer 2.1 (Zeiss, Germany) using Z-stack, at the interval of 10 µm. Green colour indicates viable cells, stained with Calcein AM (excited at 480 nm). Red colour indicates dead cells, stained using Ethidium homodimer (excited at 555 nm. emission at 560 nm), with laser diode gained at 635 nm.

In general, cellular survival depends on their capability to adhere and consolidate to the surrounding extracellular matrix, which is facilitated by the cellular adhesion peptides (CAP), such as the RDG binding molecules. Fibronectin is one of the RGD that decides the re-endothelialization of the scaffold through integrin α5β1 and αvβ3 dimers binding [37]. Furthermore, the optimizing integrin, heparin, and leucocyte surface receptors may improve cellular integration into the matrix in vitro [38].

The current study investigated relative gene expression in cardiomyogenesis by qPCR using the following markers: cardiac troponin (cTnT), myosin heavy chain (MHC), and α-actinin (ACTN2) expression. The co-culture on day 2 and day 5 did not show any cardiomyogenesis gene expression in both cultures. Nevertheless, since day 8, the 1:6 group had expressed the specific gene for cardiomyocytes; the cTnT (one-fold), the MHC, and the ACTN2 (one-fold) (Fig. 4). Perhaps, the co-culture of h-Cardio and hAESC at 1:6 ratio on a 3-D amnion bilayer scaffold might be the optimal culture condition to achieve cardiomyogenesis. Meanwhile, our previous study of a 2-D culture of h-Cardio and hAESC revealed absence of cTnT, MHC, and ACTN2 expression (unpublished results).

Figure 4. Gene expression in the 3-D co-cultures of the hAESC and hCardio after 2, 5 and 8-day incubation

All samples showed no differences after analysis by the two-way ANOVA test, and compared using Sidak’s test. Although the "1:6" group after 8-day incubation showed slight increase compared to others, this difference was insignificant. The difference between the groups at different seeding ratios was insignificant for cTnT expression (p=0.42), MHC (p=0.42), and ACTN2 (p=0.44), neither the culture duration (p>0.05).

Adult cardiomyocytes have limited ability to regenerate after birth [5, 6]. Therefore, adding a suitable cell type to improve severe heart diseases, such as progressive heart failure, is essential. In the present study, the waste heart tissue from the patients aged 0-2 years old subjected to the total correction surgery due to the tetralogy of Fallot was used for the cardiomyocyte isolation. The isolated cardiomyocytes supplied with hAESC to augment the transplanted cells were delivered to the 3-D scaffold. The scaffold acts as a temporary shelter that provides an ideal microenvironment for the transplanted cells until the cells adapt to the surrounding host environment. The microenvironment in an injured myocardium seems not provide effective support to the cell survival due to hypoxic and low-glucose conditions. The in vitro modeling of an infarct condition has shown to restrain cellular viability and prevent the stem cells from differentiation to cardiomyocytes [39]. In conclusion, optimal results from cell transplantation are not only the matter of cells, but a correct delivery approach is also crucial. In this respect, tissue engineering might resolve this problem.

Many reports have indicated that hAESC expressed cardiac-specific genes encoding atrial and ventricular myosin light chain 2 (MLC-2A and MLC-2V), and the transcription factors GATA-4 and Nkx-2.5 in vitro. Expression of MLC-2A and MLC-2V, as well as GATA-4 and Nkx 2.5 was shown by RT-PCR in hAESC after 14 days of cultivation in the medium supplemented with 1 mM of ascorbic acid. The hAESC differentiated to cardiomyocytes exhibited expression of α-actinin, as proved by immunocytochemistry [40]. Other studies comparing ability of hAESC, human umbilical cord cells, and human adipose MSC for regeneration of myocardial infarction following intramural injection in athymic nude rats have found that hAESC was superior to other cells types, i.e., after four weeks, 3% of the injected hAESC exhibited a myocardial marker. The area of infarction after hAESC injection was characterized by decreased infarct size and showed an improved cardiac function [41].

Nonetheless, other cells, such as bone marrow MSC, are also believed to have capability for cardiomyogenesis. Bone marrow MSCs were taken from the femur and tibia of rats and co-cultured indirectly with cardiomyocytes taken from the ventricular wall at the 1:10 ratio, separated with a semipermeable membrane, and then cultivated for 1-3 weeks. It was shown that the resulting cells expressed SERCA2 and RyR genes, and, when implanted in rats, cardiac troponin T, cardiac troponin I, α-actinin, and desmin were expressed in the sections [42].

Direct contact between the cells is required to stimulate the differentiation of hAESC into cardiomyocytes. It is believed that bioelectric signals between cells dictate cell signalling that influences the resting potential of cell membranes which controls regulation of growth, migration, and differentiation signals. These findings were reported in a previous study by Wang et al. concerning the factors that encourage cell differentiation into cardiomyocytes through direct contact: the elasticity of cell, increase of ligands-receptors, molecule-integrin adhesion, and signal transcription [43].

The author realized that no identical study uses similar cell types and culture systems to compare. A study from our group using human adipose MSC taken from a younger donor (30 years old) compared to the elderly donor (60 years old) when co-cultured with h-Cardio on a 3-D scaffold (at 1:5 and 1:6 ratio, respectively), showed that initial culture (Day 2) only the 60 years old group had slight expression of MHC. However, after Day 5, the 30-year old group was superior in expressing cTnT, MHC, ACTN2, and, even, PPARγ, at significantly higher level, but it was diminished after Day 9 in all groups [44]. That study reported that the 1:5 ratio for adipose MSC is superior, as it revealed higher numbers of viable cells. Adipose MSC is considered an excellent autologous cell source, being less invasive for sampling. Nonetheless, according to Sandora et al. (2021) it might not be an ideal cell source when the elderly patient occurs with myocardial infarction. It was shown that, even though the elderly group was taken from the brown adipose tissue and had higher MSC expression than in younger persons (30 years old, white adipose tissue), the cardiomyogenesis process was superior when using the cells from younger donors. However, this study cannot maintain a cardiomyogenesis observed in this system after Day 9, as all the interested expressions disappeared [44].

Nonetheless, another co-culture study also reported similar results to our study; however, using an indirect co-culture system of adipose MSC and cardiomyocytes studied in rats, separated by a semipermeable membrane at the ratio of 1:5 for 2 weeks, indicated that the MSC transformed into elliptical-shape cells and started to contact with other cells to form a streaky pattern. The cells were found to express α-actinin and cardiac troponin (cTnT) just after 5 days of incubation and reached their peak by the day 14 (29.63% and 27.38%, respectively). The medium was also found to contain TGF-β, GATA-4, Nkx-2.5, and MEF-2C which pointed to the cardiomyogenesis process [22, 45]. The human heart expresses β1- and β2-adrenergic receptors that are crucial in developing heart failure [46]. The β1 subtype stimulates cardiac muscles but relaxes blood vessels, while the β2 subtype plays an opposite role; in relaxing the smooth muscle and regulating the contractility of cardiac muscles [47]. Ageing events affect sensitivity of β-adrenergic receptors in elderly persons (59-71 years old) compared to young subjects (1-13 years old) [48].

There are two methods to deliver cell or cell vehicles in cardiac engineering, e.g., using a heart patch or hydrogel carrier. There are advantages and disadvantages between these two methods. The patches are more invasive and require open heart surgery; however, they can be transplanted in any area that cannot be reached transthoracic, firmly stitched to the epicardial. The hydrogel can be delivered via a catheter, being less invasive. However, the accessible area to deliver the cells is more limited than with the patches [49]. In this study, the amnion bilayer was designed as a heart patch. The use of a 3-D scaffold derived from acellular amnion membrane biomaterials (amnion bilayer) is a tissue by human origin, being acellular and still maintaining high elasticity. The matrix also contains fibronectin (not published), which increases stem cell adhesion and growth [50]. These properties might provide a suitable microenvironment for the transplanted cells. Along with the biological scaffold, a bioactive matrix might also be a promising candidate to improve cellular retention when the cells are transplanted in order to regenerate the infarcted heart wall [52].

Human amniotic epithelial cells (hAESCs) possess embryonic stem cell-like proliferation and differentiation capabilities and adult stem cell-like immunomodulatory properties [40]. As described in an extensive review, hAESC is considered a suitable candidate that can differentiate into cardiomyocytes [52]. It also do not express HLA-DR and HLA-A, B, C, thus preventing induction of immune reaction when transplanted [28, 29]. Compared with other stem cells, hAESC has unique advantages, including easy isolation, abundant cell quantities, avoiding ethical debates, as well as lower immunogenicity and absence of tumorigenic properties [53]. The cultivated and isolated hAESC populations are also reported to express normal karyotype, and are nontumorigenic upon transplantation [40].

Myocardial infarction (MI) leads to heart failure (HF) due to cardiac remodelling, especially wasting of the left ventricle (LV). The remodelled heart wall wastes the structure, molecular function, heart cells, and heart size, shape, and undergoes functional deterioration. Patients with extensive remodelling areas will immediately progress to terminal heart failure. Recent anti-remodelling therapy only slows the heart failure progression, nonetheless, the morbidity and mortality are still high [54].

Conclusion

This in vitro study showed that options for cell therapy (h-Cardio co-culture with hAESC at 1:6 ratio) using a biological scaffold (amnion bilayer) exhibited activation of the cardiomyogenesis-associated genes. The co-cultured cells were able to attach, migrate, proliferate and form intercellular connections. In future studies, the h-Cardio will be taken from the patient’s autologous cells, whilst the hAESC will be from an allogeneic source.

Acknowledgement

The authors would like to thank Dr. Cipto Mangunkusumo National Central Public Hospital for facilitating the authors in subject recruitment and Faculty of Medicine.

This study was supported by grant no. NKB-0541/UN2.R3.1/HKP.05.00/2019 from the University of Indonesia.

Conflict of interest

The authors declare that there is no conflicts of interest.

Ethical approval

All methods in this study have been reviewed and approved by the Ethical Committee of Universitas Indonesia with Ethical Approval no. KET.483/UN2.F1/ETIK/PPM.00.02/2019.

All methods in this study were conducted in accordance with the Ethical Committee of Universitas Indonesia (Ethical Approval no. KET.483/UN2.F1/ETIK/PPM.00.02/2019) approved protocols.

Written informed consent was obtained from the patient(s) for their anonymized information to be published in this article.

References

1. Ralapanawa U, Sivakanesan R. Epidemiology and the Magnitude of Coronary Artery Disease and Acute Coronary Syndrome:
   A Narrative Review. J Epidemiol Glob Health. 2021;11(2):169-177. doi: 10.2991/jegh.k.201217.001
2. Control CfD, Prevention. Underlying cause of death, 1999-2018. CDC WONDER Online Database Atlanta, GA: Centers for Disease Control and Prevention. 2018.
3. Sanchis-Gomar F, Perez-Quilis C, Leischik R, Lucia A. Epidemiology of coronary heart disease and acute coronary syndrome. Ann Transl Med. 2016;4(13):256. Epub 2016/08/09. doi: 10.21037/atm.2016.06.33
4. Roest S, Kaffka genaamd Dengler SE, van Suylen V, van der Kaaij NP, Damman K, van Laake LW, et al. Waiting list mortality and the potential of donation after circulatory death heart transplantations in the Netherlands. Netherlands Heart Journal. 2021;29(2):88-97. doi: 10.1007/s12471-020-01505-y
5. Michler RE. Stem cell therapy for heart failure. Metho-dist DeBakey cardiovascular journal. 2013;9(4):187-194.
   doi: 10.14797/mdcj-9-4-187
6. Lázár E, Sadek HA, Bergmann O. Cardiomyocyte renewal in the human heart: insights from the fallout. Eur Heart J. 2017;38(30):2333-2342. doi: 10.1093/eurheartj/ehx343
7. Smit NW, Cocera Ortega L, Vegh AMD, Meijborg VMF, Smits AM, Klerk M, et al. Human cardiomyocyte progenitor cells in co-culture with rat cardiomyocytes form a pro-arrhythmic substrate: evidence for two different arrhythmogenic mechanisms. Front Physiol. 2017;8:797. doi: 10.3389/fphys.2017.00797
8. Ghiroldi A, Piccoli M, Cirillo F, Monasky MM, Ciconte G, Pappone C, et al. Cell-based therapies for cardiac regeneration:
   a comprehensive review of past and ongoing strategies. Int J Mol Sci. 2018;19(10).
   doi: 10.3390/ijms19103194
9. Joggerst SJ, Hatzopoulos AK. Stem cell therapy for cardiac repair: benefits and barriers. Expert Rev Mol Med. 2009;11:e20. doi: 10.1017/s1462399409001124
10. Hou D, Youssef EA, Brinton TJ, Zhang P, Rogers P, Price ET, et al. Radiolabeled cell distribution after intramyocardial, intracoronary, and interstitial retrograde coronary venous delivery: implications for current clinical trials. Circulation. 2005;112(9 Suppl):I150-1156. doi: 10.1161/circulationaha.104.526749
11. Taylor DA, Chandler AM, Gobin AS, Sampaio LC. Maximizing cardiac repair: should we focus on the cells or on the matrix? Circ Res. 2017;120(1):30-32. doi: 10.1161/CIRCRESAHA.116.309959
12. Rodrigues ICP, Kaasi A, Maciel Filho R, Jardini AL, Gabriel LP. Cardiac tissue engineering: current state-of-the-art materials, cells and tissue formation. Einstein (Sao Paulo). 2018;16(3):eRB4538. doi: 10.1590/S1679-45082018RB4538
13. Parolini O, Alviano F, Bagnara GP, Bilic G, Bühring HJ, Evangelista M, et al. Concise review: isolation and characterization of cells from human term placenta: outcome of the first international Workshop on Placenta Derived Stem Cells. Stem Cells. 2008;26(2):300-311. Epub 2007/11/03. doi: 10.1634/stemcells.2007-0594
14. Putra MA, Sandora N, Suwarti, Nurhayati RW, Nauli R, Kusuma TR, et al. Transport viable heart tissue at physiological temperature yielded higher human cardiomyocytes compared to the conventional temperature. Cell Tissue Bank. 2022. doi: 10.1007/s10561-021-09978-w
15. Sandora N, Putra MA, Nurhayati RW, Suwarti, Nauli R, Kusuma TR, et al. Characterisation of the single-cell human cardiomyocytes taken from the excess heart tissue of the right ventricular outlet in congenital heart disease. Cell Tissue Bank. 2021. doi: 10.1007/s10561-021-09970-4
16. Axio Imager 2 Microscopy [Internet]. Carl Zeiss Microscopy LLC. 2013.
17. Koike C, Zhou K, Takeda Y, Fathy M, Okabe M, Yoshida T, et al. Characterization of amniotic stem cells. Cellular Reprogramming. 2014;16(4):298-305. doi: 10.1089/cell.2013.0090
18. Miki T, Mitamura K, Ross MA, Stolz DB, Strom SC. Identification of stem cell marker-positive cells by immunofluorescence in term human amnion. J Reprod Immunol. 2007;75(2):91-96. doi: 10.1016/j.jri.2007.03.017
19. Germscheid NM, Thornton GM, Hart DA, Hildebrand KA. Wound healing differences between Yorkshire and red Duroc porcine medial collateral ligaments identified by biomechanical assessment of scars. Clin Biomechanics. 2012;27(1):91-98. doi: 10.1016/j.clinbiomech.2011.07.001
20. Ban K, Wile B, Kim S, Park H-J, Byun J, Cho K-W, et al. Purification of cardiomyocytes from differentiating pluripotent stem cells using molecular beacons that target cardiomyocyte-specific mRNA. Circulation. 2013;128(17):1897-1909. doi: 10.1161/CIRCULATIONAHA.113.004228
21. Newman PJ, Newman DK. Signal Transduction Pathways Mediated by PECAM-1. Arteriosclerosis. Thromb Vascular Biol. 2003;23(6):953-964. doi: 10.1161/01.ATV.0000071347.69358.D9
22. Zeng J, Wang Y, Wei Y, Xie A, Lou Y, Zhang M. Co-culture with cardiomyocytes induces mesenchymal stem cells to differentiate into cardiomyocyte-like cells and express heart development-associated genes. Cell Res. 2008;18(S1):S62-S. doi: 10.1038/cr.2008.152
23. Petronilli V, Miotto G, Canton M, Brini M, Colonna R, Bernardi P, et al. Transient and long-lasting openings of the mitochondrial permeability transition pore can be monitored directly in intact cells by changes in mitochondrial calcein fluorescence. Biophys J. 1999;76(2):725-734. doi: 10.1016/S0006-3495(99)77239-5
24. Tiso N, Majetti M, Stanchi F, Rampazzo A, Zimbello R, Nava A, et al. Fine mapping and genomic structure of ACTN2, the human gene coding for the sarcomeric isoform of alpha-actinin-2, expressed in skeletal and cardiac muscle. Biochem Biophys Res Commun. 1999;265(1):256-259. doi: 10.1006/bbrc.1999.1661
25. Wade R, Eddy R, Shows TB, Kedes L. cDNA sequence, tissue-specific expression, and chromosomal mapping of the human slow-twitch skeletal muscle isoform of troponin I. Genomics. 1990;7(3):346-357. doi: 10.1016/0888-7543(90)90168-t
26. Nakao K, Minobe W, Roden R, Bristow MR, Leinwand LA. Myosin heavy chain gene expression in human heart failure. J Clin Invest. 1997;100(9):2362-2370. doi: 10.1172/JCI119776
27. Bird SD, Doevendans PA, van Rooijen MA, Brutel de la Riviere A, Hassink RJ, Passier R, et al. The human adult cardiomyocyte phenotype. Cardiovasc Res. 2003;58(2):423-434. doi: 10.1016/s0008-6363(03)00253-0
28. Bartels MC, Otten HG, Van Gelderen BE, Van der Lelij A. Influence of HLA-A, HLA-B, and HLA-DR matching on rejection of random corneal grafts using corneal tissue for retrospective DNA HLA typing. Br J Ophthalmol. 2001;85(11):1341-1346. doi: 10.1136/bjo.85.11.1341
29. Hall B, Duggin G, Philips J, Bishop GA, Horvath J, Tiller D. Increased expression of HLA-DR antigens on renal tubular cells in renal transplants: relevance to the rejection response. Lancet. 1984; 324(8397):247-251. doi: 10.1016/s0140-6736(84)90297-6
30. Badylak SF, Gilbert TW. Immune response to biologic scaffold materials. Semin Immunol. 2008; 20(2):109-116.
    doi: 10.1016/j.smim.2007.11.003
31. Hasegawa M, Fujimoto M, Kikuchi K, Takehara K. Elevated serum tumor necrosis factor-alpha levels in patients with systemic sclerosis: association with pulmonary fibrosis. J Rheumatol. 1997;24(4):663-665. PMID: 9101498
32. Conway DJ, Holland MJ, Bailey RL, Campbell AE, Mahdi O, Jennings R, et al. Scarring trachoma is associated with polymorphism in the tumor necrosis factor alpha (TNF-alpha) gene promoter and with elevated TNF-alpha levels in tear fluid. Infect Immun. 1997;65(3):1003-1006. doi: 10.1128/IAI.65.3.1003-1006.1997
33. Pratama G, Vaghjiani V, Tee JY, Liu YH, Chan J, Tan C, et al. Changes in culture expanded human amniotic epithelial cells: implications for potential therapeutic applications. PloS One. 2011;6(11):e26136. doi: 10.1371/journal.pone.0026136
34. Imagawa D, Millis J, Olthoff K, Derus L, Chia D, Sugich L, et al. The role of tumor necrosis factor in allograft rejection. I. Evidence that elevated levels of tumor necrosis factor-alpha predict rejection following orthotopic liver transplantation. Transplantation. 1990;50(2):219-225. doi: 10.1097/00007890-199008000-00009
35. Dupont M, Souriant S, Lugo-Villarino G, Maridonneau-Parini I, Vérollet C. Tunneling nanotubes: intimate communication between myeloid cells. Front Immunol. 2018;9:43. doi: 10.3389/fimmu.2018.00043
36. Hervé J-C, Derangeon M. Gap-junction-mediated cell-to-cell communication. Cell Tissue Res. 2013;352(1):21-31. doi: 10.1007/s00441-012-1485-6
37. Massaro MS, Pálek R, Rosendorf J, Červenková L, Liška V, Moulisová V. Decellularized xenogeneic scaffolds in transplantation and tissue engineering: Immunogenicity versus positive cell stimulation. Mater Sci Eng C. 2021;127:112203. doi: 10.1016/j.msec.2021.112203
38. Huettner N, Dargaville TR, Forget A. Discovering cell-adhesion peptides in tissue engineering: beyond RGD. Trends Biotechnol. 2018;36(4):372-383. doi: 10.1016/j.tibtech.2018.01.008
39. Davis RP, Casini S, van den Berg CW, Hoekstra M, Remme CA, Dambrot C, et al. Cardiomyocytes derived from pluripotent stem cells recapitulate electrophysiological characteristics of an overlap syndrome of cardiac sodium channel disease. Circulation. 2012;125(25):3079-3091. doi: 10.1161/circulationaha.111.066092
40. Miki T, Strom SC. Amnion-derived pluripotent/multipotent stem cells. Stem cell reviews. 2006;2(2):133-141.
    doi: 10.1007/s12015-006-0020-0
41. Fang C-H, Jin J, Joe J-H, Song Y-S, So B-I, Lim SM, et al. In vivo differentiation of human amniotic epithelial cells into cardiomyocyte-like cells and cell transplantation effect on myocardial infarction in rats: comparison with cord blood and adipose tissue-derived mesenchymal stem cells. Cell Transplant. 2012;21(8):1687-1696. doi: 10.3727/096368912X653039
42. Francisco JC, Cunha RC, Simeoni RB, Guarita-Souza LC, Ferreira RJ, Irioda AC, et al. Amniotic membrane as a potent source of stem cells and a matrix for engineering heart tissue. J Biomed Sci Engineering. 2013; 06(12):8. doi: 10.4236/jbise.2013.612147
43. Wang T, Xu Z, Jiang W, Ma A. Cell-to-cell contact induces mesenchymal stem cell to differentiate into cardiomyocyte and smooth muscle cell. Int J Cardiol. 2006;109(1):74-81. doi: 10.1016/j.ijcard.2005.05.072
44. Sandora N, Putra MA, Busro PW, Muttaqin C, Makdinata W, Fitria NA, et al. Preparation of cell-seeded heart patch in vitro; co-culture of adipose-derived mesenchymal stem cell and cardiomyocytes in amnion bilayer patch. Cardiovasc Eng Technol. 2021:1-14. doi: 10.1007/s13239-021-00565-4
45. Li X, Zhao H, Qi C, Zeng Y, Xu F, Du Y. Direct intercellular communications dominate the interaction between adipose-derived MSCs and myofibroblasts against cardiac fibrosis. Protein Cell. 2015;6(10):735-745. doi: 10.1007/s13238-015-0196-7
46. Lohse MJ, Engelhardt S, Eschenhagen T. What is the role of β-adrenergic signaling in heart failure? Circ Res. 2003;93(10):896-906. doi: 10.1161/01.RES.0000102042.83024.CA
47. Lands A, Arnold A, McAuliff JP, Luduena F, Brown JT. Differentiation of receptor systems activated by sympathomimetic amines. Nature. 1967;214(5088):597-598. doi: 10.1038/214597a0
48. White M, Roden R, Minobe W, Khan MF, Larrabee P, Wollmering M, et al. Age-related changes in beta-adrenergic neuroeffector systems in the human heart. Circulation. 1994;90(3):1225-1238. doi: 10.1161/01.CIR.90.3.1225
49. Vunjak-Novakovic G, Tandon N, Godier A, Maidhof R, Marsano A, Martens TP, et al. Challenges in cardiac tissue engineering. Tissue Eng Part B Rev. 2010;16(2):169-187. doi: 10.1089/ten.TEB.2009.0352
50. Dai R, Wang Z, Samanipour R, Koo KI, Kim K. Adipose-Derived Stem Cells for Tissue Engineering and Regenerative Medicine Applications. Stem Cells Int. 2016;2016:6737345. doi: 10.1155/2016/6737345
51. Khan M, Meduru S, Mohan IK, Kuppusamy ML, Wisel S, Kulkarni A, et al. Hyperbaric oxygenation enhances transplanted cell graft and functional recovery in the infarct heart. J Mol Cellular Cardiol. 2009;47(2):275-287. doi: 10.1016/j.yjmcc.2009.04.005
52. Qiu C, Ge Z, Cui W, Yu L, Li J. Human Amniotic Epithelial Stem Cells: A promising seed cell for clinical applications. Int J Mol Sci. 2020;21(20):7730. doi: 10.3390/ijms21207730
53. Zhang Q, Lai D. Application of human amniotic epithelial cells in regenerative medicine: a systematic review. Stem Cell Res Ther. 2020;11(1):439. doi: 10.1186/s13287-020-01951-w
54. Cohn JN, Ferrari R, Sharpe N. Cardiac remodeling – concepts and clinical implications: a consensus paper from an international forum on cardiac remodeling. Behalf of an International Forum on Cardiac Remodeling. J Am Coll Cardiol. 2000;35(3):569-582.
    doi: 10.1016/s0735-1097(99)00630-0

" ["~DETAIL_TEXT"]=> string(56415) "

Introduction

Coronary artery diseases are the second deadly disease worldwide causing heart failure as the terminal condition, claiming one life every 36 seconds in the USA [1, 2]. American Heart Association (AHA) reports a trend of coronary heart disease among youngsters as early as 20 years old, up to 15.5 million people, and experienced myocardial infarction every 46 seconds [3]. Similarly, according to the Indonesian Basic Health Research, Indonesia also shows an increasing tendency with 1.5% of the coronary heart disease cases at 15 years old or above, with related causes of death, 8.1% of general mortality in 2010. Total obstruction of the coronary artery causes death of cardiomyocytes, myocardial heart muscle infarction, and progressive failure when the vascularization is not immediately recovered. This condition has eventually led to heart failure, thus requiring heart replacement. In the Netherlands, only about 50% of patients received heart transplantation after 2.6 years of waiting, while 15% died [4].

Normally, the rate of cardiomyocyte replacement after birth is 1% per year after 20 years old, and 0.5% per year in the elderly. In total, 39% ventricular cardiomyocytes have been replaced after birth, while 36% of those cells have been replaced by 10 years old [5, 6]. Therefore, studies to regenerate the infarcted heart muscles are quite necessary, since the demand for heart transplantation is always insufficient. Nowadays, different attempts to improve cardiac regeneration capacity such as cellular transplantation, using different cell types such as stem cells and cardiac progenitor cells delivered using various methods. Stem cell therapy is believed to repair infarcted tissue, since the self-organ progenitor has been depleted [7, 8].

The available studies of cardiac engineering in vitro or in vivo point to low levels of newly formed cardiac tissue [9]. Animal studies and clinical practices presume this finding is due to low retention of the transplanted cells. Hou et al. (2005) have shown it by injections of human peripheral mononuclears (107 cells) labeled with ¹¹¹Indium-oxine in a porcine myocardial infarction model via intracardial, intracoronary, or intracoronary retrograde venous injections (IRV). Only 11.3% of the cells retained in the infarction area after six days after intracardiac injection, only 2.6±0.3% (p<0.05) were revealed locally following intracoronary delivery, and 3.2%±1%, when introduced by IRV [10].

Along with cellular retention, the issues in cellular therapy also include cell source, either autologous or allogeneic cells, which may be of low viability. Recently, tissue engineering has been proposed to improve cellular retention by using scaffolds to deliver the cells. Cell transplantation into the infarcted organ matrix seems to be irrational, since the matrix was subject to deterioration, it becomes thinner and stiff due to avascular structure and cell loss. The extracellular matrix composition has been altered, and the cardiac histoarchitecture has been disoriented. These alterations cannot provide a proper microenvironment for the newly transplanted cells. Hence, the cells may be delivered within a 3-D scaffold, as a provisional microenvironment to support stem cell colonization and growth [11]. The current tissue engineering technique is a co-culture system approach using a scaffold containing cells that can be applied to the damaged heart, known as "scaffold-based cell therapy" [12].

This study used human amniotic epithelial stem cells (hAESC) as a stem cell source for cell therapy, part of the translational study to regenerate the infarcted myocardium. Our group studied this cell type extensively in vitro, and the current study of co-culture with human cardiomyocytes had shown to induce the cardiomyogenesis process. Moreover, the origin of the hAESC presumes anti-inflammatory activity that concerns the issue of allogeneic tissue rejection, providing less immunogenic reaction. In addition, this is a waste tissue obtained at surgery, thus avoiding ethical issues, getting abundance of cells, and these samples are easy to obtain [13].

Materials and methods

Sampling of biomaterials

This study was designed to assess the optimal ratio of hAESC and hCardio for the cardiomyogenesis process when seeded on an amnion bilayer as the 3-D scaffold. All donors for human amnion epithelial stem cells (hAESC) and the human cardiomyocytes (hCardio) were obtained from the National Hospital Cipto Mangunkusumo, Jakarta, Indonesia. Placenta was obtained from the compliant donors negative for HIV, hepatitis B, and cytomegalovirus, by means of elective caesarean procedure which proceeded without complications. Placenta was transported to the laboratory within 30 minutes in the transport medium at 4°C. The transport medium consisted of DMEM (Dulbecco's Modified Eagle's Medium) 4.5 g.L^-1 (Sigma-Aldrich, USA), containing 10% (v/v) human platelet rich plasma (PRP), 1% (v/v) Inviclot® heparin sodium (Fahrenheit, Indonesia), and 3% (v/v) Gibco™ antibiotic-antimycotic (ThermoFisher, USA). The donor heart tissues were obtained from pediatric patients, with consent from their parents. The ethical board had approved all protocols of the Faculty of Medicine, Universitas Indonesia, and the ethical clearance number was KET.483/UN2.F1/ETIK/PPM.00.02/2019. Any specimens obtained in this study had been taken from the compliant donors, with informed consent obtained before the procedures.

Cardiac tissues were transported in the transport medium (see above), to the lab at 37°C to obtain the optimum cell number [14], while others were at 4°C unless otherwise stated, transported to the laboratory within 30 minutes. All specimens were initially verified for the microbial burden once they arrived at the lab, using a serial dilution of total plate count (TPC), taking the transport medium, inoculated onto Tryptic Soy Broth (Sigma-Aldrich, USA) and Difco™ Columbia Blood Agar (BD, USA) and incubated at 37°C. Also, inoculation onto Difco™ Sabouraud Dextrose Agar (BD, USA) was made to detect potential fungal contamination, with incubation at room temperature. All procedures to generate single-cells and culture were performed under aseptic conditions.

Isolation of the single-cell cardiomyocytes

The excess heart tissue was collected from the patients with hypertrophy of the right ventricle undergoing total correction surgery to restore the volume of the heart chamber. According to the previous method developed, the protocol to isolate cardiomyocytes from heart tissue included enzymatic, thermal, and mechanical methods [15]. Briefly, once arrived at the lab, after the initial procedures stated above, the tissue was weighted, and only 500-1000 mg of tissue was taken. The sample was washed twice in Dulbecco's phosphate-buffered saline Ca⁺⁺Mg⁺⁺free (Sigma-Aldrich, USA), minced up to 2×2×2 mm³, and loaded into a C-tube gentleMACS™ C-Tubes (Miltenyi Biotec, Germany), added with Collagenase type V (250 U.mL^-1 Gibco™) (ThermoFisher, USA), and proteinase type XXIV (Sigma Aldrich, USA). The tube was then fitted to the sleeve of the gentle MACS™ Octo Dissociator with Heater (Miltenyi Biotec, Germany), incubated for 1 hour, 37°C. The digestion process was then neutralized using two volumes of AscleStem complete medium added with the supplement (Nacalai Tesque, Japan). The cells were harvested using a 70 μm cell strainer (Biologix, China) and pelleted at 600×g for 5 minutes at room temperature. The collected cells were stained with Trypan Blue dye to assess the cellular viability, counted in a Neubauer haemocytometer, and visualized using the Brightfield microscope AxioVert.A1 (Carl Zeiss, Germany). Further confirmation of cardiomyocyte by the cell shape was performed using Live/Dead assay (Invitrogen, USA) and visualized using LSM 900 (Carl Zeiss, Germany) [16].

Isolation of human amnion epithelial stem cells

The single-cell hAESC was isolated following the method described in several papers with modifications [17, 18]. After the bio-burden assay, the fetal membrane was spread on a sterile dish to separate the chorion. The amnion membrane was washed in 50 mL of Hank’s Balanced Salt Solutions/ HBSS (Gibco, USA), followed by 50 mL of Versene solution (Gibco, USA) twice, to remove blood residue. The amnion membrane was then spread with the fetal side upright, incubated with TripleSelect (Gibco, USA) 50 mL distributed evenly, for 1 hour, 37°C. Thereafter, the fetal side was scraped gently to remove the cell layer, followed by neutralization using DTI solution (1x volume). The cell suspension was separated from tissue debris using a 100 μm cell strainer (Biologix, China). The cells were then collected by centrifugation at 150 g for 10 minutes. The amnion membrane was flipped over to allow the maternal side to be upright, followed by incubation with 2 mg.mL^-1 Collagenase-1 (Gibco, USA) and Hyaluronidase 66IU.mL^-1 (Thermo Fisher, USA) in DMEM 4.5 g.L^-1 (Sigma-Aldrich) for 1 hour, 37°C. The cell suspension was then filtered using a 100 μm cell strainer (Biologix, China); the cells were then harvested by centrifugation of the filtrate at 150 g, 10 minutes. The digestion was stopped using AscleStem™ Cardiomyocyte Differentiation Medium (Nacalai Tesque, Japan) complete medium, and the isolated cells were then collected, as mentioned before.

Characterization of the isolated hAESC and hCardio

All primarily isolated single-cell preparations were characterized using flow cytometry, antibodies used to identify the specific cells according to the specific epitopes described in the literature review. The epitopes were identified using BD FACSAria™ III, and the data were analyzed using BD FACS Diva 8.0.2 (BD Bioscience, USA). The cells of interest were separated from the background noise according to the data from unstained reading; the cut-off lower limit of the interested populations was set to the highest limit of the corresponding isotype specific to each antibody.

Both cell types, i.e., hAESC and hCardio, were firstly labelled for mesenchymal stem cell identity [19] against CD73 (Biolegend, USA), CD90 (Biolegend, USA), and CD105 (Biolegend, USA), whereas the anti-human Lineage cocktail (CD3, CD14, CD16, CD19, CD20, CD56) or Lin- (Biolegend) was used as the negative index. Further immunomodulatory factors in hAESC were confirmed to their HLA-DR antibody (L243) PE (SantaCruz, USA) paired to the murine monoclonal IgG2a PE, and the HLA-A/B/C antibody (D-2) FITC (SantaCruz, USA) paired to the mouse monoclonal IgG1 FITC (SantaCruz, USA). The h-Cardio were identified by labeling for the cardiac Troponin (cTnT) FITC (SantaCruz, USA) [20] paired to the murine monoclonal IgG2a kappa (SantaCruz, USA), murine anti-human CD31/ PECAM-1 FITC (BioLegend, USA) [21], and murine IgG-FITC isotype (BioLegend, USA), anti-human CD106/ VCAM1 PE (Biolegend, USA) paired to mouse IgG1 kappa isotype (BioLegend, USA), CD117/ cKit PE (Miltenyi Biotec, Germany) with mouse IgG1 kappa PE isotype (BioLegend, USA), CD 54/ ICAM PE (SantaCruz, USA) with mouse monoclonal IgG1 kappa isotype (BioLegend, USA). The hAESC were determined to the Nanog (A-11) PE (SantaCruz, USA) paired to mouse monoclonal IgG1 kappa PE (SantaCruz, USA) [17], Oct-3/4 (C-10) FITC (SantaCruz, USA) paired to mouse monoclonal IgG2b FITC, TRA-1-60 PE (SantaCruz, USA) paired to the murine monoclonal IgM PE, and SSEA-4 (813-70) FITC (SantaCruz, USA) paired to mouse monoclonal IgG3 FITC [18].

The cells prepared for flow cytometric analysis were set at 10⁵ cells per reading. All antibodies were labelled using extracellular markers, except the c-TnT labelling, since these epitopes are located at the wall of the nucleus membrane. The intracellular labelling followed the protocol published elsewhere. Briefly, after 2x washes with Ca⁺⁺, Mg⁺⁺ free PBS (10,000 rpm 10 min, the cells were washed in detergent to disintegrate the cell membrane using BD Perm/Wash™ (1 ml) at 25°C for 15 minutes, followed by fixation using BD Cytofix™ Fixation Buffer (4 mL), at 25°C, 15 min, washed in PermWash (2x). Then the pellet was labelled against cTnT, incubated at 4°C, for one hour. The extracellular labelling was performed with PBS Ca⁺⁺ Mg⁺⁺ free consecutively after each treatment, labelled with all antibodies and isotypes stated above with 1 µl per 10⁶ cells, at 4°C for 1 hour. The cell population was counted using FACS BD Flow cytometer, designed to stop after 30,000 cells counting.

Co-culture of hAESC and h-Cardio on an amnion bilayer scaffold

Both cell types were seeded onto the amnion bilayer, with a seeding density of 5×10⁵ cell.cm^-1. The ratio of hAESC and h-Cardio seeded on the graft was prepared at a 5:1 ratio [22], as the maximum number of cells isolated from each harvest was about 106 cells; therefore, the optimum cell ratio was compared to the 1:6. The mixture cells were suspended in the complete AscleStem™ Cardiomyocyte Differentiation Medium (Nacalai Tesque, Japan). Briefly, the amnion bilayer scaffold was round in shape, sized 4 cm in diameter, blotted dry and placed inside-out, seeded with cell-mixture suspension at 5×10⁵ cell.cm^-1 diluted in the complete AscleStem™ Cardiomyocyte Differentiation Medium (Nacalai Tesque, Japan); with addition of Supplements A (Nacalai Tesque, Japan and B (Nacalai Tesque, Japan). The seeded graft was incubated at 37°C, 5% CO₂, for nine days, and the culture medium was refreshed every three days.

The seeded co-cultures of hAESC and h-Cardio were terminated after Day 2, Day 5, and Day 8 incubation for proliferation and cardiomyogenesis verifications.

Cellular proliferation

The proliferation of the seeded cells was counted by the ATP amounts generated by the cells, quantified using ATPLite assay (PerkinElmer, USA), and qualitatively using Live/Dead staining (Invitrogen, USA), and visualised using LSM 900 (Carl Zeiss, Germany). The ATP contents have been measured by counting the luminescence intensity per second using the plate-reader Varioskan™ LUX multimode microplate reader (Thermo, USA). Briefly, each graft was washed in DPBS 3x, then minced and digested in lysis buffer (Perkin Elmer, USA) for 10 min, with agitation at 25°C, the tissue was separated by centrifugation. 100µL of the suspension were aliquoted into each well of the Opti-Plate well (Thermo, USA), with replications, supplied with 100µL of Luminescence buffer and shaked at 300 rpm for 10 minutes in the dark.

Qualitative viability analysis was determined using Live/Dead staining (Invitrogen) [23]. Briefly, the specimens were washed three times in DPBS (Sigma, USA), and incubated in Calcein 4µM that will stain cytoplasm of viable cells, and Ethidium homodimer (2 µM) staining nuclei of the dead cells, for 30 minutes, 37°C, in dark, followed by DPBS (Sigma, USA) washes (three times). The specimens were placed on a microscope slide, added with DABCO™ mounting medium (Sigma, USA), and visualized under the confocal microscopy, LSM900 confocal microscope (Zeiss, Germany).

Real-time RT-qPCR

The cardiomyogenesis gene expression from the seeded co-culture of the h-Cardio and hAESC in a 3D amnion bilayer graft were analyzed using RNA extracted with TRIzol™ Reagent (ThermoFisher, USA). RNA samples (1 µg) were converted to the complementary matrix DNA using SensiFAST™ cDNA Synthesis Kit (Bioline, USA), then amplified using Techne Prime Pro 48 Real-time qPCR System (Techne, UK), SensiFAST™ SYBR Lo-ROX Kit (Bioline, USA). The α-actinin expression identified the specific feature of cardiomyogenesis process (at the Z-disc, this factor regulates transcription of the actin-binding protein, and contraction of myofibrillar actin filaments) [24]. The primers used were as follows: for actinin (ACTN2): F5'AGCCGAATTTGCCCGCATTA3', R5'TGAAGGATTGGAAGGTGACGG3'; for cTnT (cardiac regulatory proteins to coordinate the interaction between actin and myosin through the calcium channel) [25], the human cardiac troponin/ cTnT: F5'CAAGGAGCTGTGGCAGACGAT3', R5'GCTCCCCATTTCCAAACAGGA3', and for the myosin heavy chain/MHC (reflecting the contractility of cardiac muscle) [26] MHC: F5'ACCTGAAGGAGAACATCGCC3', R5’AAGCCCTTCGTGCCAATGTC3’. The reference gene was GAPDH detected with the following primers: F5’AACATCATCCCTGCCTCTACT3’, R5’CTCCGACGCCTGCTTCAC3’.

Data analysis of the RT-PCR was performed using the Livak method. Briefly, all ΔCT values were normalized to the Ct value of the reference gene, followed by normalization of the cardiomyogenesis genes (cTnT, MHC, α-actinin) to the cardiomyocytes of normal heart serving as controls, to obtain the ΔΔCT values.

TNFα measurement using ELISA

The measurement of TNFα cytokine released to the culture medium after incubation of the co-culture was made from Day 1, Day 5, Day 7, and Day 8. H9C2 cells (rat neonatal heart cells) seeded in each 96-well plate, 25,000 cells per well, after 24 hours incubation with DMEM containing 10% FBS (Gibco, LifeTechnologies), were replaced with the tested culture medium and allowed to incubate for 48 hours. The measurements were performed using ELISA kit (1-StepTM Ultra TMB-ELISA, Thermo Scientific).

Results and discussion

This study is a part of the translation study to regenerate an infarcted heart wall using scaffold-based cell therapy. Cell therapy using a co-culture of hAESC and h-Cardio delivered in an amnion bilayer as a vehicle and temporary media before the transplanted cells will adapt for the new microenvironment. Our aim was to derive the hAESC from becoming the self-cardiomyocytes. As cell therapy is considered a tool for regeneration of infarcted heart wall, this study aims for helping the physicians to decide which cell source is suitable for the patient, either autologous or allogeneic cells.

The 3-D matrix vehicle used in this study was an amnion bilayer (Fig. 1A), prepared using a decellularized amnion membrane after extensive washes in 0.05% SDS (w/v) and Triton X-100, 0.1% (v/v), then overlayed with fibrin. The acellularity was confirmed using H&E staining (Fig. 1B), since no nuclei were identified, and further DNA residue was validated using DAPI staining, with no blue fluorescence highlighting the double strain DNA (Fig. 1C). The graft was biocompatible as revealed by contact toxicity assay using human bone marrow-MSC, with cell growth into the matrix (Fig. 1D). Fig. 1E shows the waste tissue of the heart weighing about 500-1000 mg. The tissue was then processed to become a single cell, shown in Fig. 1F, as the rod-shaped cells reported in many papers [27]. Fig. 1G shows the single cell of hAESC with a cobblestone appearance.

The heart cells were then characterized using flow cytometry to identify the cardiomyocyte phenotypes, e.g., cTnT (10.7%), progenitor cell marker cKit (16%), the adhesion molecule ICAM (94%), the endothelial marker PECAM+/VCAM- (33%), as seen in Fig. 1H. The hAESC were shown to express pluripotent phenotypes: TRA-1-60 (82.4%), SSEA-4 (28.2%), Oct-3/4 (2.9%), Nanog (11.4%), with no detectable expression of immune antigens, such as HLA-DR (0%), HLA-ABC (0.2%). Expression of mesenchymal markers was low, i.e., CD73 (20.2%), CD90 (0.4%), CD105 (59.2%), while the Lin- (CD3, CD14, CD16, CD19, CD20, CD56) were undetectable (Fig. 1I, 1J). Many studies have already reported these expression patterns, among other embryonic stem cells markers SSEA-3, SSEA-4, TRA 1-60, TRA 1-81, Oct-4, and Nanog [18]. Therefore, the hAESC might be a suitable candidate for transplantation taken from allogeneic sources, because they had no expressed antigen that would induce immune-mediated rejection [28, 29]. Further investigations will show whether this cell candidate and the proposed culture system are suitable for deriving cardiomyogenesis.

Figure 1. The scaffold for 3-D culture (amnion bilayer) used in this study. (A) Macroscopic view of the scaffold, thickness of 500 µm. (B) Section of the amnion bilayer stained with H&E and (C) DAPI, showed no cell remnants, or traces of DNA, respectively. (E) The waste tissue taken from the excess heart wall. The single cells of the (F) hAESC and (G) hCardio following isolation from the human amnion membrane and cardiac samples, respectively. The cells were captured at 100x magnification.

The production of the pro-inflammation cytokine released from the transplant or donor tissue might hinder the transplant from integrating at the transplantation site. The proinflammatory cytokines TNF-α and IL-12 are released by cytotoxic M1 macrophages (CD68+ and CD80+) related to production of highly reactive oxygen intermediates and nitric oxide. These classic factors of inflammation method kill the pathogens; however, they sometimes cause the reverse effect to the host through massive fibrosis or scarring [30]. Some reports showed that elevation of TNF-α after transplantation correlates with fibrosis/scarring process in pulmonary fibrosis [31], and scarring trachoma [32]. Other workers also reported that primary cells from the hAESC at passage 0 until passage 5 suppressed the T cell proliferation by exerting immunosuppressive effects [33].

The current study showed that the co-culture of hAESC and h-Cardio at both ratios (1:5 and 1:6) caused only weak release of TNF-α into the culture medium (<1 pg/mL) after 1-5-7-8 days of cultivation. There were no differences between the both groups at any time point (Fig. 2B). The data on TNF-α serum levels among patients after liver transplantation showed that TNF-α was significantly higher among the patients with organ rejections (941±83 pg.mL^-1) compared to the patients in a stable clinical condition (240±6 pg.mL^-1; p=0.0001) [34]. Hence, the measurement of the culture medium of the co-culture hAESC and h-Cardio in the amnion bilayer graft suggests that the co-culture might not induce inflammation under the in vivo conditions.

The culture system in a custom-made 6-well plate to incubate the co-cultures in a 3-D construct is shown in Figure 2A. The Brightfield images of the co-culture constructs (Figure 2 C-G for the 1:5 ratio, and the Figure 2H-L for the 1:6 group; Day 1-3-5-7-8, respectively).

Figure 2. The images of 3D culture system. (A) the 6-well plate modified to incubate the seeded hAESC and hCardio on the amnion bilayer. (B) Measurement of TNFα and its standard; 3-D culture of hCardio and hAESC; (C,H) Day 1, (D,I) Day 3, (E,J) Day 5, (F,K) Day 7, (G,L) Day 8. The top row (C-G) shows the cultures at 5:1 ratio, and the bottom row (B-L) shows 6:1 ratio. D and I are made at 50x magnification, others show 100x magnification.

The confocal microscopy images (Figure 3A-C, 1:5 ratio, and Figure 3D-F, 1:6 ratio; Day 2-5-8, respectively) also demonstrate that the cell population had consistently expanded over time. The confocal images of the co-culture cells stained with Calcein AM were visualized using LSM700 Observer 2.1 (Zeiss, Germany), Z-stack every 10 µm. The initial culture on Day 2 showed that the cells were still solitary, rounded, and aggregated. The cells looked well distributed across the plane, although still sparse. These might indicate that the seeding method provided good distribution. On day 5, the cell population started to proliferate with increase of cellular population, and, apparently, some cell-to-cell connections were seen. The cells also migrated by ingrowth to the deeper layers, until 120 µm, compared to only 70 µm for the 1:5 group (Figure 3A, B, C), the 1:6 group (Figure 3D, E, F) also had migrated to the deeper plane. After 8 days of incubation, all experimental groups showed projections between cells (T-tunnel/ TNT) behaviour, and the population became very dense. It was unable to discern single cells. The 1:5 and the 1:6 images appeared as the cell colony (Fig. 3C and F, respectively). This cytoplasm projections are believed to facilitate cell-to-cell communications. Dupont et al. (2018) reported that the protrusion of the tunnelling nanotubes (TNT) is formed by the projection of the thin cell membrane to reach the distant cells, or through exosomes or vesicles [35]. Other reports showed that direct co-culture of mixed cells creates cell communications between different cell types through a gap junction and other means such as cytokine or hormone effects through specific receptors [36].

Figure 3. The 3-D images of hAESC co-culture with hCardio in amnion bilayer graft on Day 2 (A,D), Day 5 (B, E), and Day 8 (C, F). The A-C present the 1:5 seeding ratio, and the D-F were the 1:6 ratios

Viability assay was performed with Live/Dead staining, the images were taken using a confocal microscope 700 LSM Observer 2.1 (Zeiss, Germany) using Z-stack, at the interval of 10 µm. Green colour indicates viable cells, stained with Calcein AM (excited at 480 nm). Red colour indicates dead cells, stained using Ethidium homodimer (excited at 555 nm. emission at 560 nm), with laser diode gained at 635 nm.

In general, cellular survival depends on their capability to adhere and consolidate to the surrounding extracellular matrix, which is facilitated by the cellular adhesion peptides (CAP), such as the RDG binding molecules. Fibronectin is one of the RGD that decides the re-endothelialization of the scaffold through integrin α5β1 and αvβ3 dimers binding [37]. Furthermore, the optimizing integrin, heparin, and leucocyte surface receptors may improve cellular integration into the matrix in vitro [38].

The current study investigated relative gene expression in cardiomyogenesis by qPCR using the following markers: cardiac troponin (cTnT), myosin heavy chain (MHC), and α-actinin (ACTN2) expression. The co-culture on day 2 and day 5 did not show any cardiomyogenesis gene expression in both cultures. Nevertheless, since day 8, the 1:6 group had expressed the specific gene for cardiomyocytes; the cTnT (one-fold), the MHC, and the ACTN2 (one-fold) (Fig. 4). Perhaps, the co-culture of h-Cardio and hAESC at 1:6 ratio on a 3-D amnion bilayer scaffold might be the optimal culture condition to achieve cardiomyogenesis. Meanwhile, our previous study of a 2-D culture of h-Cardio and hAESC revealed absence of cTnT, MHC, and ACTN2 expression (unpublished results).

Figure 4. Gene expression in the 3-D co-cultures of the hAESC and hCardio after 2, 5 and 8-day incubation

All samples showed no differences after analysis by the two-way ANOVA test, and compared using Sidak’s test. Although the "1:6" group after 8-day incubation showed slight increase compared to others, this difference was insignificant. The difference between the groups at different seeding ratios was insignificant for cTnT expression (p=0.42), MHC (p=0.42), and ACTN2 (p=0.44), neither the culture duration (p>0.05).

Adult cardiomyocytes have limited ability to regenerate after birth [5, 6]. Therefore, adding a suitable cell type to improve severe heart diseases, such as progressive heart failure, is essential. In the present study, the waste heart tissue from the patients aged 0-2 years old subjected to the total correction surgery due to the tetralogy of Fallot was used for the cardiomyocyte isolation. The isolated cardiomyocytes supplied with hAESC to augment the transplanted cells were delivered to the 3-D scaffold. The scaffold acts as a temporary shelter that provides an ideal microenvironment for the transplanted cells until the cells adapt to the surrounding host environment. The microenvironment in an injured myocardium seems not provide effective support to the cell survival due to hypoxic and low-glucose conditions. The in vitro modeling of an infarct condition has shown to restrain cellular viability and prevent the stem cells from differentiation to cardiomyocytes [39]. In conclusion, optimal results from cell transplantation are not only the matter of cells, but a correct delivery approach is also crucial. In this respect, tissue engineering might resolve this problem.

Many reports have indicated that hAESC expressed cardiac-specific genes encoding atrial and ventricular myosin light chain 2 (MLC-2A and MLC-2V), and the transcription factors GATA-4 and Nkx-2.5 in vitro. Expression of MLC-2A and MLC-2V, as well as GATA-4 and Nkx 2.5 was shown by RT-PCR in hAESC after 14 days of cultivation in the medium supplemented with 1 mM of ascorbic acid. The hAESC differentiated to cardiomyocytes exhibited expression of α-actinin, as proved by immunocytochemistry [40]. Other studies comparing ability of hAESC, human umbilical cord cells, and human adipose MSC for regeneration of myocardial infarction following intramural injection in athymic nude rats have found that hAESC was superior to other cells types, i.e., after four weeks, 3% of the injected hAESC exhibited a myocardial marker. The area of infarction after hAESC injection was characterized by decreased infarct size and showed an improved cardiac function [41].

Nonetheless, other cells, such as bone marrow MSC, are also believed to have capability for cardiomyogenesis. Bone marrow MSCs were taken from the femur and tibia of rats and co-cultured indirectly with cardiomyocytes taken from the ventricular wall at the 1:10 ratio, separated with a semipermeable membrane, and then cultivated for 1-3 weeks. It was shown that the resulting cells expressed SERCA2 and RyR genes, and, when implanted in rats, cardiac troponin T, cardiac troponin I, α-actinin, and desmin were expressed in the sections [42].

Direct contact between the cells is required to stimulate the differentiation of hAESC into cardiomyocytes. It is believed that bioelectric signals between cells dictate cell signalling that influences the resting potential of cell membranes which controls regulation of growth, migration, and differentiation signals. These findings were reported in a previous study by Wang et al. concerning the factors that encourage cell differentiation into cardiomyocytes through direct contact: the elasticity of cell, increase of ligands-receptors, molecule-integrin adhesion, and signal transcription [43].

The author realized that no identical study uses similar cell types and culture systems to compare. A study from our group using human adipose MSC taken from a younger donor (30 years old) compared to the elderly donor (60 years old) when co-cultured with h-Cardio on a 3-D scaffold (at 1:5 and 1:6 ratio, respectively), showed that initial culture (Day 2) only the 60 years old group had slight expression of MHC. However, after Day 5, the 30-year old group was superior in expressing cTnT, MHC, ACTN2, and, even, PPARγ, at significantly higher level, but it was diminished after Day 9 in all groups [44]. That study reported that the 1:5 ratio for adipose MSC is superior, as it revealed higher numbers of viable cells. Adipose MSC is considered an excellent autologous cell source, being less invasive for sampling. Nonetheless, according to Sandora et al. (2021) it might not be an ideal cell source when the elderly patient occurs with myocardial infarction. It was shown that, even though the elderly group was taken from the brown adipose tissue and had higher MSC expression than in younger persons (30 years old, white adipose tissue), the cardiomyogenesis process was superior when using the cells from younger donors. However, this study cannot maintain a cardiomyogenesis observed in this system after Day 9, as all the interested expressions disappeared [44].

Nonetheless, another co-culture study also reported similar results to our study; however, using an indirect co-culture system of adipose MSC and cardiomyocytes studied in rats, separated by a semipermeable membrane at the ratio of 1:5 for 2 weeks, indicated that the MSC transformed into elliptical-shape cells and started to contact with other cells to form a streaky pattern. The cells were found to express α-actinin and cardiac troponin (cTnT) just after 5 days of incubation and reached their peak by the day 14 (29.63% and 27.38%, respectively). The medium was also found to contain TGF-β, GATA-4, Nkx-2.5, and MEF-2C which pointed to the cardiomyogenesis process [22, 45]. The human heart expresses β1- and β2-adrenergic receptors that are crucial in developing heart failure [46]. The β1 subtype stimulates cardiac muscles but relaxes blood vessels, while the β2 subtype plays an opposite role; in relaxing the smooth muscle and regulating the contractility of cardiac muscles [47]. Ageing events affect sensitivity of β-adrenergic receptors in elderly persons (59-71 years old) compared to young subjects (1-13 years old) [48].

There are two methods to deliver cell or cell vehicles in cardiac engineering, e.g., using a heart patch or hydrogel carrier. There are advantages and disadvantages between these two methods. The patches are more invasive and require open heart surgery; however, they can be transplanted in any area that cannot be reached transthoracic, firmly stitched to the epicardial. The hydrogel can be delivered via a catheter, being less invasive. However, the accessible area to deliver the cells is more limited than with the patches [49]. In this study, the amnion bilayer was designed as a heart patch. The use of a 3-D scaffold derived from acellular amnion membrane biomaterials (amnion bilayer) is a tissue by human origin, being acellular and still maintaining high elasticity. The matrix also contains fibronectin (not published), which increases stem cell adhesion and growth [50]. These properties might provide a suitable microenvironment for the transplanted cells. Along with the biological scaffold, a bioactive matrix might also be a promising candidate to improve cellular retention when the cells are transplanted in order to regenerate the infarcted heart wall [52].

Human amniotic epithelial cells (hAESCs) possess embryonic stem cell-like proliferation and differentiation capabilities and adult stem cell-like immunomodulatory properties [40]. As described in an extensive review, hAESC is considered a suitable candidate that can differentiate into cardiomyocytes [52]. It also do not express HLA-DR and HLA-A, B, C, thus preventing induction of immune reaction when transplanted [28, 29]. Compared with other stem cells, hAESC has unique advantages, including easy isolation, abundant cell quantities, avoiding ethical debates, as well as lower immunogenicity and absence of tumorigenic properties [53]. The cultivated and isolated hAESC populations are also reported to express normal karyotype, and are nontumorigenic upon transplantation [40].

Myocardial infarction (MI) leads to heart failure (HF) due to cardiac remodelling, especially wasting of the left ventricle (LV). The remodelled heart wall wastes the structure, molecular function, heart cells, and heart size, shape, and undergoes functional deterioration. Patients with extensive remodelling areas will immediately progress to terminal heart failure. Recent anti-remodelling therapy only slows the heart failure progression, nonetheless, the morbidity and mortality are still high [54].

Conclusion

This in vitro study showed that options for cell therapy (h-Cardio co-culture with hAESC at 1:6 ratio) using a biological scaffold (amnion bilayer) exhibited activation of the cardiomyogenesis-associated genes. The co-cultured cells were able to attach, migrate, proliferate and form intercellular connections. In future studies, the h-Cardio will be taken from the patient’s autologous cells, whilst the hAESC will be from an allogeneic source.

Acknowledgement

The authors would like to thank Dr. Cipto Mangunkusumo National Central Public Hospital for facilitating the authors in subject recruitment and Faculty of Medicine.

This study was supported by grant no. NKB-0541/UN2.R3.1/HKP.05.00/2019 from the University of Indonesia.

Conflict of interest

The authors declare that there is no conflicts of interest.

Ethical approval

All methods in this study have been reviewed and approved by the Ethical Committee of Universitas Indonesia with Ethical Approval no. KET.483/UN2.F1/ETIK/PPM.00.02/2019.

All methods in this study were conducted in accordance with the Ethical Committee of Universitas Indonesia (Ethical Approval no. KET.483/UN2.F1/ETIK/PPM.00.02/2019) approved protocols.

Written informed consent was obtained from the patient(s) for their anonymized information to be published in this article.

References

1. Ralapanawa U, Sivakanesan R. Epidemiology and the Magnitude of Coronary Artery Disease and Acute Coronary Syndrome:
   A Narrative Review. J Epidemiol Glob Health. 2021;11(2):169-177. doi: 10.2991/jegh.k.201217.001
2. Control CfD, Prevention. Underlying cause of death, 1999-2018. CDC WONDER Online Database Atlanta, GA: Centers for Disease Control and Prevention. 2018.
3. Sanchis-Gomar F, Perez-Quilis C, Leischik R, Lucia A. Epidemiology of coronary heart disease and acute coronary syndrome. Ann Transl Med. 2016;4(13):256. Epub 2016/08/09. doi: 10.21037/atm.2016.06.33
4. Roest S, Kaffka genaamd Dengler SE, van Suylen V, van der Kaaij NP, Damman K, van Laake LW, et al. Waiting list mortality and the potential of donation after circulatory death heart transplantations in the Netherlands. Netherlands Heart Journal. 2021;29(2):88-97. doi: 10.1007/s12471-020-01505-y
5. Michler RE. Stem cell therapy for heart failure. Metho-dist DeBakey cardiovascular journal. 2013;9(4):187-194.
   doi: 10.14797/mdcj-9-4-187
6. Lázár E, Sadek HA, Bergmann O. Cardiomyocyte renewal in the human heart: insights from the fallout. Eur Heart J. 2017;38(30):2333-2342. doi: 10.1093/eurheartj/ehx343
7. Smit NW, Cocera Ortega L, Vegh AMD, Meijborg VMF, Smits AM, Klerk M, et al. Human cardiomyocyte progenitor cells in co-culture with rat cardiomyocytes form a pro-arrhythmic substrate: evidence for two different arrhythmogenic mechanisms. Front Physiol. 2017;8:797. doi: 10.3389/fphys.2017.00797
8. Ghiroldi A, Piccoli M, Cirillo F, Monasky MM, Ciconte G, Pappone C, et al. Cell-based therapies for cardiac regeneration:
   a comprehensive review of past and ongoing strategies. Int J Mol Sci. 2018;19(10).
   doi: 10.3390/ijms19103194
9. Joggerst SJ, Hatzopoulos AK. Stem cell therapy for cardiac repair: benefits and barriers. Expert Rev Mol Med. 2009;11:e20. doi: 10.1017/s1462399409001124
10. Hou D, Youssef EA, Brinton TJ, Zhang P, Rogers P, Price ET, et al. Radiolabeled cell distribution after intramyocardial, intracoronary, and interstitial retrograde coronary venous delivery: implications for current clinical trials. Circulation. 2005;112(9 Suppl):I150-1156. doi: 10.1161/circulationaha.104.526749
11. Taylor DA, Chandler AM, Gobin AS, Sampaio LC. Maximizing cardiac repair: should we focus on the cells or on the matrix? Circ Res. 2017;120(1):30-32. doi: 10.1161/CIRCRESAHA.116.309959
12. Rodrigues ICP, Kaasi A, Maciel Filho R, Jardini AL, Gabriel LP. Cardiac tissue engineering: current state-of-the-art materials, cells and tissue formation. Einstein (Sao Paulo). 2018;16(3):eRB4538. doi: 10.1590/S1679-45082018RB4538
13. Parolini O, Alviano F, Bagnara GP, Bilic G, Bühring HJ, Evangelista M, et al. Concise review: isolation and characterization of cells from human term placenta: outcome of the first international Workshop on Placenta Derived Stem Cells. Stem Cells. 2008;26(2):300-311. Epub 2007/11/03. doi: 10.1634/stemcells.2007-0594
14. Putra MA, Sandora N, Suwarti, Nurhayati RW, Nauli R, Kusuma TR, et al. Transport viable heart tissue at physiological temperature yielded higher human cardiomyocytes compared to the conventional temperature. Cell Tissue Bank. 2022. doi: 10.1007/s10561-021-09978-w
15. Sandora N, Putra MA, Nurhayati RW, Suwarti, Nauli R, Kusuma TR, et al. Characterisation of the single-cell human cardiomyocytes taken from the excess heart tissue of the right ventricular outlet in congenital heart disease. Cell Tissue Bank. 2021. doi: 10.1007/s10561-021-09970-4
16. Axio Imager 2 Microscopy [Internet]. Carl Zeiss Microscopy LLC. 2013.
17. Koike C, Zhou K, Takeda Y, Fathy M, Okabe M, Yoshida T, et al. Characterization of amniotic stem cells. Cellular Reprogramming. 2014;16(4):298-305. doi: 10.1089/cell.2013.0090
18. Miki T, Mitamura K, Ross MA, Stolz DB, Strom SC. Identification of stem cell marker-positive cells by immunofluorescence in term human amnion. J Reprod Immunol. 2007;75(2):91-96. doi: 10.1016/j.jri.2007.03.017
19. Germscheid NM, Thornton GM, Hart DA, Hildebrand KA. Wound healing differences between Yorkshire and red Duroc porcine medial collateral ligaments identified by biomechanical assessment of scars. Clin Biomechanics. 2012;27(1):91-98. doi: 10.1016/j.clinbiomech.2011.07.001
20. Ban K, Wile B, Kim S, Park H-J, Byun J, Cho K-W, et al. Purification of cardiomyocytes from differentiating pluripotent stem cells using molecular beacons that target cardiomyocyte-specific mRNA. Circulation. 2013;128(17):1897-1909. doi: 10.1161/CIRCULATIONAHA.113.004228
21. Newman PJ, Newman DK. Signal Transduction Pathways Mediated by PECAM-1. Arteriosclerosis. Thromb Vascular Biol. 2003;23(6):953-964. doi: 10.1161/01.ATV.0000071347.69358.D9
22. Zeng J, Wang Y, Wei Y, Xie A, Lou Y, Zhang M. Co-culture with cardiomyocytes induces mesenchymal stem cells to differentiate into cardiomyocyte-like cells and express heart development-associated genes. Cell Res. 2008;18(S1):S62-S. doi: 10.1038/cr.2008.152
23. Petronilli V, Miotto G, Canton M, Brini M, Colonna R, Bernardi P, et al. Transient and long-lasting openings of the mitochondrial permeability transition pore can be monitored directly in intact cells by changes in mitochondrial calcein fluorescence. Biophys J. 1999;76(2):725-734. doi: 10.1016/S0006-3495(99)77239-5
24. Tiso N, Majetti M, Stanchi F, Rampazzo A, Zimbello R, Nava A, et al. Fine mapping and genomic structure of ACTN2, the human gene coding for the sarcomeric isoform of alpha-actinin-2, expressed in skeletal and cardiac muscle. Biochem Biophys Res Commun. 1999;265(1):256-259. doi: 10.1006/bbrc.1999.1661
25. Wade R, Eddy R, Shows TB, Kedes L. cDNA sequence, tissue-specific expression, and chromosomal mapping of the human slow-twitch skeletal muscle isoform of troponin I. Genomics. 1990;7(3):346-357. doi: 10.1016/0888-7543(90)90168-t
26. Nakao K, Minobe W, Roden R, Bristow MR, Leinwand LA. Myosin heavy chain gene expression in human heart failure. J Clin Invest. 1997;100(9):2362-2370. doi: 10.1172/JCI119776
27. Bird SD, Doevendans PA, van Rooijen MA, Brutel de la Riviere A, Hassink RJ, Passier R, et al. The human adult cardiomyocyte phenotype. Cardiovasc Res. 2003;58(2):423-434. doi: 10.1016/s0008-6363(03)00253-0
28. Bartels MC, Otten HG, Van Gelderen BE, Van der Lelij A. Influence of HLA-A, HLA-B, and HLA-DR matching on rejection of random corneal grafts using corneal tissue for retrospective DNA HLA typing. Br J Ophthalmol. 2001;85(11):1341-1346. doi: 10.1136/bjo.85.11.1341
29. Hall B, Duggin G, Philips J, Bishop GA, Horvath J, Tiller D. Increased expression of HLA-DR antigens on renal tubular cells in renal transplants: relevance to the rejection response. Lancet. 1984; 324(8397):247-251. doi: 10.1016/s0140-6736(84)90297-6
30. Badylak SF, Gilbert TW. Immune response to biologic scaffold materials. Semin Immunol. 2008; 20(2):109-116.
    doi: 10.1016/j.smim.2007.11.003
31. Hasegawa M, Fujimoto M, Kikuchi K, Takehara K. Elevated serum tumor necrosis factor-alpha levels in patients with systemic sclerosis: association with pulmonary fibrosis. J Rheumatol. 1997;24(4):663-665. PMID: 9101498
32. Conway DJ, Holland MJ, Bailey RL, Campbell AE, Mahdi O, Jennings R, et al. Scarring trachoma is associated with polymorphism in the tumor necrosis factor alpha (TNF-alpha) gene promoter and with elevated TNF-alpha levels in tear fluid. Infect Immun. 1997;65(3):1003-1006. doi: 10.1128/IAI.65.3.1003-1006.1997
33. Pratama G, Vaghjiani V, Tee JY, Liu YH, Chan J, Tan C, et al. Changes in culture expanded human amniotic epithelial cells: implications for potential therapeutic applications. PloS One. 2011;6(11):e26136. doi: 10.1371/journal.pone.0026136
34. Imagawa D, Millis J, Olthoff K, Derus L, Chia D, Sugich L, et al. The role of tumor necrosis factor in allograft rejection. I. Evidence that elevated levels of tumor necrosis factor-alpha predict rejection following orthotopic liver transplantation. Transplantation. 1990;50(2):219-225. doi: 10.1097/00007890-199008000-00009
35. Dupont M, Souriant S, Lugo-Villarino G, Maridonneau-Parini I, Vérollet C. Tunneling nanotubes: intimate communication between myeloid cells. Front Immunol. 2018;9:43. doi: 10.3389/fimmu.2018.00043
36. Hervé J-C, Derangeon M. Gap-junction-mediated cell-to-cell communication. Cell Tissue Res. 2013;352(1):21-31. doi: 10.1007/s00441-012-1485-6
37. Massaro MS, Pálek R, Rosendorf J, Červenková L, Liška V, Moulisová V. Decellularized xenogeneic scaffolds in transplantation and tissue engineering: Immunogenicity versus positive cell stimulation. Mater Sci Eng C. 2021;127:112203. doi: 10.1016/j.msec.2021.112203
38. Huettner N, Dargaville TR, Forget A. Discovering cell-adhesion peptides in tissue engineering: beyond RGD. Trends Biotechnol. 2018;36(4):372-383. doi: 10.1016/j.tibtech.2018.01.008
39. Davis RP, Casini S, van den Berg CW, Hoekstra M, Remme CA, Dambrot C, et al. Cardiomyocytes derived from pluripotent stem cells recapitulate electrophysiological characteristics of an overlap syndrome of cardiac sodium channel disease. Circulation. 2012;125(25):3079-3091. doi: 10.1161/circulationaha.111.066092
40. Miki T, Strom SC. Amnion-derived pluripotent/multipotent stem cells. Stem cell reviews. 2006;2(2):133-141.
    doi: 10.1007/s12015-006-0020-0
41. Fang C-H, Jin J, Joe J-H, Song Y-S, So B-I, Lim SM, et al. In vivo differentiation of human amniotic epithelial cells into cardiomyocyte-like cells and cell transplantation effect on myocardial infarction in rats: comparison with cord blood and adipose tissue-derived mesenchymal stem cells. Cell Transplant. 2012;21(8):1687-1696. doi: 10.3727/096368912X653039
42. Francisco JC, Cunha RC, Simeoni RB, Guarita-Souza LC, Ferreira RJ, Irioda AC, et al. Amniotic membrane as a potent source of stem cells and a matrix for engineering heart tissue. J Biomed Sci Engineering. 2013; 06(12):8. doi: 10.4236/jbise.2013.612147
43. Wang T, Xu Z, Jiang W, Ma A. Cell-to-cell contact induces mesenchymal stem cell to differentiate into cardiomyocyte and smooth muscle cell. Int J Cardiol. 2006;109(1):74-81. doi: 10.1016/j.ijcard.2005.05.072
44. Sandora N, Putra MA, Busro PW, Muttaqin C, Makdinata W, Fitria NA, et al. Preparation of cell-seeded heart patch in vitro; co-culture of adipose-derived mesenchymal stem cell and cardiomyocytes in amnion bilayer patch. Cardiovasc Eng Technol. 2021:1-14. doi: 10.1007/s13239-021-00565-4
45. Li X, Zhao H, Qi C, Zeng Y, Xu F, Du Y. Direct intercellular communications dominate the interaction between adipose-derived MSCs and myofibroblasts against cardiac fibrosis. Protein Cell. 2015;6(10):735-745. doi: 10.1007/s13238-015-0196-7
46. Lohse MJ, Engelhardt S, Eschenhagen T. What is the role of β-adrenergic signaling in heart failure? Circ Res. 2003;93(10):896-906. doi: 10.1161/01.RES.0000102042.83024.CA
47. Lands A, Arnold A, McAuliff JP, Luduena F, Brown JT. Differentiation of receptor systems activated by sympathomimetic amines. Nature. 1967;214(5088):597-598. doi: 10.1038/214597a0
48. White M, Roden R, Minobe W, Khan MF, Larrabee P, Wollmering M, et al. Age-related changes in beta-adrenergic neuroeffector systems in the human heart. Circulation. 1994;90(3):1225-1238. doi: 10.1161/01.CIR.90.3.1225
49. Vunjak-Novakovic G, Tandon N, Godier A, Maidhof R, Marsano A, Martens TP, et al. Challenges in cardiac tissue engineering. Tissue Eng Part B Rev. 2010;16(2):169-187. doi: 10.1089/ten.TEB.2009.0352
50. Dai R, Wang Z, Samanipour R, Koo KI, Kim K. Adipose-Derived Stem Cells for Tissue Engineering and Regenerative Medicine Applications. Stem Cells Int. 2016;2016:6737345. doi: 10.1155/2016/6737345
51. Khan M, Meduru S, Mohan IK, Kuppusamy ML, Wisel S, Kulkarni A, et al. Hyperbaric oxygenation enhances transplanted cell graft and functional recovery in the infarct heart. J Mol Cellular Cardiol. 2009;47(2):275-287. doi: 10.1016/j.yjmcc.2009.04.005
52. Qiu C, Ge Z, Cui W, Yu L, Li J. Human Amniotic Epithelial Stem Cells: A promising seed cell for clinical applications. Int J Mol Sci. 2020;21(20):7730. doi: 10.3390/ijms21207730
53. Zhang Q, Lai D. Application of human amniotic epithelial cells in regenerative medicine: a systematic review. Stem Cell Res Ther. 2020;11(1):439. doi: 10.1186/s13287-020-01951-w
54. Cohn JN, Ferrari R, Sharpe N. Cardiac remodeling – concepts and clinical implications: a consensus paper from an international forum on cardiac remodeling. Behalf of an International Forum on Cardiac Remodeling. J Am Coll Cardiol. 2000;35(3):569-582.
    doi: 10.1016/s0735-1097(99)00630-0

" ["DETAIL_TEXT_TYPE"]=> string(4) "html" ["~DETAIL_TEXT_TYPE"]=> string(4) "html" ["PREVIEW_TEXT"]=> string(0) "" ["~PREVIEW_TEXT"]=> string(0) "" ["PREVIEW_TEXT_TYPE"]=> string(4) "text" ["~PREVIEW_TEXT_TYPE"]=> string(4) "text" ["PREVIEW_PICTURE"]=> NULL ["~PREVIEW_PICTURE"]=> NULL ["LANG_DIR"]=> string(4) "/ru/" ["~LANG_DIR"]=> string(4) "/ru/" ["SORT"]=> string(2) "20" ["~SORT"]=> string(2) "20" ["CODE"]=> string(100) "kokultivirovanie-kardiomiotsitov-i-epitelialnykh-stvolovykh-kletok-amniona-cheloveka-v-amniotichesko" ["~CODE"]=> string(100) "kokultivirovanie-kardiomiotsitov-i-epitelialnykh-stvolovykh-kletok-amniona-cheloveka-v-amniotichesko" ["EXTERNAL_ID"]=> string(4) "2065" ["~EXTERNAL_ID"]=> string(4) "2065" ["IBLOCK_TYPE_ID"]=> string(7) "journal" ["~IBLOCK_TYPE_ID"]=> string(7) "journal" ["IBLOCK_CODE"]=> string(7) "volumes" ["~IBLOCK_CODE"]=> string(7) "volumes" ["IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["~IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["LID"]=> string(2) "s2" ["~LID"]=> string(2) "s2" ["EDIT_LINK"]=> NULL ["DELETE_LINK"]=> NULL ["DISPLAY_ACTIVE_FROM"]=> string(0) "" ["IPROPERTY_VALUES"]=> array(18) { ["ELEMENT_META_TITLE"]=> string(270) "Кокультивирование кардиомиоцитов и эпителиальных стволовых клеток амниона человека в амниотическом двуслойном матриксе в целях кардиомиогенеза" ["ELEMENT_META_KEYWORDS"]=> string(0) "" ["ELEMENT_META_DESCRIPTION"]=> string(388) "Кокультивирование кардиомиоцитов и эпителиальных стволовых клеток амниона человека в амниотическом двуслойном матриксе в целях кардиомиогенезаCo-culture of human cardiomyocyte and human amnion epithelial stem cells in amnion bilayer matrix for cardiomyogenesis" ["ELEMENT_PREVIEW_PICTURE_FILE_ALT"]=> string(5098) "<p style="text-align: justify;">В нашем исследовании разрабатывается система культивирования и доставки клеток для регенерации ткани миокарда в зоне инфаркта. Миокардиоциты человека (hCardio) и стволовые эпителиальные клетки амниона человека (hAESC) культивировали совместно на биологическом каркасе, образующем трехмерную (3D) матрицу в качестве возможного материала для заплаты на сердце. Настоящее исследование имело целью определение количественного соотношения миокардиоцитов и клеток амниона при их посеве для оценки лучших условий достижения кардиомиогенеза, а именно 1:5 или 1:6. Это соотношение соответствовало оптимальному числу 500000 клеток на см², что обеспечивает приготовление заплаты на сердце площадью 12 см². Это соотношение видов клеток уже сообщалось нами для кокультур стволовых клеток жировой ткани и миокардиоцитов. Миокардиоциты изолировали из операционного материала взятого от пациентов с гипертрофией правого желудочка. В изолированных клеточных популяциях показана экспрессия cTnT (10,7%), cKit/CD117 (16%), ICAM (94%) и PECAM+/VCAM- 33%. Амниотические эпителиальные стволовые клетки (hAESC) получали от доноров-женщин при кесаревом сечении. В этих клетках отмечена экспрессия TRA-1-60 (82,4%), SSEA-4 (28,2%), Oct-3/4 (2,9%), Nanog (11,4%), при отсутствии экспрессии иммунных антигенов, в т.ч., HLA-DR (0%), HLA-ABC (0,2%), а также низкий уровень экспрессии маркеров мезенхимальных стволовых клеток (MSC), т.е. CD73 (20,2%), CD90 (0,4%), CD105 (59,2%). Эти клетки не проявляли фенотипа Lin phenotype (CD3, CD14, CD16, CD19, CD20, CD56). При обоих соотношениях клеток в культуре в матрице выделялись небольшие количества TNF-α (<1 пг/мл) на протяжении культивирования с 1-го по 8-й день. Обе группы экспериментов имели сравнимый уровень роста клеток на протяжении времени. Конфокальные изображения показывают, что клеточная популяция размножалась и мигрировала в глубину до 140 мкм после 5 сут. культивирования кА в группе 1:5, так и в режиме 1:6. При этом отмечалось соединение клеток и образование отростков, начиная с 5 сут., более заметно в опытах с соотношением 1:5. Отмечалась быстрая пролиферация и отсутствие отдельно лежащих клеток после 8 сут. культивирования. Экспрессия генов кардиомиогенеза, в т.ч. cTnT и ACTN2, в группе с соотношением 1:6 на 8 сут. была сравнима с таковой в нормальных кардиомиоцитах. Гены MHC в группе с соотношением клеток 1:6 также экспрессировались, хотя и в меньшей степени, чем в в нормальных кардиомиоцитах. Эта работа показала, что кокультивирование миокардиоцитов и амниотических стволовых клеток при соотношении 1:6 на бислое амниотических клеток может поддерживать развитие кардиомиогенеза из клеток-предшественников.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;"> Амниотические эпителиальные клетки человека, кардиомиоциты человека, кардиомиогенез, амниотический бислой, каркас трехмерный, клеточная терапия.</p>" ["ELEMENT_PREVIEW_PICTURE_FILE_TITLE"]=> string(270) "Кокультивирование кардиомиоцитов и эпителиальных стволовых клеток амниона человека в амниотическом двуслойном матриксе в целях кардиомиогенеза" ["ELEMENT_DETAIL_PICTURE_FILE_ALT"]=> string(270) "Кокультивирование кардиомиоцитов и эпителиальных стволовых клеток амниона человека в амниотическом двуслойном матриксе в целях кардиомиогенеза" ["ELEMENT_DETAIL_PICTURE_FILE_TITLE"]=> string(270) "Кокультивирование кардиомиоцитов и эпителиальных стволовых клеток амниона человека в амниотическом двуслойном матриксе в целях кардиомиогенеза" ["SECTION_META_TITLE"]=> string(270) "Кокультивирование кардиомиоцитов и эпителиальных стволовых клеток амниона человека в амниотическом двуслойном матриксе в целях кардиомиогенеза" ["SECTION_META_KEYWORDS"]=> string(270) "Кокультивирование кардиомиоцитов и эпителиальных стволовых клеток амниона человека в амниотическом двуслойном матриксе в целях кардиомиогенеза" ["SECTION_META_DESCRIPTION"]=> string(270) "Кокультивирование кардиомиоцитов и эпителиальных стволовых клеток амниона человека в амниотическом двуслойном матриксе в целях кардиомиогенеза" ["SECTION_PICTURE_FILE_ALT"]=> string(270) "Кокультивирование кардиомиоцитов и эпителиальных стволовых клеток амниона человека в амниотическом двуслойном матриксе в целях кардиомиогенеза" ["SECTION_PICTURE_FILE_TITLE"]=> string(270) "Кокультивирование кардиомиоцитов и эпителиальных стволовых клеток амниона человека в амниотическом двуслойном матриксе в целях кардиомиогенеза" ["SECTION_PICTURE_FILE_NAME"]=> string(100) "kokultivirovanie-kardiomiotsitov-i-epitelialnykh-stvolovykh-kletok-amniona-cheloveka-v-amniotichesko" ["SECTION_DETAIL_PICTURE_FILE_ALT"]=> string(270) "Кокультивирование кардиомиоцитов и эпителиальных стволовых клеток амниона человека в амниотическом двуслойном матриксе в целях кардиомиогенеза" ["SECTION_DETAIL_PICTURE_FILE_TITLE"]=> string(270) "Кокультивирование кардиомиоцитов и эпителиальных стволовых клеток амниона человека в амниотическом двуслойном матриксе в целях кардиомиогенеза" ["SECTION_DETAIL_PICTURE_FILE_NAME"]=> string(100) "kokultivirovanie-kardiomiotsitov-i-epitelialnykh-stvolovykh-kletok-amniona-cheloveka-v-amniotichesko" ["ELEMENT_PREVIEW_PICTURE_FILE_NAME"]=> string(100) "kokultivirovanie-kardiomiotsitov-i-epitelialnykh-stvolovykh-kletok-amniona-cheloveka-v-amniotichesko" ["ELEMENT_DETAIL_PICTURE_FILE_NAME"]=> string(100) "kokultivirovanie-kardiomiotsitov-i-epitelialnykh-stvolovykh-kletok-amniona-cheloveka-v-amniotichesko" } ["FIELDS"]=> array(1) { ["IBLOCK_SECTION_ID"]=> string(3) "214" } ["PROPERTIES"]=> array(18) { ["KEYWORDS"]=> array(36) { ["ID"]=> string(2) "19" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:46:01" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(27) "Ключевые слова" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "KEYWORDS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "19" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "4" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "Y" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "Y" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(27) "Ключевые слова" ["~DEFAULT_VALUE"]=> string(0) "" } ["SUBMITTED"]=> array(36) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28686" ["VALUE"]=> string(22) "05/27/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "05/27/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL } ["ACCEPTED"]=> array(36) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28687" ["VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL } ["PUBLISHED"]=> array(36) { ["ID"]=> string(2) "22" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Дата публикации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "PUBLISHED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "22" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Дата публикации" ["~DEFAULT_VALUE"]=> NULL } ["CONTACT"]=> array(36) { ["ID"]=> string(2) "23" ["TIMESTAMP_X"]=> string(19) "2015-09-03 14:43:05" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(14) "Контакт" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "CONTACT" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "23" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(14) "Контакт" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHORS"]=> array(36) { ["ID"]=> string(2) "24" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:45:07" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "AUTHORS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "24" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_RU"]=> array(36) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28688" ["VALUE"]=> array(2) { ["TEXT"]=> string(543) "<p>Мухаммад А. Путра¹, Нормалина Сандора², Тиас Р. Кусума², Нур А. Фитриа², Три В. Сетисна³, Прибади В. Бусро¹, Арднансиа¹, Чайдар Муттакин¹, Вильям Макдината¹, Идрус Альви¹ </p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(411) "

Мухаммад А. Путра¹, Нормалина Сандора², Тиас Р. Кусума², Нур А. Фитриа², Три В. Сетисна³, Прибади В. Бусро¹, Арднансиа¹, Чайдар Муттакин¹, Вильям Макдината¹, Идрус Альви¹

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_RU"]=> array(36) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28689" ["VALUE"]=> array(2) { ["TEXT"]=> string(800) "<p>¹ Отдел торакальной и сердечно-сосудистой хирургии, факультет медицины, Индонезийский университет, Джакарта, Индонезия<br> ² Индонезийский институт медицинского образования и исследований, Научный центр репродукции, бесплодия и планирования семьи, Джакарта, Индонезия<br> ³ Отдел сердечной хирургии взрослых, Национальный сердечно-сосудистый центр Харапан Кита, Джакарта, Индонезия</>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(740) "

¹ Отдел торакальной и сердечно-сосудистой хирургии, факультет медицины, Индонезийский университет, Джакарта, Индонезия
² Индонезийский институт медицинского образования и исследований, Научный центр репродукции, бесплодия и планирования семьи, Джакарта, Индонезия
³ Отдел сердечной хирургии взрослых, Национальный сердечно-сосудистый центр Харапан Кита, Джакарта, Индонезия" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_RU"]=> array(36) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28690" ["VALUE"]=> array(2) { ["TEXT"]=> string(5098) "<p style="text-align: justify;">В нашем исследовании разрабатывается система культивирования и доставки клеток для регенерации ткани миокарда в зоне инфаркта. Миокардиоциты человека (hCardio) и стволовые эпителиальные клетки амниона человека (hAESC) культивировали совместно на биологическом каркасе, образующем трехмерную (3D) матрицу в качестве возможного материала для заплаты на сердце. Настоящее исследование имело целью определение количественного соотношения миокардиоцитов и клеток амниона при их посеве для оценки лучших условий достижения кардиомиогенеза, а именно 1:5 или 1:6. Это соотношение соответствовало оптимальному числу 500000 клеток на см², что обеспечивает приготовление заплаты на сердце площадью 12 см². Это соотношение видов клеток уже сообщалось нами для кокультур стволовых клеток жировой ткани и миокардиоцитов. Миокардиоциты изолировали из операционного материала взятого от пациентов с гипертрофией правого желудочка. В изолированных клеточных популяциях показана экспрессия cTnT (10,7%), cKit/CD117 (16%), ICAM (94%) и PECAM+/VCAM- 33%. Амниотические эпителиальные стволовые клетки (hAESC) получали от доноров-женщин при кесаревом сечении. В этих клетках отмечена экспрессия TRA-1-60 (82,4%), SSEA-4 (28,2%), Oct-3/4 (2,9%), Nanog (11,4%), при отсутствии экспрессии иммунных антигенов, в т.ч., HLA-DR (0%), HLA-ABC (0,2%), а также низкий уровень экспрессии маркеров мезенхимальных стволовых клеток (MSC), т.е. CD73 (20,2%), CD90 (0,4%), CD105 (59,2%). Эти клетки не проявляли фенотипа Lin phenotype (CD3, CD14, CD16, CD19, CD20, CD56). При обоих соотношениях клеток в культуре в матрице выделялись небольшие количества TNF-α (<1 пг/мл) на протяжении культивирования с 1-го по 8-й день. Обе группы экспериментов имели сравнимый уровень роста клеток на протяжении времени. Конфокальные изображения показывают, что клеточная популяция размножалась и мигрировала в глубину до 140 мкм после 5 сут. культивирования кА в группе 1:5, так и в режиме 1:6. При этом отмечалось соединение клеток и образование отростков, начиная с 5 сут., более заметно в опытах с соотношением 1:5. Отмечалась быстрая пролиферация и отсутствие отдельно лежащих клеток после 8 сут. культивирования. Экспрессия генов кардиомиогенеза, в т.ч. cTnT и ACTN2, в группе с соотношением 1:6 на 8 сут. была сравнима с таковой в нормальных кардиомиоцитах. Гены MHC в группе с соотношением клеток 1:6 также экспрессировались, хотя и в меньшей степени, чем в в нормальных кардиомиоцитах. Эта работа показала, что кокультивирование миокардиоцитов и амниотических стволовых клеток при соотношении 1:6 на бислое амниотических клеток может поддерживать развитие кардиомиогенеза из клеток-предшественников.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;"> Амниотические эпителиальные клетки человека, кардиомиоциты человека, кардиомиогенез, амниотический бислой, каркас трехмерный, клеточная терапия.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(5015) "

В нашем исследовании разрабатывается система культивирования и доставки клеток для регенерации ткани миокарда в зоне инфаркта. Миокардиоциты человека (hCardio) и стволовые эпителиальные клетки амниона человека (hAESC) культивировали совместно на биологическом каркасе, образующем трехмерную (3D) матрицу в качестве возможного материала для заплаты на сердце. Настоящее исследование имело целью определение количественного соотношения миокардиоцитов и клеток амниона при их посеве для оценки лучших условий достижения кардиомиогенеза, а именно 1:5 или 1:6. Это соотношение соответствовало оптимальному числу 500000 клеток на см², что обеспечивает приготовление заплаты на сердце площадью 12 см². Это соотношение видов клеток уже сообщалось нами для кокультур стволовых клеток жировой ткани и миокардиоцитов. Миокардиоциты изолировали из операционного материала взятого от пациентов с гипертрофией правого желудочка. В изолированных клеточных популяциях показана экспрессия cTnT (10,7%), cKit/CD117 (16%), ICAM (94%) и PECAM+/VCAM- 33%. Амниотические эпителиальные стволовые клетки (hAESC) получали от доноров-женщин при кесаревом сечении. В этих клетках отмечена экспрессия TRA-1-60 (82,4%), SSEA-4 (28,2%), Oct-3/4 (2,9%), Nanog (11,4%), при отсутствии экспрессии иммунных антигенов, в т.ч., HLA-DR (0%), HLA-ABC (0,2%), а также низкий уровень экспрессии маркеров мезенхимальных стволовых клеток (MSC), т.е. CD73 (20,2%), CD90 (0,4%), CD105 (59,2%). Эти клетки не проявляли фенотипа Lin phenotype (CD3, CD14, CD16, CD19, CD20, CD56). При обоих соотношениях клеток в культуре в матрице выделялись небольшие количества TNF-α (<1 пг/мл) на протяжении культивирования с 1-го по 8-й день. Обе группы экспериментов имели сравнимый уровень роста клеток на протяжении времени. Конфокальные изображения показывают, что клеточная популяция размножалась и мигрировала в глубину до 140 мкм после 5 сут. культивирования кА в группе 1:5, так и в режиме 1:6. При этом отмечалось соединение клеток и образование отростков, начиная с 5 сут., более заметно в опытах с соотношением 1:5. Отмечалась быстрая пролиферация и отсутствие отдельно лежащих клеток после 8 сут. культивирования. Экспрессия генов кардиомиогенеза, в т.ч. cTnT и ACTN2, в группе с соотношением 1:6 на 8 сут. была сравнима с таковой в нормальных кардиомиоцитах. Гены MHC в группе с соотношением клеток 1:6 также экспрессировались, хотя и в меньшей степени, чем в в нормальных кардиомиоцитах. Эта работа показала, что кокультивирование миокардиоцитов и амниотических стволовых клеток при соотношении 1:6 на бислое амниотических клеток может поддерживать развитие кардиомиогенеза из клеток-предшественников.

Ключевые слова

Амниотические эпителиальные клетки человека, кардиомиоциты человека, кардиомиогенез, амниотический бислой, каркас трехмерный, клеточная терапия.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["DOI"]=> array(36) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28691" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-72-83" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-72-83" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_EN"]=> array(36) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28694" ["VALUE"]=> array(2) { ["TEXT"]=> string(422) "<p>Muhammad A. Putra¹, Normalina Sandora², Tyas R. Kusuma², Nur A. Fitria², Tri W. Soetisna³, Pribadi W. Busro¹, Ardiansyah¹, Chaidar Muttaqin¹, William Makdinata¹, Idrus Alwi¹</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(290) "

Muhammad A. Putra¹, Normalina Sandora², Tyas R. Kusuma², Nur A. Fitria², Tri W. Soetisna³, Pribadi W. Busro¹, Ardiansyah¹, Chaidar Muttaqin¹, William Makdinata¹, Idrus Alwi¹

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_EN"]=> array(36) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28695" ["VALUE"]=> array(2) { ["TEXT"]=> string(1009) "<p>¹ Department of Thoracic and Cardiovascular Surgery, Faculty of Medicine, Universitas Indonesia, Jakarta, Indonesia<br> ² Indonesia Medical Education and Research Institute, Human Reproduction Infertility and Family Planning Research Center, Jakarta, Indonesia<br> ³ Adult Cardiac Surgery Department, National Cardiovascular Center Harapan Kita, Jakarta, Indonesia</p><br> <p><b>Correspondence:</b><br> Dr. Normalina Sandora, Indonesia Medical Education and Research Institute, Human Reproduction Infertility and Family Planning Research Center, Jakarta, Indonesia<br> E-mail: normalinasandora@gmail.com</p><br> <p><b>Citation:</b> Putra MA, Sandora N, Kusuma TR, et al. Co-culture of human cardiomyocyte and human amnion epithelial stem cells in amnion bilayer matrix for cardiomyogenesis. Cell Ther Transplant 2022; 11(2): 72-83.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(877) "

¹ Department of Thoracic and Cardiovascular Surgery, Faculty of Medicine, Universitas Indonesia, Jakarta, Indonesia
² Indonesia Medical Education and Research Institute, Human Reproduction Infertility and Family Planning Research Center, Jakarta, Indonesia
³ Adult Cardiac Surgery Department, National Cardiovascular Center Harapan Kita, Jakarta, Indonesia

Correspondence:
Dr. Normalina Sandora, Indonesia Medical Education and Research Institute, Human Reproduction Infertility and Family Planning Research Center, Jakarta, Indonesia
E-mail: normalinasandora@gmail.com

Citation: Putra MA, Sandora N, Kusuma TR, et al. Co-culture of human cardiomyocyte and human amnion epithelial stem cells in amnion bilayer matrix for cardiomyogenesis. Cell Ther Transplant 2022; 11(2): 72-83.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_EN"]=> array(36) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28696" ["VALUE"]=> array(2) { ["TEXT"]=> string(2608) "<p style="text-align: justify;">Our study developed a culture system to deliver cells for the regeneration of infarcted myocardial tissue. Human cardiomyocytes (hCardio) and human amnion epithelial stem cells (hAESC) were co-cultured in a biological scaffold forming a 3-D matrix, prepared as a heart patch candidate. The current investigation was aimed for assessment of hCardio-to-hAESC seeding ratio for the best conditions to provide cardiomyogenesis, i.e., 1:5 or the 1:6. This ratio corresponded to optimal cell number of 500,000 cells/cm², thus providing a 12-cm² heart patch. This cell ratio was also published in our previous study using human adipose stem cells and hCardio. The hCardio was isolated from the heart tissue taken during surgical correction performed in patients with right ventricular hypertrophy. The cell isolates expressed cTnT (10.7%), cKit/CD117 (16%), ICAM (94%), and PECAM+/VCAM- 33%. The hAESC was isolated from an elected donor at Caesarean section. It showed expression of TRA-1-60 (82.4%), SSEA-4 (28.2%), Oct-3/4 (2.9%), Nanog (11.4%), without expression of immune antigens, e.g., HLA-DR (0%), HLA-ABC (0.2%) as well as low-level expression of mesenchymal stem cell (MSC) markers, i.e., CD73 (20.2%), CD90 (0.4%), CD105 (59.2%). These cells did not exhibit Lin phenotype (CD3, CD14, CD16, CD19, CD20, CD56). At both seeding ratios, the co-culture matrix also released TNF-α at low levels (<1 pg/ml) throughout cultivation from day 1 to day 8. Both groups had shown a consistent growth of cells over time. Confocal images showed that the cell population has expanded and migrated to the deeper plane up to 140 µm after 5 days of incubation in both 1:5 and 1:6 groups. The cells seemed to connect and form projections, starting by day 5, being more obvious among the 1:5 group. They proliferated rapidly until no solitary cells were observed after day 8 of co-culture. Expression of the cardiomyogenesis genes, e.g., cTnT and ACTN2 in the 1:6 group were expressed, similarly to normal cardiomyocytes after eight days of cultivation. MHC genes in the 1:6 group were also expressed, although less than 1-fold to normal cardiomyocytes. This study indicated that hCardio and hAESC at 1:6 ratio seeded on amnion bilayer could support cardiomyogenesis derivation from the progenitor cells.</p> <h2>Keywords</h2> <p style="text-align: justify;"> Human amnion epithelial stem cells, human cardiomyocytes, cardiomyogenesis, amnion bilayer, 3-D scaffold, cell therapy.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(2525) "

Our study developed a culture system to deliver cells for the regeneration of infarcted myocardial tissue. Human cardiomyocytes (hCardio) and human amnion epithelial stem cells (hAESC) were co-cultured in a biological scaffold forming a 3-D matrix, prepared as a heart patch candidate. The current investigation was aimed for assessment of hCardio-to-hAESC seeding ratio for the best conditions to provide cardiomyogenesis, i.e., 1:5 or the 1:6. This ratio corresponded to optimal cell number of 500,000 cells/cm², thus providing a 12-cm² heart patch. This cell ratio was also published in our previous study using human adipose stem cells and hCardio. The hCardio was isolated from the heart tissue taken during surgical correction performed in patients with right ventricular hypertrophy. The cell isolates expressed cTnT (10.7%), cKit/CD117 (16%), ICAM (94%), and PECAM+/VCAM- 33%. The hAESC was isolated from an elected donor at Caesarean section. It showed expression of TRA-1-60 (82.4%), SSEA-4 (28.2%), Oct-3/4 (2.9%), Nanog (11.4%), without expression of immune antigens, e.g., HLA-DR (0%), HLA-ABC (0.2%) as well as low-level expression of mesenchymal stem cell (MSC) markers, i.e., CD73 (20.2%), CD90 (0.4%), CD105 (59.2%). These cells did not exhibit Lin phenotype (CD3, CD14, CD16, CD19, CD20, CD56). At both seeding ratios, the co-culture matrix also released TNF-α at low levels (<1 pg/ml) throughout cultivation from day 1 to day 8. Both groups had shown a consistent growth of cells over time. Confocal images showed that the cell population has expanded and migrated to the deeper plane up to 140 µm after 5 days of incubation in both 1:5 and 1:6 groups. The cells seemed to connect and form projections, starting by day 5, being more obvious among the 1:5 group. They proliferated rapidly until no solitary cells were observed after day 8 of co-culture. Expression of the cardiomyogenesis genes, e.g., cTnT and ACTN2 in the 1:6 group were expressed, similarly to normal cardiomyocytes after eight days of cultivation. MHC genes in the 1:6 group were also expressed, although less than 1-fold to normal cardiomyocytes. This study indicated that hCardio and hAESC at 1:6 ratio seeded on amnion bilayer could support cardiomyogenesis derivation from the progenitor cells.

Keywords

Human amnion epithelial stem cells, human cardiomyocytes, cardiomyogenesis, amnion bilayer, 3-D scaffold, cell therapy.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["NAME_EN"]=> array(36) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28692" ["VALUE"]=> string(118) "Co-culture of human cardiomyocyte and human amnion epithelial stem cells in amnion bilayer matrix for cardiomyogenesis" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(118) "Co-culture of human cardiomyocyte and human amnion epithelial stem cells in amnion bilayer matrix for cardiomyogenesis" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" } ["FULL_TEXT_RU"]=> array(36) { ["ID"]=> string(2) "42" ["TIMESTAMP_X"]=> string(19) "2015-09-07 20:29:18" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(23) "Полный текст" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(12) "FULL_TEXT_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "42" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(23) "Полный текст" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["PDF_RU"]=> array(36) { ["ID"]=> string(2) "43" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF RUS" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_RU" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "43" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28693" ["VALUE"]=> string(4) "2876" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2876" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF RUS" ["~DEFAULT_VALUE"]=> string(0) "" } ["PDF_EN"]=> array(36) { ["ID"]=> string(2) "44" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF ENG" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "44" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28697" ["VALUE"]=> string(4) "2877" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2877" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF ENG" ["~DEFAULT_VALUE"]=> string(0) "" } ["NAME_LONG"]=> array(36) { ["ID"]=> string(2) "45" ["TIMESTAMP_X"]=> string(19) "2023-04-13 00:55:00" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(72) "Название (для очень длинных заголовков)" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "NAME_LONG" ["DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "45" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(80) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(72) "Название (для очень длинных заголовков)" ["~DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } } } ["DISPLAY_PROPERTIES"]=> array(10) { ["AUTHOR_EN"]=> array(37) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28694" ["VALUE"]=> array(2) { ["TEXT"]=> string(422) "<p>Muhammad A. Putra¹, Normalina Sandora², Tyas R. Kusuma², Nur A. Fitria², Tri W. Soetisna³, Pribadi W. Busro¹, Ardiansyah¹, Chaidar Muttaqin¹, William Makdinata¹, Idrus Alwi¹</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(290) "

Muhammad A. Putra¹, Normalina Sandora², Tyas R. Kusuma², Nur A. Fitria², Tri W. Soetisna³, Pribadi W. Busro¹, Ardiansyah¹, Chaidar Muttaqin¹, William Makdinata¹, Idrus Alwi¹

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(290) "

Muhammad A. Putra¹, Normalina Sandora², Tyas R. Kusuma², Nur A. Fitria², Tri W. Soetisna³, Pribadi W. Busro¹, Ardiansyah¹, Chaidar Muttaqin¹, William Makdinata¹, Idrus Alwi¹

" } ["SUMMARY_EN"]=> array(37) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28696" ["VALUE"]=> array(2) { ["TEXT"]=> string(2608) "<p style="text-align: justify;">Our study developed a culture system to deliver cells for the regeneration of infarcted myocardial tissue. Human cardiomyocytes (hCardio) and human amnion epithelial stem cells (hAESC) were co-cultured in a biological scaffold forming a 3-D matrix, prepared as a heart patch candidate. The current investigation was aimed for assessment of hCardio-to-hAESC seeding ratio for the best conditions to provide cardiomyogenesis, i.e., 1:5 or the 1:6. This ratio corresponded to optimal cell number of 500,000 cells/cm², thus providing a 12-cm² heart patch. This cell ratio was also published in our previous study using human adipose stem cells and hCardio. The hCardio was isolated from the heart tissue taken during surgical correction performed in patients with right ventricular hypertrophy. The cell isolates expressed cTnT (10.7%), cKit/CD117 (16%), ICAM (94%), and PECAM+/VCAM- 33%. The hAESC was isolated from an elected donor at Caesarean section. It showed expression of TRA-1-60 (82.4%), SSEA-4 (28.2%), Oct-3/4 (2.9%), Nanog (11.4%), without expression of immune antigens, e.g., HLA-DR (0%), HLA-ABC (0.2%) as well as low-level expression of mesenchymal stem cell (MSC) markers, i.e., CD73 (20.2%), CD90 (0.4%), CD105 (59.2%). These cells did not exhibit Lin phenotype (CD3, CD14, CD16, CD19, CD20, CD56). At both seeding ratios, the co-culture matrix also released TNF-α at low levels (<1 pg/ml) throughout cultivation from day 1 to day 8. Both groups had shown a consistent growth of cells over time. Confocal images showed that the cell population has expanded and migrated to the deeper plane up to 140 µm after 5 days of incubation in both 1:5 and 1:6 groups. The cells seemed to connect and form projections, starting by day 5, being more obvious among the 1:5 group. They proliferated rapidly until no solitary cells were observed after day 8 of co-culture. Expression of the cardiomyogenesis genes, e.g., cTnT and ACTN2 in the 1:6 group were expressed, similarly to normal cardiomyocytes after eight days of cultivation. MHC genes in the 1:6 group were also expressed, although less than 1-fold to normal cardiomyocytes. This study indicated that hCardio and hAESC at 1:6 ratio seeded on amnion bilayer could support cardiomyogenesis derivation from the progenitor cells.</p> <h2>Keywords</h2> <p style="text-align: justify;"> Human amnion epithelial stem cells, human cardiomyocytes, cardiomyogenesis, amnion bilayer, 3-D scaffold, cell therapy.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(2525) "

Our study developed a culture system to deliver cells for the regeneration of infarcted myocardial tissue. Human cardiomyocytes (hCardio) and human amnion epithelial stem cells (hAESC) were co-cultured in a biological scaffold forming a 3-D matrix, prepared as a heart patch candidate. The current investigation was aimed for assessment of hCardio-to-hAESC seeding ratio for the best conditions to provide cardiomyogenesis, i.e., 1:5 or the 1:6. This ratio corresponded to optimal cell number of 500,000 cells/cm², thus providing a 12-cm² heart patch. This cell ratio was also published in our previous study using human adipose stem cells and hCardio. The hCardio was isolated from the heart tissue taken during surgical correction performed in patients with right ventricular hypertrophy. The cell isolates expressed cTnT (10.7%), cKit/CD117 (16%), ICAM (94%), and PECAM+/VCAM- 33%. The hAESC was isolated from an elected donor at Caesarean section. It showed expression of TRA-1-60 (82.4%), SSEA-4 (28.2%), Oct-3/4 (2.9%), Nanog (11.4%), without expression of immune antigens, e.g., HLA-DR (0%), HLA-ABC (0.2%) as well as low-level expression of mesenchymal stem cell (MSC) markers, i.e., CD73 (20.2%), CD90 (0.4%), CD105 (59.2%). These cells did not exhibit Lin phenotype (CD3, CD14, CD16, CD19, CD20, CD56). At both seeding ratios, the co-culture matrix also released TNF-α at low levels (<1 pg/ml) throughout cultivation from day 1 to day 8. Both groups had shown a consistent growth of cells over time. Confocal images showed that the cell population has expanded and migrated to the deeper plane up to 140 µm after 5 days of incubation in both 1:5 and 1:6 groups. The cells seemed to connect and form projections, starting by day 5, being more obvious among the 1:5 group. They proliferated rapidly until no solitary cells were observed after day 8 of co-culture. Expression of the cardiomyogenesis genes, e.g., cTnT and ACTN2 in the 1:6 group were expressed, similarly to normal cardiomyocytes after eight days of cultivation. MHC genes in the 1:6 group were also expressed, although less than 1-fold to normal cardiomyocytes. This study indicated that hCardio and hAESC at 1:6 ratio seeded on amnion bilayer could support cardiomyogenesis derivation from the progenitor cells.

Keywords

Human amnion epithelial stem cells, human cardiomyocytes, cardiomyogenesis, amnion bilayer, 3-D scaffold, cell therapy.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(2525) "

Our study developed a culture system to deliver cells for the regeneration of infarcted myocardial tissue. Human cardiomyocytes (hCardio) and human amnion epithelial stem cells (hAESC) were co-cultured in a biological scaffold forming a 3-D matrix, prepared as a heart patch candidate. The current investigation was aimed for assessment of hCardio-to-hAESC seeding ratio for the best conditions to provide cardiomyogenesis, i.e., 1:5 or the 1:6. This ratio corresponded to optimal cell number of 500,000 cells/cm², thus providing a 12-cm² heart patch. This cell ratio was also published in our previous study using human adipose stem cells and hCardio. The hCardio was isolated from the heart tissue taken during surgical correction performed in patients with right ventricular hypertrophy. The cell isolates expressed cTnT (10.7%), cKit/CD117 (16%), ICAM (94%), and PECAM+/VCAM- 33%. The hAESC was isolated from an elected donor at Caesarean section. It showed expression of TRA-1-60 (82.4%), SSEA-4 (28.2%), Oct-3/4 (2.9%), Nanog (11.4%), without expression of immune antigens, e.g., HLA-DR (0%), HLA-ABC (0.2%) as well as low-level expression of mesenchymal stem cell (MSC) markers, i.e., CD73 (20.2%), CD90 (0.4%), CD105 (59.2%). These cells did not exhibit Lin phenotype (CD3, CD14, CD16, CD19, CD20, CD56). At both seeding ratios, the co-culture matrix also released TNF-α at low levels (<1 pg/ml) throughout cultivation from day 1 to day 8. Both groups had shown a consistent growth of cells over time. Confocal images showed that the cell population has expanded and migrated to the deeper plane up to 140 µm after 5 days of incubation in both 1:5 and 1:6 groups. The cells seemed to connect and form projections, starting by day 5, being more obvious among the 1:5 group. They proliferated rapidly until no solitary cells were observed after day 8 of co-culture. Expression of the cardiomyogenesis genes, e.g., cTnT and ACTN2 in the 1:6 group were expressed, similarly to normal cardiomyocytes after eight days of cultivation. MHC genes in the 1:6 group were also expressed, although less than 1-fold to normal cardiomyocytes. This study indicated that hCardio and hAESC at 1:6 ratio seeded on amnion bilayer could support cardiomyogenesis derivation from the progenitor cells.

Keywords

Human amnion epithelial stem cells, human cardiomyocytes, cardiomyogenesis, amnion bilayer, 3-D scaffold, cell therapy.

" } ["DOI"]=> array(37) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28691" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-72-83" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-72-83" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-72-83" } ["NAME_EN"]=> array(37) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28692" ["VALUE"]=> string(118) "Co-culture of human cardiomyocyte and human amnion epithelial stem cells in amnion bilayer matrix for cardiomyogenesis" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(118) "Co-culture of human cardiomyocyte and human amnion epithelial stem cells in amnion bilayer matrix for cardiomyogenesis" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(118) "Co-culture of human cardiomyocyte and human amnion epithelial stem cells in amnion bilayer matrix for cardiomyogenesis" } ["ORGANIZATION_EN"]=> array(37) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28695" ["VALUE"]=> array(2) { ["TEXT"]=> string(1009) "<p>¹ Department of Thoracic and Cardiovascular Surgery, Faculty of Medicine, Universitas Indonesia, Jakarta, Indonesia<br> ² Indonesia Medical Education and Research Institute, Human Reproduction Infertility and Family Planning Research Center, Jakarta, Indonesia<br> ³ Adult Cardiac Surgery Department, National Cardiovascular Center Harapan Kita, Jakarta, Indonesia</p><br> <p><b>Correspondence:</b><br> Dr. Normalina Sandora, Indonesia Medical Education and Research Institute, Human Reproduction Infertility and Family Planning Research Center, Jakarta, Indonesia<br> E-mail: normalinasandora@gmail.com</p><br> <p><b>Citation:</b> Putra MA, Sandora N, Kusuma TR, et al. Co-culture of human cardiomyocyte and human amnion epithelial stem cells in amnion bilayer matrix for cardiomyogenesis. Cell Ther Transplant 2022; 11(2): 72-83.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(877) "

¹ Department of Thoracic and Cardiovascular Surgery, Faculty of Medicine, Universitas Indonesia, Jakarta, Indonesia
² Indonesia Medical Education and Research Institute, Human Reproduction Infertility and Family Planning Research Center, Jakarta, Indonesia
³ Adult Cardiac Surgery Department, National Cardiovascular Center Harapan Kita, Jakarta, Indonesia

Correspondence:
Dr. Normalina Sandora, Indonesia Medical Education and Research Institute, Human Reproduction Infertility and Family Planning Research Center, Jakarta, Indonesia
E-mail: normalinasandora@gmail.com

Citation: Putra MA, Sandora N, Kusuma TR, et al. Co-culture of human cardiomyocyte and human amnion epithelial stem cells in amnion bilayer matrix for cardiomyogenesis. Cell Ther Transplant 2022; 11(2): 72-83.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(877) "

¹ Department of Thoracic and Cardiovascular Surgery, Faculty of Medicine, Universitas Indonesia, Jakarta, Indonesia
² Indonesia Medical Education and Research Institute, Human Reproduction Infertility and Family Planning Research Center, Jakarta, Indonesia
³ Adult Cardiac Surgery Department, National Cardiovascular Center Harapan Kita, Jakarta, Indonesia

Correspondence:
Dr. Normalina Sandora, Indonesia Medical Education and Research Institute, Human Reproduction Infertility and Family Planning Research Center, Jakarta, Indonesia
E-mail: normalinasandora@gmail.com

Citation: Putra MA, Sandora N, Kusuma TR, et al. Co-culture of human cardiomyocyte and human amnion epithelial stem cells in amnion bilayer matrix for cardiomyogenesis. Cell Ther Transplant 2022; 11(2): 72-83.

" } ["AUTHOR_RU"]=> array(37) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28688" ["VALUE"]=> array(2) { ["TEXT"]=> string(543) "<p>Мухаммад А. Путра¹, Нормалина Сандора², Тиас Р. Кусума², Нур А. Фитриа², Три В. Сетисна³, Прибади В. Бусро¹, Арднансиа¹, Чайдар Муттакин¹, Вильям Макдината¹, Идрус Альви¹ </p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(411) "

Мухаммад А. Путра¹, Нормалина Сандора², Тиас Р. Кусума², Нур А. Фитриа², Три В. Сетисна³, Прибади В. Бусро¹, Арднансиа¹, Чайдар Муттакин¹, Вильям Макдината¹, Идрус Альви¹

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(411) "

Мухаммад А. Путра¹, Нормалина Сандора², Тиас Р. Кусума², Нур А. Фитриа², Три В. Сетисна³, Прибади В. Бусро¹, Арднансиа¹, Чайдар Муттакин¹, Вильям Макдината¹, Идрус Альви¹

" } ["SUBMITTED"]=> array(37) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28686" ["VALUE"]=> string(22) "05/27/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "05/27/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "05/27/2022 12:00:00 am" } ["ACCEPTED"]=> array(37) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28687" ["VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "06/24/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "06/24/2022 12:00:00 am" } ["SUMMARY_RU"]=> array(37) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28690" ["VALUE"]=> array(2) { ["TEXT"]=> string(5098) "<p style="text-align: justify;">В нашем исследовании разрабатывается система культивирования и доставки клеток для регенерации ткани миокарда в зоне инфаркта. Миокардиоциты человека (hCardio) и стволовые эпителиальные клетки амниона человека (hAESC) культивировали совместно на биологическом каркасе, образующем трехмерную (3D) матрицу в качестве возможного материала для заплаты на сердце. Настоящее исследование имело целью определение количественного соотношения миокардиоцитов и клеток амниона при их посеве для оценки лучших условий достижения кардиомиогенеза, а именно 1:5 или 1:6. Это соотношение соответствовало оптимальному числу 500000 клеток на см², что обеспечивает приготовление заплаты на сердце площадью 12 см². Это соотношение видов клеток уже сообщалось нами для кокультур стволовых клеток жировой ткани и миокардиоцитов. Миокардиоциты изолировали из операционного материала взятого от пациентов с гипертрофией правого желудочка. В изолированных клеточных популяциях показана экспрессия cTnT (10,7%), cKit/CD117 (16%), ICAM (94%) и PECAM+/VCAM- 33%. Амниотические эпителиальные стволовые клетки (hAESC) получали от доноров-женщин при кесаревом сечении. В этих клетках отмечена экспрессия TRA-1-60 (82,4%), SSEA-4 (28,2%), Oct-3/4 (2,9%), Nanog (11,4%), при отсутствии экспрессии иммунных антигенов, в т.ч., HLA-DR (0%), HLA-ABC (0,2%), а также низкий уровень экспрессии маркеров мезенхимальных стволовых клеток (MSC), т.е. CD73 (20,2%), CD90 (0,4%), CD105 (59,2%). Эти клетки не проявляли фенотипа Lin phenotype (CD3, CD14, CD16, CD19, CD20, CD56). При обоих соотношениях клеток в культуре в матрице выделялись небольшие количества TNF-α (<1 пг/мл) на протяжении культивирования с 1-го по 8-й день. Обе группы экспериментов имели сравнимый уровень роста клеток на протяжении времени. Конфокальные изображения показывают, что клеточная популяция размножалась и мигрировала в глубину до 140 мкм после 5 сут. культивирования кА в группе 1:5, так и в режиме 1:6. При этом отмечалось соединение клеток и образование отростков, начиная с 5 сут., более заметно в опытах с соотношением 1:5. Отмечалась быстрая пролиферация и отсутствие отдельно лежащих клеток после 8 сут. культивирования. Экспрессия генов кардиомиогенеза, в т.ч. cTnT и ACTN2, в группе с соотношением 1:6 на 8 сут. была сравнима с таковой в нормальных кардиомиоцитах. Гены MHC в группе с соотношением клеток 1:6 также экспрессировались, хотя и в меньшей степени, чем в в нормальных кардиомиоцитах. Эта работа показала, что кокультивирование миокардиоцитов и амниотических стволовых клеток при соотношении 1:6 на бислое амниотических клеток может поддерживать развитие кардиомиогенеза из клеток-предшественников.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;"> Амниотические эпителиальные клетки человека, кардиомиоциты человека, кардиомиогенез, амниотический бислой, каркас трехмерный, клеточная терапия.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(5015) "

В нашем исследовании разрабатывается система культивирования и доставки клеток для регенерации ткани миокарда в зоне инфаркта. Миокардиоциты человека (hCardio) и стволовые эпителиальные клетки амниона человека (hAESC) культивировали совместно на биологическом каркасе, образующем трехмерную (3D) матрицу в качестве возможного материала для заплаты на сердце. Настоящее исследование имело целью определение количественного соотношения миокардиоцитов и клеток амниона при их посеве для оценки лучших условий достижения кардиомиогенеза, а именно 1:5 или 1:6. Это соотношение соответствовало оптимальному числу 500000 клеток на см², что обеспечивает приготовление заплаты на сердце площадью 12 см². Это соотношение видов клеток уже сообщалось нами для кокультур стволовых клеток жировой ткани и миокардиоцитов. Миокардиоциты изолировали из операционного материала взятого от пациентов с гипертрофией правого желудочка. В изолированных клеточных популяциях показана экспрессия cTnT (10,7%), cKit/CD117 (16%), ICAM (94%) и PECAM+/VCAM- 33%. Амниотические эпителиальные стволовые клетки (hAESC) получали от доноров-женщин при кесаревом сечении. В этих клетках отмечена экспрессия TRA-1-60 (82,4%), SSEA-4 (28,2%), Oct-3/4 (2,9%), Nanog (11,4%), при отсутствии экспрессии иммунных антигенов, в т.ч., HLA-DR (0%), HLA-ABC (0,2%), а также низкий уровень экспрессии маркеров мезенхимальных стволовых клеток (MSC), т.е. CD73 (20,2%), CD90 (0,4%), CD105 (59,2%). Эти клетки не проявляли фенотипа Lin phenotype (CD3, CD14, CD16, CD19, CD20, CD56). При обоих соотношениях клеток в культуре в матрице выделялись небольшие количества TNF-α (<1 пг/мл) на протяжении культивирования с 1-го по 8-й день. Обе группы экспериментов имели сравнимый уровень роста клеток на протяжении времени. Конфокальные изображения показывают, что клеточная популяция размножалась и мигрировала в глубину до 140 мкм после 5 сут. культивирования кА в группе 1:5, так и в режиме 1:6. При этом отмечалось соединение клеток и образование отростков, начиная с 5 сут., более заметно в опытах с соотношением 1:5. Отмечалась быстрая пролиферация и отсутствие отдельно лежащих клеток после 8 сут. культивирования. Экспрессия генов кардиомиогенеза, в т.ч. cTnT и ACTN2, в группе с соотношением 1:6 на 8 сут. была сравнима с таковой в нормальных кардиомиоцитах. Гены MHC в группе с соотношением клеток 1:6 также экспрессировались, хотя и в меньшей степени, чем в в нормальных кардиомиоцитах. Эта работа показала, что кокультивирование миокардиоцитов и амниотических стволовых клеток при соотношении 1:6 на бислое амниотических клеток может поддерживать развитие кардиомиогенеза из клеток-предшественников.

Ключевые слова

Амниотические эпителиальные клетки человека, кардиомиоциты человека, кардиомиогенез, амниотический бислой, каркас трехмерный, клеточная терапия.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(5015) "

В нашем исследовании разрабатывается система культивирования и доставки клеток для регенерации ткани миокарда в зоне инфаркта. Миокардиоциты человека (hCardio) и стволовые эпителиальные клетки амниона человека (hAESC) культивировали совместно на биологическом каркасе, образующем трехмерную (3D) матрицу в качестве возможного материала для заплаты на сердце. Настоящее исследование имело целью определение количественного соотношения миокардиоцитов и клеток амниона при их посеве для оценки лучших условий достижения кардиомиогенеза, а именно 1:5 или 1:6. Это соотношение соответствовало оптимальному числу 500000 клеток на см², что обеспечивает приготовление заплаты на сердце площадью 12 см². Это соотношение видов клеток уже сообщалось нами для кокультур стволовых клеток жировой ткани и миокардиоцитов. Миокардиоциты изолировали из операционного материала взятого от пациентов с гипертрофией правого желудочка. В изолированных клеточных популяциях показана экспрессия cTnT (10,7%), cKit/CD117 (16%), ICAM (94%) и PECAM+/VCAM- 33%. Амниотические эпителиальные стволовые клетки (hAESC) получали от доноров-женщин при кесаревом сечении. В этих клетках отмечена экспрессия TRA-1-60 (82,4%), SSEA-4 (28,2%), Oct-3/4 (2,9%), Nanog (11,4%), при отсутствии экспрессии иммунных антигенов, в т.ч., HLA-DR (0%), HLA-ABC (0,2%), а также низкий уровень экспрессии маркеров мезенхимальных стволовых клеток (MSC), т.е. CD73 (20,2%), CD90 (0,4%), CD105 (59,2%). Эти клетки не проявляли фенотипа Lin phenotype (CD3, CD14, CD16, CD19, CD20, CD56). При обоих соотношениях клеток в культуре в матрице выделялись небольшие количества TNF-α (<1 пг/мл) на протяжении культивирования с 1-го по 8-й день. Обе группы экспериментов имели сравнимый уровень роста клеток на протяжении времени. Конфокальные изображения показывают, что клеточная популяция размножалась и мигрировала в глубину до 140 мкм после 5 сут. культивирования кА в группе 1:5, так и в режиме 1:6. При этом отмечалось соединение клеток и образование отростков, начиная с 5 сут., более заметно в опытах с соотношением 1:5. Отмечалась быстрая пролиферация и отсутствие отдельно лежащих клеток после 8 сут. культивирования. Экспрессия генов кардиомиогенеза, в т.ч. cTnT и ACTN2, в группе с соотношением 1:6 на 8 сут. была сравнима с таковой в нормальных кардиомиоцитах. Гены MHC в группе с соотношением клеток 1:6 также экспрессировались, хотя и в меньшей степени, чем в в нормальных кардиомиоцитах. Эта работа показала, что кокультивирование миокардиоцитов и амниотических стволовых клеток при соотношении 1:6 на бислое амниотических клеток может поддерживать развитие кардиомиогенеза из клеток-предшественников.

Ключевые слова

Амниотические эпителиальные клетки человека, кардиомиоциты человека, кардиомиогенез, амниотический бислой, каркас трехмерный, клеточная терапия.

" } ["ORGANIZATION_RU"]=> array(37) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28689" ["VALUE"]=> array(2) { ["TEXT"]=> string(800) "<p>¹ Отдел торакальной и сердечно-сосудистой хирургии, факультет медицины, Индонезийский университет, Джакарта, Индонезия<br> ² Индонезийский институт медицинского образования и исследований, Научный центр репродукции, бесплодия и планирования семьи, Джакарта, Индонезия<br> ³ Отдел сердечной хирургии взрослых, Национальный сердечно-сосудистый центр Харапан Кита, Джакарта, Индонезия</>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(740) "

¹ Отдел торакальной и сердечно-сосудистой хирургии, факультет медицины, Индонезийский университет, Джакарта, Индонезия
² Индонезийский институт медицинского образования и исследований, Научный центр репродукции, бесплодия и планирования семьи, Джакарта, Индонезия
³ Отдел сердечной хирургии взрослых, Национальный сердечно-сосудистый центр Харапан Кита, Джакарта, Индонезия" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(740) "

¹ Отдел торакальной и сердечно-сосудистой хирургии, факультет медицины, Индонезийский университет, Джакарта, Индонезия
² Индонезийский институт медицинского образования и исследований, Научный центр репродукции, бесплодия и планирования семьи, Джакарта, Индонезия
³ Отдел сердечной хирургии взрослых, Национальный сердечно-сосудистый центр Харапан Кита, Джакарта, Индонезия" } } } [11]=> array(49) { ["IBLOCK_SECTION_ID"]=> string(3) "214" ["~IBLOCK_SECTION_ID"]=> string(3) "214" ["ID"]=> string(4) "2064" ["~ID"]=> string(4) "2064" ["IBLOCK_ID"]=> string(1) "2" ["~IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(282) "Выращивание фибробластов кожи человека с использованием роботизированной системы: сравнение технологий ручного и автоматизированного культивирования" ["~NAME"]=> string(282) "Выращивание фибробластов кожи человека с использованием роботизированной системы: сравнение технологий ручного и автоматизированного культивирования" ["ACTIVE_FROM"]=> NULL ["~ACTIVE_FROM"]=> NULL ["TIMESTAMP_X"]=> string(22) "08/10/2022 11:06:32 am" ["~TIMESTAMP_X"]=> string(22) "08/10/2022 11:06:32 am" ["DETAIL_PAGE_URL"]=> string(159) "/en/archive/tom-11-nomer-2/eksperimentalnye-issledovaniya/vyrashchivanie-fibroblastov-kozhi-cheloveka-s-ispolzovaniem-robotizirovannoy-sistemy-sravnenie-tekhn/" ["~DETAIL_PAGE_URL"]=> string(159) "/en/archive/tom-11-nomer-2/eksperimentalnye-issledovaniya/vyrashchivanie-fibroblastov-kozhi-cheloveka-s-ispolzovaniem-robotizirovannoy-sistemy-sravnenie-tekhn/" ["LIST_PAGE_URL"]=> string(12) "/en/archive/" ["~LIST_PAGE_URL"]=> string(12) "/en/archive/" ["DETAIL_TEXT"]=> string(34606) "

Introduction

Cell therapy is becoming an essential branch of contemporary medicine. Clinical implementation of cell therapy faces the need to solve the challenges of increasing scale of cell manufacturing. The large-scale cultivation of cells may require the use of scale up systems, such as microcarriers-based bioreactor systems, multi-layer bioreactors, hollow-fiber bioreactors. Such approaches are cost effective for the production of a minimum a billion cells per lot and hence are the most suitable for the cell cultures applied in allogenic cell therapy [1].

Human dermal fibroblasts (HDFs) of allogenic or autologous origin have a wide range of applications, especially in regenerative medicine. Autologous fibroblasts are clinically used for the correction of age-related skin changes [2, 3], the treatment of acne scars [4] or traumatic scars [5]. The individual dose of fibroblasts usually does not exceed 6×10⁷ cells per injection session and 12×10⁷ cells per treatment course. Therefore, the employment of scale up cell cultivation systems for autologous cell therapy is impractical. Considering the requirement for separate manufacturing of autologous fibroblasts for each patient, the scale-out of operations using standard T-flasks is the most preferred method, since this method allows parallel manufacturing of several small batches of adherent cells.

However, the scale-out production of autologous cells using culture flasks is labor intensive, costly, time-consuming, increases the risk of microbial contamination, and, moreover, often fails to reproduce cell cultivation processes. These drawbacks could be minimized or even completely eliminated by using automated cell culture platforms operating with T-flasks.

CompacT SelecT CellBase automated cell culture system (here forth referred to as CompacT SelecT, TAP Biosystems/Sartorius, Royston, UK) is used to automatically cultivate and maintain adherent cell lines using polystyrene cell culture flasks. It consists of two main parts: CO₂-incubator chamber containing a carousel to handle cell culture flasks and the laminar flow chamber with robotic manipulator equipped with a gripper, performing the work steps of a human operator (Fig. 1). Liquids, such as growth media, can be added via peristaltic pumps, while in order to transfer liquids from one flask to another one, CompacT SelecT uses 10 mL disposable serological pipettes. The counting of viable cell number is performed by the integrated Beckman Coulter Vi-CELL XR Cell Viability Analyzer in the semi-autonomous mode.

Figure 1. CompacT SelecT automated cell culture system (A) and its key functions: (B) spent medium is poured to waste funnel; (C) media, trypsin or other process liquids can be precisely dispensed by peristaltic pumps from nozzles; (D) flasks are swirled to distribute enzyme or rinse the cell monolayer; (E) the pipette is used to transfer cells from flask

CompacT SelecT has been successfully employed to cultivate mesenchymal stem cells (MSCs) [6, 7], induced pluripotent stem cells (iPSCs) and their derivatives [8, 9], embryonic stem cells (ESCs) [10], human Caucasian osteosarcoma cells (HOS) [11], as well as transfected cell lines [12]. To our knowledge, however, cultivation of HDFs on CompacT SelecT platform has not been reported previously.

Our study aimed (i) to test the automated process of long-term cultivation of autologous HDFs using the CompacT SelecT platform, and (ii) to compare morphology, proliferative activity, viability and secretory activity of HDFs cultured under manual and automatic modes.

Materials and methods

HDFs culture

The HDFs lines were isolated from skin samples (area ≈0,5 cm²), which were surgically excised from 6 donors (age 25-35) during surgery. Prior to the surgery patients provided a written informed consent. The study was approved by the Ethics Committee of the Institute of Medical Cell Technologies (Ekaterinburg, Russian Federation) (approval No.5-16). Primary HDFs cultures were obtained via tissue enzymatic dissociation method. Briefly, dermal biopsy sample was cut into small pieces (about 1 mm in all three dimensions) and incubated in 3 mL of collagenase I solution (1000 U/mL, Sigma-Aldrich, St. Louis, MO, USA) at 37°C for 2.5 hours. Following enzyme inhibition by mixing with 4-fold volume of growth medium, cells were dissociated by vigorous shaking. Cell suspension was centrifuged at 270 g for 10 minutes, the pellet was resuspended in complete growth medium and transferred to T25 culture flask (Nunc, Roskilde, Denmark). The growth medium consisted of the mixture of Advanced DMEM and F-12 (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) in the ratio 1:1, supplemented with 12% fetal calf serum (Biosera, Nuaille, France), 0.03% Glutamine (Gibco, USA) and gentamycin (50 μg/mL). Fibroblasts were subcultured when the monolayer reached 70-80% confluency. For long-term preservation, cells were stored in liquid nitrogen. Thawed cells were passaged at least twice prior to their usage. In this study, the cells from passages 4-7 were used.

Manual HDFs subculture protocol

The protocol for manual subculturing of HDFs in Т175 culture flask consisted of the following steps: (i) growth medium from flask was aspirated, cells were washed with 15 mL of DPBS without Ca²⁺, Mg²⁺ (Biolot, Russia); (ii) cells were incubated with 5 mL of 0.25% trypsin/EDTA (Gibco, USA) at 37°С, 5% CO₂ for 8 min., cell detachment was controlled visually; (iii) trypsin was neutralized with 10 mL of growth medium; (iv) cell number was counted using the ViCell XR cell counter, integrated into CompacT SelecT; (v) cell suspension containing 525,000 cells was transferred into a new culture flask (seeding density 3000 cells/cm²); (vi) growth medium was added to the new flask to reach the final volume of 30 mL. Cells were incubated in CO₂-incubator (Sanyo/Panasonic, Moriguchi, Osaka, Japan) at 37°С, 5% CO₂.

Automated HDFs subculture protocol

The sequence of CompacT SelecT automated protocol operations is presented in Fig. 2.

Secretory products assay

Spent medium samples were collected from flasks before subculturing, centrifuged at 6800g for 10 min and stored at -20°С until further analysis. Quantitative ELISA assay was used to evaluate the levels of IL-6 (Interleukin-6-ELISA-BEST №А8768, Vector-Best, Novosibirsk, Russia), IL-8/CXCL8 (Interleukin8-ELISA-BEST №А8762, Vector-Best, Russia) and α1 chain of procollagen I (Human Pro-Collagen I alpha 1 DuoSet ELISA №DY6220-05, R&D Systems, Minneapolis, MN, USA). The assays were performed according to the manufacturer’s protocols.

HDFs adhesion and growth in T175 flasks from different manufacturers

The operations were performed in CompacT SelecT using a modified protocol for automated subculturing. For cell adhesion assay, HDFs were seeded at a density of 8000 cells/cm² into the flasks and incubated in CompacT SelecT СО₂-incubator (37°С, 5% СО₂) for 18 hours; adherent cells were detached with trypsin and counted automatically by using the shortened version of protocol (Fig. 2) without steps of seeding cells to new flask. To perform proliferation assay, the seeding density was 1500 cells/cm², incubation in CompacT SelecT lasted 6 days with the single medium change on day 3. After 6 days fibroblasts were automatically detached and counted in the same way.

Comparative analysis between manual and automated HDFs cultivation

HDFs after thawing were seeded into Т175 Nunc culture flasks. After reaching 80% confluency of monolayer, cells from all flasks were harvested and seeded into new T175 Nunc flasks, according to scheme in Fig. 3, with the seeding density 3000 cells/cm². Six flasks were loaded into CompacT SelecT for automated cultivation; the other 6 flasks were placed in СО₂-incubator for manual cultivation. Cells were subcultured after 7 days of growth with the single growth medium change on day 4. During subculturing HDFs were seeded from mother flask to daughter flask without mixing cells from different flasks for both manual and automated protocol. HDFs were grown for 4 consecutive passages. Seeding density was always 3000 cells/cm². All operations with manually and automatically processed flasks were synchronized (Fig. 3).

Figure 3. Schematic representation of automated (filled circles) and manual (empty circles) cultivation of human dermal fibroblasts

Statistics

All quantitative values are presented as X±m, where m is the standard error of the mean X. The relative standard deviation (RSD) was calculated as a ratio of standard deviation of the value to its mean X. The statistical significance of differences between 2 groups was analyzed by non-parametric Mann-Whitney U-test, for pairwise comparison of 3 groups the non-parametric variant of Newman-Keuls test was used. Statistical analysis was performed using MS Excel 2010 and STATISTICA 6.0. The level of statistical significance was set at p<0.05. All experiments were performed in six replicates.

Results

Selection of Т175 cell culture flasks for HDFs automated cultivation

In the first series of experiments the culture flasks which are the most suitable for the automated HDFs cultivation were selected. CompacT SelecT software allows to use Т175 flasks from three manufacturers: (i) Nunc (Denmark), № 178983; (ii) Corning (USA), № 431306; and (iii) Becton Dickinson (BD) (USA), № 353118. The percentage of adhered HDFs and their proliferation on these types of flasks were measured using CompacT SelecT platform.

The variations in the percentage of adhered cells between all types of flasks were not statistically significant (p>0.05) (Table 1). At the same time, HDFs, grown in Corning flasks, showed the lowest ratio of monolayer density / seeding density, while the differences between BD and Nunc flasks were not statistically significant (p>0.05). Hence, BD and Nunc T175 flasks proved to be the most suitable for HDFs manufacturing in CompacT SelecT. To conduct a comparative analysis of manual and automated HDFs cultivation, we have used Nunc flasks.

Table 1. HDFs adhesion and proliferation on three types of T175 culture flasks (Nunc, BD, Corning), appropriate for CompacT SelecT

Automated and manual cultivation: cell morphology and proliferation

In the next series of experiments, we compared morphology, proliferation and secretory activity of HDFs, cultivated in Т175 Nunc culture flasks manually and automatically in CompacT SelecT. The manual and automated protocols contained similar sets of operations. CompacT SelecT is not designed to use the centrifuge. For this reason, in both protocols following cell detachment, trypsin was neutralized by the dilution with growth medium.

The cells grown manually and automatically had the typical fibroblast-like shape without any differences in their shape (Fig. 4). Besides, in both cases cells were distributed on culture plastic surface rather evenly, without the formation of large aggregates. This indicates that the protocol for automated cell cultivation provides the even mixing of cells in suspension after their detachment from plastic surface by trypsin.

Figure 4. HDFs shape at automatic and manual cultivation modes, passage 2

The comparison of HDF sizes (cell diameters in suspension) also did not reveal significant differences between manual and automated cell cultivation at all four passages (Fig. 5).

The cell viability was 97% or higher at all the passages. At the 2^nd and 3^rd passages the viability of automatically cultivated cells was statistically higher than that of manually grown cells (p<0.05), however, that difference was less than 1% and hence can be considered negligible (Fig. 5).

The HDF monolayer densities are presented in Fig. 6. The cell yields demonstrated the tendency of decreasing from the 1st to the last passage, which is obviously due to the aging of culture. At all of the four passages the average quantity of automatically grown cells was 1.25-1.5 times higher than of that of cells grown manually (p<0.01).

The technical flask-to-flask variations of cell diameter and cell number for both cell processing techniques are presented in Fig. 7. The RSD in cell density fell in the range from 0.047 to 0.130 for automated culturing and from 0.097 to 0.185 for manual culturing; the RSD in cell diameter ranged from 0.0019 to 0.0038 and from 0.0020 to 0.0053 for automated and manual culturing, respectively. At all the passages, the RSDs in cell diameter and cell number for automated protocol were lower in comparison with the data for manual protocol.

Figure 6. HDF densities in flasks during four passages: automated and manual procedures are shown by solid and dotted lines, respectively. Differences between automated and manual cultivation were statistically significant at all four passages (p<0.01)

Figure 7. The RSD in cell diameter (lower lines with triangle markers) and in cell monolayer density (upper lines with square markers) of HDFs grown automatically (solid lines) and manually (dotted lines)

Automated and manual cultivation: cell secretion assay

The paracrine function of HDFs was estimated by the quantity of secreted interleukin-6 (IL-6) and interleukin-8 (IL-8/CXCL8) per 10⁶ cells. The concentration of IL-8 was 1.5-3 times higher for manual cultivation in comparison to the automated mode at all passages. The quantity of IL-6 was also higher for the manual cell cultivation albeit the differences observed were less significant (maximum 1.8 times) (Table 2).

The pro-collagen Iα assay was used to estimate the synthesis of extracellular matrix (ECM) components by HDFs. As with cytokines, the quantity of pro-collagen secreted by manually grown cells was higher than that recorded in the case with automatically cultivated cells. The differences between the two modes were statistically significant at 1, 3 and 4 passages (Table 2).

Table 2. Secretion of cytokines (IL-6, IL-8) and pro-collagen I α-chain by HDFs. Statistically significant (p<0.05) differences between manual and automatic cultivation are indicated by bold underlined font

Discussion

The procedure of obtaining fibroblasts for autologous therapy consists of 3 main steps: (i) isolation of primary fibroblasts culture, (ii) expansion of cells and (iii) preparation of cells for clinical usage and / or cryopreservation of cell yield. The technical characteristics of CompacT SelecT allow its use for the automation of step 2. We developed the protocol to cultivate human skin fibroblasts using CompacT SelecT robotic station and imitated its application for the scale-out cultivation of autologous cells which can be further applied in clinical practice.

Automation of cell cultivation processes allows to standardize and multiply cell cultivation and to overcome the problems of manual operations with cells related to individual features of operator skills and possible missteps occurring during work [13, 14, 15]. Thus, it is expected that automated cultivation would reduce the flask-to-flask variations resulting in more homogenous and standardized cell yield.

In this study, we demonstrated the possibility of long-term automated scale-out manufacturing of HDFs applied in autologous cell therapy using CompacT SelecT. Cells were successfuly subcultured for 4 passages, in the first 3 passages (7-10)×10⁶ cells per flask were obtained. Thus, manufacturing the batch of 10⁸ HDFs for the patient requires harvesting cells from about 15 flasks. Using the seeding density of 3000 cells/cm² (applied in this study) allows the production of such HDFs batch after 1-2 passages from a single T175 flask. CompacT SelecT platform is capable of handling up to 90 flasks simultaneously, which is sufficient to process up to 8 batches in parallel (starting batches processing at different time and using more sophisticated types of flasks can increase this number).

We have also compared the manual and automated methods of cell cultivation. The automated protocol repeated the basic steps of manual protocol. With the both modes having been applied, trypsin was neutralized by dilution with serum containing growth media, hence, the differences in the data obtained after studying of two cultivation modes cannot be explained by different ways of trypsin removal. The comparison demonstrated similarity in cell shape, cell size and viability of manually and automatically processed HDFs cultures. However, the cell yield on robotic platform was significantly higher at all passages.

The quantities of cells grown manually and using CompacT SelecT platform were analyzed in other studies. The results of such studies varied: the yield of human MSCs [7] and HOS cells [11] was greater in manual culture, while the human iPSC-derived neuroepithelial-like stem cells [8] had more population doublings when grown automatically. On the other hand, the growth profiles of manual and automated neural stem cells (CTX0E03) cultures were almost identical [16]. These findings are not surprizing. They may be due to significant discrepancies between manual and automated protocols. Firstly, in manual protocols of all these studies, trypsin was discarded by centrifugation, while in automated protocols it was either diluted by growth medium or neutralized and dumped after cells adhered to plastic. The different ways of trypsin neutralization could significantly affect cell proliferation. Secondly, CompacT SelecT robotic arm imitates the work of human operator in laminar flow hood, but the development of protocol for automated cell cultivation is limited by manipulations performed by the machine and by the inability to monitor cells during protocol execution. For example, one of the most significant problems was the high rate of cell aggregation after detachment with trypsin. The aggregates were ineffectively broken by CompacT SelecT pipette, which inevitably affected the cell yield. The same problem was observed in other researches [17]. High cell aggregation rate is most probably due to the prolonged incubation in trypsin during the protocol run, since the inability to control cell detachment requires the increase in trypsinization time. In our protocol, this problem was solved by using the complicated scheme of mixing of trypsinized fibroblasts with growth medium. The quantity of cells obtained in automated platform greatly depends on the design of the protocol and its fitness for cell culture [18, 19]. Hence, the evaluation of advantages/disadvantages of the automated/manual cell cultivation using the data on the cell yield from various studies must be done with caution.

The clinical effect of transplanted fibroblasts is mostly due to the synthesis of ECM components [20, 21] and to the paracrine secretion of growth factors and cytokines affecting the migration and proliferation of patient skin cells [22, 23]. IL-6 is involved in both pro- and antiinflammatory activities, but it also stimulates the proliferation of keratinocytes [24]. Apart from inducing chemotaxis in neutrophils, IL-8/CXCL8 is a pro-angiogenic factor [25]. The concentration of these cytokines tended to grow from the first to the last passage at the both types of HDFs culture techniques used, which was most likely caused by the progressive approaching of cells to senescent phenotype [26, 27]. Though it should be noted that automatically cultured HDFs produced lower amounts of both cytokines and pro-collagen I (per 10⁶ cells) than cells cultured manually. This may be due to the difference in cell monolayer density in flasks processed manually and automatically: in some researches fibroblasts with higher monolayer density secreted lower levels of cytokines and collagen per cell [28, 29, 30].

A higher reproducibility of automated operations in scale-out manufacturing of cells is expected to provide a higher uniformity of cells phenotype and cell yields for different flasks from the batch. We compared the flask-to-flask variation of HDFs cell diameter and cell yield. In all four passages, the RSD in cell monolayer density and RSD in cell diameter were lower in the case of automated process. The RSD data showed that flask-to-flask variations of cell size and cell yield for automated culturing were less apparent, which supports a higher consistency of automated HDFs manufacturing.

Conclusion

The automation of scale-out cultivation of cells for clinical applications is one of significant challenges in regenerative medicine. In this study, we demonstrated a successful long-term cultivation of HDFs in the CompacT SelecT robotic platform. Cells, manufactured automatically, preserved the typical fibroblast-like shape, high proliferation activity and the capability to produce cytokines and pro-collagen. Comparison of manual and automated cultivation confirmed a higher uniformity of cell yield after automated manufacturing.

This work has been funded by Institute of Medical Cell Technologies.

Conflicts of interest

The authors declare no conflict of interest.

References

1. Simaria AS, Hassan S, Varadaraju H, Rowley J, Warren K, Vanek P, Farid SS. Allogeneic cell therapy bioprocess economics and optimization: single-use cell expansion technologies. Biotechnol Bioeng. 2014; 111(1):69-83. doi: 10.1002/bit.25008
2. De Chiara ML, Tuche FA, de Mendonça FR. 2020. Autologous fibroblasts injections in face. In: A. Da Costa (eds.) Minimally Invasive Aesthetic Procedures. Springer, Cham, Switzerland. P. 705-710. doi: 10.1007/978-3-319-78265-2_99
3. Zorin VL, Zorinа AI, Kopnin PB, Kantserov SZ, Isaev AA. Autologous dermal fibroblasts for the correction of age-related skin changes (SPRS-therapy®). Results of 2-year clinical trials and post-marketing clinical studies. CellR4. 2016; 4(3): e2084.
4. Munavalli GS, Smith S, Maslowski JM, Weiss RA. Successful treatment of depressed, distensible acne scars using autologous fibroblasts: a multi-site, prospective, double blind, placebo-controlled clinical trial. Dermatol Surg. 2013; 39(8): 1226-1236.
   doi: 10.1111/dsu.12204
5. Yeh SW, Huang M.-Y. Autologous fibroblast therapy of the scar: A preclinical report. Dermatol Sinica. 2013; 31: 159-160.
   doi: 10.1016/j.dsi.2012.10.007
6. Archibald PRT, Chandra A, Thomas D, Morley G, Lekishvili T, Devonshire A, Williams DJ. Comparability of scalable, automated hMSC culture using manual andautomated process steps. Biochem. Engineering J. 2016; 108:69-83. doi: 10.1016/j.bej.2015.07.001
7. Thomas RJ, Chandra A, Liu Y, Hourd PC, Conway PP, Williams DJ. Manufacture of a human mesenchymal stem cell population using an automated cell culture platform. Cytotechnology. 2007. 55: 31-39. doi: 10.1007/s10616-007-9091-2
8. McLaren D, Gorba T, de Rotrou AM, Pillai G, Chappell C, Stacey A, et al. Automated large-scale culture and medium-throughput chemical screen for modulators of proliferation and viability of human induced pluripotent stem cell-derived neuroepithelial-like stem cells. J Biomol Screen. 2013. 18(3): 258-268. doi: 10.1177/1087057112461446
9. Soares FA, Chandra A, Thomas RJ, Pedersen RA, Vallier L, Williams DJ. Investigating the feasibility of scale up and automation of human induced pluripotent stem cells cultured in aggregates in feeder free conditions. J Biotechnol. 2014 Mar 10;173(100):53-58.
   doi: 10.1016/j.jbiotec.2013.12.009
10. Thomas RJ, Anderson D, Chandra A, Smith NM, Young LE, Williams D, Denning C. Automated, scalable culture of human embryonic stem cells in feeder-free conditions. Biotechnol Bioeng. 2009; 102(6):1636-1644. doi: 10.1002/bit.22187
11. Liu Y, Hourd P, Chandra A, Williams DJ. Human cell culture process capability: a comparison of manual and automated production.
    J Tissue Eng Regen Med. 2010;4(1):45-54. doi: 10.1002/term.217
12. Zhao Y, Bishop B, Clay JE, Lu W, Jones M, Daenke S, et al. Automation of large scale transient protein expression in mammalian cells. J Struct Biol. 2011;175(2):209-215. doi: 10.1016/j.jsb.2011.04.017
13. Daniszewski M, Crombie DE, Henderson R, Liang HH, Wong RCB, Hewitt AW, Pébay A. Automated Cell Culture Systems and Their Applications to Human Pluripotent Stem Cell Studies. SLAS Technol. 2018;23(4):315-325. doi: 10.1177/2472630317712220
14. Jung S, Ochs J, Kulik M, König N, Schmitt R. Highly modular and generic control software for adaptive cell processing on automated production platforms. Proc CIRP. 2018; 72; 1245-1250. doi: 10.1016/j.procir.2018.03.189
15. Tristan CA, Ormanoglu P, Slamecka J, Malley C, Chu PH, Jovanovic VM, Gedik Y, Bonney C, Barnaeva E, Braisted J, Mallanna SK, Dorjsuren D, Iannotti MJ, Voss TC, Michael S, Simeonov A, Singeç I. Robotic High-Throughput Biomanufacturing and Functional Differentiation of Human Pluripotent Stem Cells. bioRxiv [Preprint]. 2020 Aug 3:2020.08.03.235242. doi: 10.1101/2020.08.03.235242
16. Thomas RJ, Hope AD, Hourd P, Baradez M, Miljan EA, Sinden JD, Williams DJ. Automated, serum-free production of CTX0E03:
    a therapeutic clinical grade human neural stem cell line. Biotechnol Lett. 2009; 31(8):1167-72. doi: 10.1007/s10529-009-9989-1
17. Shariatzadeh M, Chandra A, Wilson SL, McCall MJ, Morizur L, Lesueur L, et al. Distributed automated manufacturing of pluripotent stem cell products. Int. J. Adv. Manuf. Technol. 2020. 106(3):1085-1103. doi: 10.1007/s00170-019-04516-1
18. Ferreira MV, Jahnen-Dechent W, Neuss S. Standardization of automated cell-based protocols for toxicity testing of biomaterials.
    J Biomol Screen. 2011; 16(6): 647-654. doi: 10.1177/1087057111405380
19. Doulgkeroglou MN, Di Nubila A, Niessing B, König N, Schmitt RH, Damen J, Szilvassy AJ, Chang W, Csontos L, Louis S, Kugelmeier P, Ronfard V, Bayon Y, Zeugolis DI. Automation, Monitoring, and Standardization of Cell Pro-duct Manufacturing. Front Bioeng Biotechnol. 2020. 8:811. doi: 10.3389/fbioe.2020.00811
20. Wong T, McGrath JA, Navsaria H. The role of fibroblasts in tissue engineering and regeneration. Br. J. Dermatol. 2007;156:1149-1155. doi: 10.1111/j.1365-2133.2007.07914.x
21. Kouhbananinejad SM, Arminm F, Dabiri S, Derakhshani A, Iranpour M, Farsinejad A. Application and assessment of allogeneic fibroblasts for cell therapy. Iran J Pathol. 2018; 13(4): 454-460. PMID: 30774685
22. Singer AJ, Simon MWound healing and skin substitutes. pp. 375-393. In: A. Battler, and J. Leor (eds). Stem Cell and Gene-Based Therapy. 2006. Springer-Verlag, London, UK.
23. Thangapazham RL, Darling TN, Meyerle J. Alteration of skin properties with autologous dermal fibroblasts. Int J Mol Sci. 2014. 15: 8407-8427. doi: 10.3390/ijms15058407
24. Werner S, Krieg T, Smola H. Keratinocyte-fibroblast interactions in wound healing. J. Invest. Dermatol. 2007. 127(5): 998-1008.
    doi: 10.1038/sj.jid.5700786
25. Wojtowicz AM, Oliveira S, Carlson MW, Zawadzka A, Rousseau CF, Baksh D. The importance of both fibroblasts and keratinocytes in a bilayered living cellular construct used in wound healing. Wound Repair Regen. 2014. 22(2): 246-255. doi: 10.1111/wrr.12154
26. Coppé JP, Desprez PY, Krtolica A, Campisi J. The senescence-associated secretory phenotype: the dark side of tumor suppression. Annu Rev Pathol. 2010; 5: 99-118. doi: 10.1146/annurev-pathol-121808-102144
27. Sapochnik M, Fuertes M, Arzt E. Programmed cell senescence: role of IL-6 in the pituitary. J Mol Endocrinol. 2017; 58(4): R241-R253. doi: 10.1530/JME-17-0026
28. Olgart C, Frossard N. Human lung fibroblasts secrete nerve growth factor: effect of inflammatory cytokines and glucocorticoids. Eur Respir J. 2001; 18(1): 115-121. doi: 10.1183/09031936.01.00069901
29. Masur SK, Dewal HS, Dinh TT, Erenburg I, Petridou S. Myofibroblasts differentiate from fibroblasts when plated at low density. Proc Natl Acad Sci. USA. 1996; 93(9): 4219-4223. doi: 10.1073/pnas.93.9.4219
30. Aumailley M, Krieg T, Razaka G, Müller PK, Bricaud H. Influence of cell density on collagen biosynthesis in fibroblast cultures. Biochem J. 1982; 206(3): 505-510. doi: 10.1042/bj2060505

" ["~DETAIL_TEXT"]=> string(34606) "

Introduction

Cell therapy is becoming an essential branch of contemporary medicine. Clinical implementation of cell therapy faces the need to solve the challenges of increasing scale of cell manufacturing. The large-scale cultivation of cells may require the use of scale up systems, such as microcarriers-based bioreactor systems, multi-layer bioreactors, hollow-fiber bioreactors. Such approaches are cost effective for the production of a minimum a billion cells per lot and hence are the most suitable for the cell cultures applied in allogenic cell therapy [1].

Human dermal fibroblasts (HDFs) of allogenic or autologous origin have a wide range of applications, especially in regenerative medicine. Autologous fibroblasts are clinically used for the correction of age-related skin changes [2, 3], the treatment of acne scars [4] or traumatic scars [5]. The individual dose of fibroblasts usually does not exceed 6×10⁷ cells per injection session and 12×10⁷ cells per treatment course. Therefore, the employment of scale up cell cultivation systems for autologous cell therapy is impractical. Considering the requirement for separate manufacturing of autologous fibroblasts for each patient, the scale-out of operations using standard T-flasks is the most preferred method, since this method allows parallel manufacturing of several small batches of adherent cells.

However, the scale-out production of autologous cells using culture flasks is labor intensive, costly, time-consuming, increases the risk of microbial contamination, and, moreover, often fails to reproduce cell cultivation processes. These drawbacks could be minimized or even completely eliminated by using automated cell culture platforms operating with T-flasks.

CompacT SelecT CellBase automated cell culture system (here forth referred to as CompacT SelecT, TAP Biosystems/Sartorius, Royston, UK) is used to automatically cultivate and maintain adherent cell lines using polystyrene cell culture flasks. It consists of two main parts: CO₂-incubator chamber containing a carousel to handle cell culture flasks and the laminar flow chamber with robotic manipulator equipped with a gripper, performing the work steps of a human operator (Fig. 1). Liquids, such as growth media, can be added via peristaltic pumps, while in order to transfer liquids from one flask to another one, CompacT SelecT uses 10 mL disposable serological pipettes. The counting of viable cell number is performed by the integrated Beckman Coulter Vi-CELL XR Cell Viability Analyzer in the semi-autonomous mode.

Figure 1. CompacT SelecT automated cell culture system (A) and its key functions: (B) spent medium is poured to waste funnel; (C) media, trypsin or other process liquids can be precisely dispensed by peristaltic pumps from nozzles; (D) flasks are swirled to distribute enzyme or rinse the cell monolayer; (E) the pipette is used to transfer cells from flask

CompacT SelecT has been successfully employed to cultivate mesenchymal stem cells (MSCs) [6, 7], induced pluripotent stem cells (iPSCs) and their derivatives [8, 9], embryonic stem cells (ESCs) [10], human Caucasian osteosarcoma cells (HOS) [11], as well as transfected cell lines [12]. To our knowledge, however, cultivation of HDFs on CompacT SelecT platform has not been reported previously.

Our study aimed (i) to test the automated process of long-term cultivation of autologous HDFs using the CompacT SelecT platform, and (ii) to compare morphology, proliferative activity, viability and secretory activity of HDFs cultured under manual and automatic modes.

Materials and methods

HDFs culture

The HDFs lines were isolated from skin samples (area ≈0,5 cm²), which were surgically excised from 6 donors (age 25-35) during surgery. Prior to the surgery patients provided a written informed consent. The study was approved by the Ethics Committee of the Institute of Medical Cell Technologies (Ekaterinburg, Russian Federation) (approval No.5-16). Primary HDFs cultures were obtained via tissue enzymatic dissociation method. Briefly, dermal biopsy sample was cut into small pieces (about 1 mm in all three dimensions) and incubated in 3 mL of collagenase I solution (1000 U/mL, Sigma-Aldrich, St. Louis, MO, USA) at 37°C for 2.5 hours. Following enzyme inhibition by mixing with 4-fold volume of growth medium, cells were dissociated by vigorous shaking. Cell suspension was centrifuged at 270 g for 10 minutes, the pellet was resuspended in complete growth medium and transferred to T25 culture flask (Nunc, Roskilde, Denmark). The growth medium consisted of the mixture of Advanced DMEM and F-12 (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) in the ratio 1:1, supplemented with 12% fetal calf serum (Biosera, Nuaille, France), 0.03% Glutamine (Gibco, USA) and gentamycin (50 μg/mL). Fibroblasts were subcultured when the monolayer reached 70-80% confluency. For long-term preservation, cells were stored in liquid nitrogen. Thawed cells were passaged at least twice prior to their usage. In this study, the cells from passages 4-7 were used.

Manual HDFs subculture protocol

The protocol for manual subculturing of HDFs in Т175 culture flask consisted of the following steps: (i) growth medium from flask was aspirated, cells were washed with 15 mL of DPBS without Ca²⁺, Mg²⁺ (Biolot, Russia); (ii) cells were incubated with 5 mL of 0.25% trypsin/EDTA (Gibco, USA) at 37°С, 5% CO₂ for 8 min., cell detachment was controlled visually; (iii) trypsin was neutralized with 10 mL of growth medium; (iv) cell number was counted using the ViCell XR cell counter, integrated into CompacT SelecT; (v) cell suspension containing 525,000 cells was transferred into a new culture flask (seeding density 3000 cells/cm²); (vi) growth medium was added to the new flask to reach the final volume of 30 mL. Cells were incubated in CO₂-incubator (Sanyo/Panasonic, Moriguchi, Osaka, Japan) at 37°С, 5% CO₂.

Automated HDFs subculture protocol

The sequence of CompacT SelecT automated protocol operations is presented in Fig. 2.

Secretory products assay

Spent medium samples were collected from flasks before subculturing, centrifuged at 6800g for 10 min and stored at -20°С until further analysis. Quantitative ELISA assay was used to evaluate the levels of IL-6 (Interleukin-6-ELISA-BEST №А8768, Vector-Best, Novosibirsk, Russia), IL-8/CXCL8 (Interleukin8-ELISA-BEST №А8762, Vector-Best, Russia) and α1 chain of procollagen I (Human Pro-Collagen I alpha 1 DuoSet ELISA №DY6220-05, R&D Systems, Minneapolis, MN, USA). The assays were performed according to the manufacturer’s protocols.

HDFs adhesion and growth in T175 flasks from different manufacturers

The operations were performed in CompacT SelecT using a modified protocol for automated subculturing. For cell adhesion assay, HDFs were seeded at a density of 8000 cells/cm² into the flasks and incubated in CompacT SelecT СО₂-incubator (37°С, 5% СО₂) for 18 hours; adherent cells were detached with trypsin and counted automatically by using the shortened version of protocol (Fig. 2) without steps of seeding cells to new flask. To perform proliferation assay, the seeding density was 1500 cells/cm², incubation in CompacT SelecT lasted 6 days with the single medium change on day 3. After 6 days fibroblasts were automatically detached and counted in the same way.

Comparative analysis between manual and automated HDFs cultivation

HDFs after thawing were seeded into Т175 Nunc culture flasks. After reaching 80% confluency of monolayer, cells from all flasks were harvested and seeded into new T175 Nunc flasks, according to scheme in Fig. 3, with the seeding density 3000 cells/cm². Six flasks were loaded into CompacT SelecT for automated cultivation; the other 6 flasks were placed in СО₂-incubator for manual cultivation. Cells were subcultured after 7 days of growth with the single growth medium change on day 4. During subculturing HDFs were seeded from mother flask to daughter flask without mixing cells from different flasks for both manual and automated protocol. HDFs were grown for 4 consecutive passages. Seeding density was always 3000 cells/cm². All operations with manually and automatically processed flasks were synchronized (Fig. 3).

Figure 3. Schematic representation of automated (filled circles) and manual (empty circles) cultivation of human dermal fibroblasts

Statistics

All quantitative values are presented as X±m, where m is the standard error of the mean X. The relative standard deviation (RSD) was calculated as a ratio of standard deviation of the value to its mean X. The statistical significance of differences between 2 groups was analyzed by non-parametric Mann-Whitney U-test, for pairwise comparison of 3 groups the non-parametric variant of Newman-Keuls test was used. Statistical analysis was performed using MS Excel 2010 and STATISTICA 6.0. The level of statistical significance was set at p<0.05. All experiments were performed in six replicates.

Results

Selection of Т175 cell culture flasks for HDFs automated cultivation

In the first series of experiments the culture flasks which are the most suitable for the automated HDFs cultivation were selected. CompacT SelecT software allows to use Т175 flasks from three manufacturers: (i) Nunc (Denmark), № 178983; (ii) Corning (USA), № 431306; and (iii) Becton Dickinson (BD) (USA), № 353118. The percentage of adhered HDFs and their proliferation on these types of flasks were measured using CompacT SelecT platform.

The variations in the percentage of adhered cells between all types of flasks were not statistically significant (p>0.05) (Table 1). At the same time, HDFs, grown in Corning flasks, showed the lowest ratio of monolayer density / seeding density, while the differences between BD and Nunc flasks were not statistically significant (p>0.05). Hence, BD and Nunc T175 flasks proved to be the most suitable for HDFs manufacturing in CompacT SelecT. To conduct a comparative analysis of manual and automated HDFs cultivation, we have used Nunc flasks.

Table 1. HDFs adhesion and proliferation on three types of T175 culture flasks (Nunc, BD, Corning), appropriate for CompacT SelecT

Automated and manual cultivation: cell morphology and proliferation

In the next series of experiments, we compared morphology, proliferation and secretory activity of HDFs, cultivated in Т175 Nunc culture flasks manually and automatically in CompacT SelecT. The manual and automated protocols contained similar sets of operations. CompacT SelecT is not designed to use the centrifuge. For this reason, in both protocols following cell detachment, trypsin was neutralized by the dilution with growth medium.

The cells grown manually and automatically had the typical fibroblast-like shape without any differences in their shape (Fig. 4). Besides, in both cases cells were distributed on culture plastic surface rather evenly, without the formation of large aggregates. This indicates that the protocol for automated cell cultivation provides the even mixing of cells in suspension after their detachment from plastic surface by trypsin.

Figure 4. HDFs shape at automatic and manual cultivation modes, passage 2

The comparison of HDF sizes (cell diameters in suspension) also did not reveal significant differences between manual and automated cell cultivation at all four passages (Fig. 5).

The cell viability was 97% or higher at all the passages. At the 2^nd and 3^rd passages the viability of automatically cultivated cells was statistically higher than that of manually grown cells (p<0.05), however, that difference was less than 1% and hence can be considered negligible (Fig. 5).

The HDF monolayer densities are presented in Fig. 6. The cell yields demonstrated the tendency of decreasing from the 1st to the last passage, which is obviously due to the aging of culture. At all of the four passages the average quantity of automatically grown cells was 1.25-1.5 times higher than of that of cells grown manually (p<0.01).

The technical flask-to-flask variations of cell diameter and cell number for both cell processing techniques are presented in Fig. 7. The RSD in cell density fell in the range from 0.047 to 0.130 for automated culturing and from 0.097 to 0.185 for manual culturing; the RSD in cell diameter ranged from 0.0019 to 0.0038 and from 0.0020 to 0.0053 for automated and manual culturing, respectively. At all the passages, the RSDs in cell diameter and cell number for automated protocol were lower in comparison with the data for manual protocol.

Figure 6. HDF densities in flasks during four passages: automated and manual procedures are shown by solid and dotted lines, respectively. Differences between automated and manual cultivation were statistically significant at all four passages (p<0.01)

Figure 7. The RSD in cell diameter (lower lines with triangle markers) and in cell monolayer density (upper lines with square markers) of HDFs grown automatically (solid lines) and manually (dotted lines)

Automated and manual cultivation: cell secretion assay

The paracrine function of HDFs was estimated by the quantity of secreted interleukin-6 (IL-6) and interleukin-8 (IL-8/CXCL8) per 10⁶ cells. The concentration of IL-8 was 1.5-3 times higher for manual cultivation in comparison to the automated mode at all passages. The quantity of IL-6 was also higher for the manual cell cultivation albeit the differences observed were less significant (maximum 1.8 times) (Table 2).

The pro-collagen Iα assay was used to estimate the synthesis of extracellular matrix (ECM) components by HDFs. As with cytokines, the quantity of pro-collagen secreted by manually grown cells was higher than that recorded in the case with automatically cultivated cells. The differences between the two modes were statistically significant at 1, 3 and 4 passages (Table 2).

Table 2. Secretion of cytokines (IL-6, IL-8) and pro-collagen I α-chain by HDFs. Statistically significant (p<0.05) differences between manual and automatic cultivation are indicated by bold underlined font

Discussion

The procedure of obtaining fibroblasts for autologous therapy consists of 3 main steps: (i) isolation of primary fibroblasts culture, (ii) expansion of cells and (iii) preparation of cells for clinical usage and / or cryopreservation of cell yield. The technical characteristics of CompacT SelecT allow its use for the automation of step 2. We developed the protocol to cultivate human skin fibroblasts using CompacT SelecT robotic station and imitated its application for the scale-out cultivation of autologous cells which can be further applied in clinical practice.

Automation of cell cultivation processes allows to standardize and multiply cell cultivation and to overcome the problems of manual operations with cells related to individual features of operator skills and possible missteps occurring during work [13, 14, 15]. Thus, it is expected that automated cultivation would reduce the flask-to-flask variations resulting in more homogenous and standardized cell yield.

In this study, we demonstrated the possibility of long-term automated scale-out manufacturing of HDFs applied in autologous cell therapy using CompacT SelecT. Cells were successfuly subcultured for 4 passages, in the first 3 passages (7-10)×10⁶ cells per flask were obtained. Thus, manufacturing the batch of 10⁸ HDFs for the patient requires harvesting cells from about 15 flasks. Using the seeding density of 3000 cells/cm² (applied in this study) allows the production of such HDFs batch after 1-2 passages from a single T175 flask. CompacT SelecT platform is capable of handling up to 90 flasks simultaneously, which is sufficient to process up to 8 batches in parallel (starting batches processing at different time and using more sophisticated types of flasks can increase this number).

We have also compared the manual and automated methods of cell cultivation. The automated protocol repeated the basic steps of manual protocol. With the both modes having been applied, trypsin was neutralized by dilution with serum containing growth media, hence, the differences in the data obtained after studying of two cultivation modes cannot be explained by different ways of trypsin removal. The comparison demonstrated similarity in cell shape, cell size and viability of manually and automatically processed HDFs cultures. However, the cell yield on robotic platform was significantly higher at all passages.

The quantities of cells grown manually and using CompacT SelecT platform were analyzed in other studies. The results of such studies varied: the yield of human MSCs [7] and HOS cells [11] was greater in manual culture, while the human iPSC-derived neuroepithelial-like stem cells [8] had more population doublings when grown automatically. On the other hand, the growth profiles of manual and automated neural stem cells (CTX0E03) cultures were almost identical [16]. These findings are not surprizing. They may be due to significant discrepancies between manual and automated protocols. Firstly, in manual protocols of all these studies, trypsin was discarded by centrifugation, while in automated protocols it was either diluted by growth medium or neutralized and dumped after cells adhered to plastic. The different ways of trypsin neutralization could significantly affect cell proliferation. Secondly, CompacT SelecT robotic arm imitates the work of human operator in laminar flow hood, but the development of protocol for automated cell cultivation is limited by manipulations performed by the machine and by the inability to monitor cells during protocol execution. For example, one of the most significant problems was the high rate of cell aggregation after detachment with trypsin. The aggregates were ineffectively broken by CompacT SelecT pipette, which inevitably affected the cell yield. The same problem was observed in other researches [17]. High cell aggregation rate is most probably due to the prolonged incubation in trypsin during the protocol run, since the inability to control cell detachment requires the increase in trypsinization time. In our protocol, this problem was solved by using the complicated scheme of mixing of trypsinized fibroblasts with growth medium. The quantity of cells obtained in automated platform greatly depends on the design of the protocol and its fitness for cell culture [18, 19]. Hence, the evaluation of advantages/disadvantages of the automated/manual cell cultivation using the data on the cell yield from various studies must be done with caution.

The clinical effect of transplanted fibroblasts is mostly due to the synthesis of ECM components [20, 21] and to the paracrine secretion of growth factors and cytokines affecting the migration and proliferation of patient skin cells [22, 23]. IL-6 is involved in both pro- and antiinflammatory activities, but it also stimulates the proliferation of keratinocytes [24]. Apart from inducing chemotaxis in neutrophils, IL-8/CXCL8 is a pro-angiogenic factor [25]. The concentration of these cytokines tended to grow from the first to the last passage at the both types of HDFs culture techniques used, which was most likely caused by the progressive approaching of cells to senescent phenotype [26, 27]. Though it should be noted that automatically cultured HDFs produced lower amounts of both cytokines and pro-collagen I (per 10⁶ cells) than cells cultured manually. This may be due to the difference in cell monolayer density in flasks processed manually and automatically: in some researches fibroblasts with higher monolayer density secreted lower levels of cytokines and collagen per cell [28, 29, 30].

A higher reproducibility of automated operations in scale-out manufacturing of cells is expected to provide a higher uniformity of cells phenotype and cell yields for different flasks from the batch. We compared the flask-to-flask variation of HDFs cell diameter and cell yield. In all four passages, the RSD in cell monolayer density and RSD in cell diameter were lower in the case of automated process. The RSD data showed that flask-to-flask variations of cell size and cell yield for automated culturing were less apparent, which supports a higher consistency of automated HDFs manufacturing.

Conclusion

The automation of scale-out cultivation of cells for clinical applications is one of significant challenges in regenerative medicine. In this study, we demonstrated a successful long-term cultivation of HDFs in the CompacT SelecT robotic platform. Cells, manufactured automatically, preserved the typical fibroblast-like shape, high proliferation activity and the capability to produce cytokines and pro-collagen. Comparison of manual and automated cultivation confirmed a higher uniformity of cell yield after automated manufacturing.

This work has been funded by Institute of Medical Cell Technologies.

Conflicts of interest

The authors declare no conflict of interest.

References

1. Simaria AS, Hassan S, Varadaraju H, Rowley J, Warren K, Vanek P, Farid SS. Allogeneic cell therapy bioprocess economics and optimization: single-use cell expansion technologies. Biotechnol Bioeng. 2014; 111(1):69-83. doi: 10.1002/bit.25008
2. De Chiara ML, Tuche FA, de Mendonça FR. 2020. Autologous fibroblasts injections in face. In: A. Da Costa (eds.) Minimally Invasive Aesthetic Procedures. Springer, Cham, Switzerland. P. 705-710. doi: 10.1007/978-3-319-78265-2_99
3. Zorin VL, Zorinа AI, Kopnin PB, Kantserov SZ, Isaev AA. Autologous dermal fibroblasts for the correction of age-related skin changes (SPRS-therapy®). Results of 2-year clinical trials and post-marketing clinical studies. CellR4. 2016; 4(3): e2084.
4. Munavalli GS, Smith S, Maslowski JM, Weiss RA. Successful treatment of depressed, distensible acne scars using autologous fibroblasts: a multi-site, prospective, double blind, placebo-controlled clinical trial. Dermatol Surg. 2013; 39(8): 1226-1236.
   doi: 10.1111/dsu.12204
5. Yeh SW, Huang M.-Y. Autologous fibroblast therapy of the scar: A preclinical report. Dermatol Sinica. 2013; 31: 159-160.
   doi: 10.1016/j.dsi.2012.10.007
6. Archibald PRT, Chandra A, Thomas D, Morley G, Lekishvili T, Devonshire A, Williams DJ. Comparability of scalable, automated hMSC culture using manual andautomated process steps. Biochem. Engineering J. 2016; 108:69-83. doi: 10.1016/j.bej.2015.07.001
7. Thomas RJ, Chandra A, Liu Y, Hourd PC, Conway PP, Williams DJ. Manufacture of a human mesenchymal stem cell population using an automated cell culture platform. Cytotechnology. 2007. 55: 31-39. doi: 10.1007/s10616-007-9091-2
8. McLaren D, Gorba T, de Rotrou AM, Pillai G, Chappell C, Stacey A, et al. Automated large-scale culture and medium-throughput chemical screen for modulators of proliferation and viability of human induced pluripotent stem cell-derived neuroepithelial-like stem cells. J Biomol Screen. 2013. 18(3): 258-268. doi: 10.1177/1087057112461446
9. Soares FA, Chandra A, Thomas RJ, Pedersen RA, Vallier L, Williams DJ. Investigating the feasibility of scale up and automation of human induced pluripotent stem cells cultured in aggregates in feeder free conditions. J Biotechnol. 2014 Mar 10;173(100):53-58.
   doi: 10.1016/j.jbiotec.2013.12.009
10. Thomas RJ, Anderson D, Chandra A, Smith NM, Young LE, Williams D, Denning C. Automated, scalable culture of human embryonic stem cells in feeder-free conditions. Biotechnol Bioeng. 2009; 102(6):1636-1644. doi: 10.1002/bit.22187
11. Liu Y, Hourd P, Chandra A, Williams DJ. Human cell culture process capability: a comparison of manual and automated production.
    J Tissue Eng Regen Med. 2010;4(1):45-54. doi: 10.1002/term.217
12. Zhao Y, Bishop B, Clay JE, Lu W, Jones M, Daenke S, et al. Automation of large scale transient protein expression in mammalian cells. J Struct Biol. 2011;175(2):209-215. doi: 10.1016/j.jsb.2011.04.017
13. Daniszewski M, Crombie DE, Henderson R, Liang HH, Wong RCB, Hewitt AW, Pébay A. Automated Cell Culture Systems and Their Applications to Human Pluripotent Stem Cell Studies. SLAS Technol. 2018;23(4):315-325. doi: 10.1177/2472630317712220
14. Jung S, Ochs J, Kulik M, König N, Schmitt R. Highly modular and generic control software for adaptive cell processing on automated production platforms. Proc CIRP. 2018; 72; 1245-1250. doi: 10.1016/j.procir.2018.03.189
15. Tristan CA, Ormanoglu P, Slamecka J, Malley C, Chu PH, Jovanovic VM, Gedik Y, Bonney C, Barnaeva E, Braisted J, Mallanna SK, Dorjsuren D, Iannotti MJ, Voss TC, Michael S, Simeonov A, Singeç I. Robotic High-Throughput Biomanufacturing and Functional Differentiation of Human Pluripotent Stem Cells. bioRxiv [Preprint]. 2020 Aug 3:2020.08.03.235242. doi: 10.1101/2020.08.03.235242
16. Thomas RJ, Hope AD, Hourd P, Baradez M, Miljan EA, Sinden JD, Williams DJ. Automated, serum-free production of CTX0E03:
    a therapeutic clinical grade human neural stem cell line. Biotechnol Lett. 2009; 31(8):1167-72. doi: 10.1007/s10529-009-9989-1
17. Shariatzadeh M, Chandra A, Wilson SL, McCall MJ, Morizur L, Lesueur L, et al. Distributed automated manufacturing of pluripotent stem cell products. Int. J. Adv. Manuf. Technol. 2020. 106(3):1085-1103. doi: 10.1007/s00170-019-04516-1
18. Ferreira MV, Jahnen-Dechent W, Neuss S. Standardization of automated cell-based protocols for toxicity testing of biomaterials.
    J Biomol Screen. 2011; 16(6): 647-654. doi: 10.1177/1087057111405380
19. Doulgkeroglou MN, Di Nubila A, Niessing B, König N, Schmitt RH, Damen J, Szilvassy AJ, Chang W, Csontos L, Louis S, Kugelmeier P, Ronfard V, Bayon Y, Zeugolis DI. Automation, Monitoring, and Standardization of Cell Pro-duct Manufacturing. Front Bioeng Biotechnol. 2020. 8:811. doi: 10.3389/fbioe.2020.00811
20. Wong T, McGrath JA, Navsaria H. The role of fibroblasts in tissue engineering and regeneration. Br. J. Dermatol. 2007;156:1149-1155. doi: 10.1111/j.1365-2133.2007.07914.x
21. Kouhbananinejad SM, Arminm F, Dabiri S, Derakhshani A, Iranpour M, Farsinejad A. Application and assessment of allogeneic fibroblasts for cell therapy. Iran J Pathol. 2018; 13(4): 454-460. PMID: 30774685
22. Singer AJ, Simon MWound healing and skin substitutes. pp. 375-393. In: A. Battler, and J. Leor (eds). Stem Cell and Gene-Based Therapy. 2006. Springer-Verlag, London, UK.
23. Thangapazham RL, Darling TN, Meyerle J. Alteration of skin properties with autologous dermal fibroblasts. Int J Mol Sci. 2014. 15: 8407-8427. doi: 10.3390/ijms15058407
24. Werner S, Krieg T, Smola H. Keratinocyte-fibroblast interactions in wound healing. J. Invest. Dermatol. 2007. 127(5): 998-1008.
    doi: 10.1038/sj.jid.5700786
25. Wojtowicz AM, Oliveira S, Carlson MW, Zawadzka A, Rousseau CF, Baksh D. The importance of both fibroblasts and keratinocytes in a bilayered living cellular construct used in wound healing. Wound Repair Regen. 2014. 22(2): 246-255. doi: 10.1111/wrr.12154
26. Coppé JP, Desprez PY, Krtolica A, Campisi J. The senescence-associated secretory phenotype: the dark side of tumor suppression. Annu Rev Pathol. 2010; 5: 99-118. doi: 10.1146/annurev-pathol-121808-102144
27. Sapochnik M, Fuertes M, Arzt E. Programmed cell senescence: role of IL-6 in the pituitary. J Mol Endocrinol. 2017; 58(4): R241-R253. doi: 10.1530/JME-17-0026
28. Olgart C, Frossard N. Human lung fibroblasts secrete nerve growth factor: effect of inflammatory cytokines and glucocorticoids. Eur Respir J. 2001; 18(1): 115-121. doi: 10.1183/09031936.01.00069901
29. Masur SK, Dewal HS, Dinh TT, Erenburg I, Petridou S. Myofibroblasts differentiate from fibroblasts when plated at low density. Proc Natl Acad Sci. USA. 1996; 93(9): 4219-4223. doi: 10.1073/pnas.93.9.4219
30. Aumailley M, Krieg T, Razaka G, Müller PK, Bricaud H. Influence of cell density on collagen biosynthesis in fibroblast cultures. Biochem J. 1982; 206(3): 505-510. doi: 10.1042/bj2060505

" ["DETAIL_TEXT_TYPE"]=> string(4) "html" ["~DETAIL_TEXT_TYPE"]=> string(4) "html" ["PREVIEW_TEXT"]=> string(0) "" ["~PREVIEW_TEXT"]=> string(0) "" ["PREVIEW_TEXT_TYPE"]=> string(4) "text" ["~PREVIEW_TEXT_TYPE"]=> string(4) "text" ["PREVIEW_PICTURE"]=> NULL ["~PREVIEW_PICTURE"]=> NULL ["LANG_DIR"]=> string(4) "/ru/" ["~LANG_DIR"]=> string(4) "/ru/" ["SORT"]=> string(2) "10" ["~SORT"]=> string(2) "10" ["CODE"]=> string(100) "vyrashchivanie-fibroblastov-kozhi-cheloveka-s-ispolzovaniem-robotizirovannoy-sistemy-sravnenie-tekhn" ["~CODE"]=> string(100) "vyrashchivanie-fibroblastov-kozhi-cheloveka-s-ispolzovaniem-robotizirovannoy-sistemy-sravnenie-tekhn" ["EXTERNAL_ID"]=> string(4) "2064" ["~EXTERNAL_ID"]=> string(4) "2064" ["IBLOCK_TYPE_ID"]=> string(7) "journal" ["~IBLOCK_TYPE_ID"]=> string(7) "journal" ["IBLOCK_CODE"]=> string(7) "volumes" ["~IBLOCK_CODE"]=> string(7) "volumes" ["IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["~IBLOCK_EXTERNAL_ID"]=> string(1) "2" ["LID"]=> string(2) "s2" ["~LID"]=> string(2) "s2" ["EDIT_LINK"]=> NULL ["DELETE_LINK"]=> NULL ["DISPLAY_ACTIVE_FROM"]=> string(0) "" ["IPROPERTY_VALUES"]=> array(18) { ["ELEMENT_META_TITLE"]=> string(282) "Выращивание фибробластов кожи человека с использованием роботизированной системы: сравнение технологий ручного и автоматизированного культивирования" ["ELEMENT_META_KEYWORDS"]=> string(0) "" ["ELEMENT_META_DESCRIPTION"]=> string(412) "Выращивание фибробластов кожи человека с использованием роботизированной системы: сравнение технологий ручного и автоматизированного культивированияScale-out cultivation of human dermal fibroblasts using robotic cell culture system: comparison of manual and automated processing" ["ELEMENT_PREVIEW_PICTURE_FILE_ALT"]=> string(2373) "<p style="text-align: justify;">Автоматизация культивирования клеток позволяет решить вопросы стандартизации, воспроизводимости и снижения себестоимости данного технологического процесса при получении клеточной культуры для терапевтического применения. В данной работе был разработан протокол автоматизированного культивирования фибробластов кожи человека с использованием роботизированной станции CompacT SelecT и проведено сравнение морфологии, скорости пролиферации, жизнеспособности и секреторной активности фибробластов, выращиваемых вручную и в автоматическом режиме. Автоматизация процесса культивирования не оказала негативного влияния на скорость пролиферации фибробластов, но при этом обеспечивала большую стабильность, как объемов клеточного урожая, так и морфологических характеристик клеток. Таким образом, применение роботизированной станции позволяет масштабировать производство фибробластов. Технология автоматизированного культивирования клеток может находить применение в различных областях, в том числе, для получения фибробластов, используемых в регенеративной медицине.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Культивирование клеток, автоматизированная система, фибробласты кожи, пролиферация клеток, масштабирование производства.</p>" ["ELEMENT_PREVIEW_PICTURE_FILE_TITLE"]=> string(282) "Выращивание фибробластов кожи человека с использованием роботизированной системы: сравнение технологий ручного и автоматизированного культивирования" ["ELEMENT_DETAIL_PICTURE_FILE_ALT"]=> string(282) "Выращивание фибробластов кожи человека с использованием роботизированной системы: сравнение технологий ручного и автоматизированного культивирования" ["ELEMENT_DETAIL_PICTURE_FILE_TITLE"]=> string(282) "Выращивание фибробластов кожи человека с использованием роботизированной системы: сравнение технологий ручного и автоматизированного культивирования" ["SECTION_META_TITLE"]=> string(282) "Выращивание фибробластов кожи человека с использованием роботизированной системы: сравнение технологий ручного и автоматизированного культивирования" ["SECTION_META_KEYWORDS"]=> string(282) "Выращивание фибробластов кожи человека с использованием роботизированной системы: сравнение технологий ручного и автоматизированного культивирования" ["SECTION_META_DESCRIPTION"]=> string(282) "Выращивание фибробластов кожи человека с использованием роботизированной системы: сравнение технологий ручного и автоматизированного культивирования" ["SECTION_PICTURE_FILE_ALT"]=> string(282) "Выращивание фибробластов кожи человека с использованием роботизированной системы: сравнение технологий ручного и автоматизированного культивирования" ["SECTION_PICTURE_FILE_TITLE"]=> string(282) "Выращивание фибробластов кожи человека с использованием роботизированной системы: сравнение технологий ручного и автоматизированного культивирования" ["SECTION_PICTURE_FILE_NAME"]=> string(100) "vyrashchivanie-fibroblastov-kozhi-cheloveka-s-ispolzovaniem-robotizirovannoy-sistemy-sravnenie-tekhn" ["SECTION_DETAIL_PICTURE_FILE_ALT"]=> string(282) "Выращивание фибробластов кожи человека с использованием роботизированной системы: сравнение технологий ручного и автоматизированного культивирования" ["SECTION_DETAIL_PICTURE_FILE_TITLE"]=> string(282) "Выращивание фибробластов кожи человека с использованием роботизированной системы: сравнение технологий ручного и автоматизированного культивирования" ["SECTION_DETAIL_PICTURE_FILE_NAME"]=> string(100) "vyrashchivanie-fibroblastov-kozhi-cheloveka-s-ispolzovaniem-robotizirovannoy-sistemy-sravnenie-tekhn" ["ELEMENT_PREVIEW_PICTURE_FILE_NAME"]=> string(100) "vyrashchivanie-fibroblastov-kozhi-cheloveka-s-ispolzovaniem-robotizirovannoy-sistemy-sravnenie-tekhn" ["ELEMENT_DETAIL_PICTURE_FILE_NAME"]=> string(100) "vyrashchivanie-fibroblastov-kozhi-cheloveka-s-ispolzovaniem-robotizirovannoy-sistemy-sravnenie-tekhn" } ["FIELDS"]=> array(1) { ["IBLOCK_SECTION_ID"]=> string(3) "214" } ["PROPERTIES"]=> array(18) { ["KEYWORDS"]=> array(36) { ["ID"]=> string(2) "19" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:46:01" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(27) "Ключевые слова" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "KEYWORDS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "19" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "4" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "Y" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "Y" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(27) "Ключевые слова" ["~DEFAULT_VALUE"]=> string(0) "" } ["SUBMITTED"]=> array(36) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28674" ["VALUE"]=> string(22) "06/20/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "06/20/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL } ["ACCEPTED"]=> array(36) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28675" ["VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL } ["PUBLISHED"]=> array(36) { ["ID"]=> string(2) "22" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Дата публикации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "PUBLISHED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "22" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Дата публикации" ["~DEFAULT_VALUE"]=> NULL } ["CONTACT"]=> array(36) { ["ID"]=> string(2) "23" ["TIMESTAMP_X"]=> string(19) "2015-09-03 14:43:05" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(14) "Контакт" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "CONTACT" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "23" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(14) "Контакт" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHORS"]=> array(36) { ["ID"]=> string(2) "24" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:45:07" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "AUTHORS" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "E" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "Y" ["XML_ID"]=> string(2) "24" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "3" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(13) "EAutocomplete" ["USER_TYPE_SETTINGS"]=> array(9) { ["VIEW"]=> string(1) "E" ["SHOW_ADD"]=> string(1) "Y" ["MAX_WIDTH"]=> int(0) ["MIN_HEIGHT"]=> int(24) ["MAX_HEIGHT"]=> int(1000) ["BAN_SYM"]=> string(2) ",;" ["REP_SYM"]=> string(1) " " ["OTHER_REP_SYM"]=> string(0) "" ["IBLOCK_MESS"]=> string(1) "N" } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> bool(false) ["VALUE"]=> bool(false) ["DESCRIPTION"]=> bool(false) ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> bool(false) ["~DESCRIPTION"]=> bool(false) ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_RU"]=> array(36) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28676" ["VALUE"]=> array(2) { ["TEXT"]=> string(129) "<p>Федор А. Фадеев, Даяна В. Седнева-Луговец, Оксана В. Мадиярова</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(117) "

Федор А. Фадеев, Даяна В. Седнева-Луговец, Оксана В. Мадиярова

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_RU"]=> array(36) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28677" ["VALUE"]=> array(2) { ["TEXT"]=> string(138) "<p>Институт медицинских клеточных технологий, Екатеринбург, Россия</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(126) "

Институт медицинских клеточных технологий, Екатеринбург, Россия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_RU"]=> array(36) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28678" ["VALUE"]=> array(2) { ["TEXT"]=> string(2373) "<p style="text-align: justify;">Автоматизация культивирования клеток позволяет решить вопросы стандартизации, воспроизводимости и снижения себестоимости данного технологического процесса при получении клеточной культуры для терапевтического применения. В данной работе был разработан протокол автоматизированного культивирования фибробластов кожи человека с использованием роботизированной станции CompacT SelecT и проведено сравнение морфологии, скорости пролиферации, жизнеспособности и секреторной активности фибробластов, выращиваемых вручную и в автоматическом режиме. Автоматизация процесса культивирования не оказала негативного влияния на скорость пролиферации фибробластов, но при этом обеспечивала большую стабильность, как объемов клеточного урожая, так и морфологических характеристик клеток. Таким образом, применение роботизированной станции позволяет масштабировать производство фибробластов. Технология автоматизированного культивирования клеток может находить применение в различных областях, в том числе, для получения фибробластов, используемых в регенеративной медицине.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Культивирование клеток, автоматизированная система, фибробласты кожи, пролиферация клеток, масштабирование производства.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(2317) "

Автоматизация культивирования клеток позволяет решить вопросы стандартизации, воспроизводимости и снижения себестоимости данного технологического процесса при получении клеточной культуры для терапевтического применения. В данной работе был разработан протокол автоматизированного культивирования фибробластов кожи человека с использованием роботизированной станции CompacT SelecT и проведено сравнение морфологии, скорости пролиферации, жизнеспособности и секреторной активности фибробластов, выращиваемых вручную и в автоматическом режиме. Автоматизация процесса культивирования не оказала негативного влияния на скорость пролиферации фибробластов, но при этом обеспечивала большую стабильность, как объемов клеточного урожая, так и морфологических характеристик клеток. Таким образом, применение роботизированной станции позволяет масштабировать производство фибробластов. Технология автоматизированного культивирования клеток может находить применение в различных областях, в том числе, для получения фибробластов, используемых в регенеративной медицине.

Ключевые слова

Культивирование клеток, автоматизированная система, фибробласты кожи, пролиферация клеток, масштабирование производства.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["DOI"]=> array(36) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28679" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-63-71" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-63-71" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" } ["AUTHOR_EN"]=> array(36) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28682" ["VALUE"]=> array(2) { ["TEXT"]=> string(84) "<p>Fedor A. Fadeyev, Dayana V. Sedneva-Lugovets, Oksana V. Madyarova</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(72) "

Fedor A. Fadeyev, Dayana V. Sedneva-Lugovets, Oksana V. Madyarova

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["ORGANIZATION_EN"]=> array(36) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28683" ["VALUE"]=> array(2) { ["TEXT"]=> string(651) "<p>Institute of Medical Cell Technologies, Ekaterinburg, Russia</p><br> <p><b>Correspondence:</b><br> Dr. Fedor A. Fadeyev, Institute of Medical Cell Technologies. 22A Karl Marx St., 620026, Ekaterinburg, Russia<br> Phone: +7 (912) 618-24-97<br> Fax: +7 (343) 355-62-42<br> E-mail: fdf79@mail.ru</p><br> <p><b>Citation:</b> Fadeyev FA, Sedneva-Lugovets DV, Madyarova OV. Scale-out cultivation of human dermal fibroblasts using robotic cell culture system: comparison of manual and automated processing. Cell Ther Transplant 2022; 11(2): 63-71.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(555) "

Institute of Medical Cell Technologies, Ekaterinburg, Russia

Correspondence:
Dr. Fedor A. Fadeyev, Institute of Medical Cell Technologies. 22A Karl Marx St., 620026, Ekaterinburg, Russia
Phone: +7 (912) 618-24-97
Fax: +7 (343) 355-62-42
E-mail: fdf79@mail.ru

Citation: Fadeyev FA, Sedneva-Lugovets DV, Madyarova OV. Scale-out cultivation of human dermal fibroblasts using robotic cell culture system: comparison of manual and automated processing. Cell Ther Transplant 2022; 11(2): 63-71.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["SUMMARY_EN"]=> array(36) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28684" ["VALUE"]=> array(2) { ["TEXT"]=> string(1141) "<p style="text-align: justify;">Automation of cell cultivation process allows solving the problems of standardization, reproducibility and cost effectiveness of the large scale manufacturing of cell-based therapy products. In this study we established the protocol for automated (employing CompacT SelecT cell culture platform) <i>in vitro</i> expansion of human dermal fibroblasts (here forth, HDFs). We have conducted a series of assays aimed to compare cell morphology, proliferation, viability and secretory activity of human HDFs under manual and automated cell cultivation strategies. Automation of cell cultivation did not have negative impact on HDFs proliferation and provided the higher uniformity of cell yield. Our data indicate that CompacT SelecT is suitable for scale-out HDFs manufacturing and has the potential to be used for various applications, including fibroblast-based regeneration therapies.</p> <h2>Keywords</h2> <p style="text-align: justify;">Сell culture, automated system, dermal fibroblasts, cell proliferation, scale-out manufacturing.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1073) "

Automation of cell cultivation process allows solving the problems of standardization, reproducibility and cost effectiveness of the large scale manufacturing of cell-based therapy products. In this study we established the protocol for automated (employing CompacT SelecT cell culture platform) in vitro expansion of human dermal fibroblasts (here forth, HDFs). We have conducted a series of assays aimed to compare cell morphology, proliferation, viability and secretory activity of human HDFs under manual and automated cell cultivation strategies. Automation of cell cultivation did not have negative impact on HDFs proliferation and provided the higher uniformity of cell yield. Our data indicate that CompacT SelecT is suitable for scale-out HDFs manufacturing and has the potential to be used for various applications, including fibroblast-based regeneration therapies.

Keywords

Сell culture, automated system, dermal fibroblasts, cell proliferation, scale-out manufacturing.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["NAME_EN"]=> array(36) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28680" ["VALUE"]=> string(130) "Scale-out cultivation of human dermal fibroblasts using robotic cell culture system: comparison of manual and automated processing" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(130) "Scale-out cultivation of human dermal fibroblasts using robotic cell culture system: comparison of manual and automated processing" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" } ["FULL_TEXT_RU"]=> array(36) { ["ID"]=> string(2) "42" ["TIMESTAMP_X"]=> string(19) "2015-09-07 20:29:18" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(23) "Полный текст" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(12) "FULL_TEXT_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "42" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(23) "Полный текст" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } } ["PDF_RU"]=> array(36) { ["ID"]=> string(2) "43" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF RUS" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_RU" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "43" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28681" ["VALUE"]=> string(4) "2865" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2865" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF RUS" ["~DEFAULT_VALUE"]=> string(0) "" } ["PDF_EN"]=> array(36) { ["ID"]=> string(2) "44" ["TIMESTAMP_X"]=> string(19) "2015-09-09 16:05:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(7) "PDF ENG" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(6) "PDF_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "F" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "44" ["FILE_TYPE"]=> string(18) "doc, txt, rtf, pdf" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28685" ["VALUE"]=> string(4) "2866" ["DESCRIPTION"]=> NULL ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(4) "2866" ["~DESCRIPTION"]=> NULL ["~NAME"]=> string(7) "PDF ENG" ["~DEFAULT_VALUE"]=> string(0) "" } ["NAME_LONG"]=> array(36) { ["ID"]=> string(2) "45" ["TIMESTAMP_X"]=> string(19) "2023-04-13 00:55:00" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(72) "Название (для очень длинных заголовков)" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "NAME_LONG" ["DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "45" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(80) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> NULL ["VALUE"]=> string(0) "" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(0) "" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(72) "Название (для очень длинных заголовков)" ["~DEFAULT_VALUE"]=> array(2) { ["TYPE"]=> string(4) "HTML" ["TEXT"]=> string(0) "" } } } ["DISPLAY_PROPERTIES"]=> array(10) { ["AUTHOR_EN"]=> array(37) { ["ID"]=> string(2) "37" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(6) "Author" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "37" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28682" ["VALUE"]=> array(2) { ["TEXT"]=> string(84) "<p>Fedor A. Fadeyev, Dayana V. Sedneva-Lugovets, Oksana V. Madyarova</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(72) "

Fedor A. Fadeyev, Dayana V. Sedneva-Lugovets, Oksana V. Madyarova

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(6) "Author" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(72) "

Fedor A. Fadeyev, Dayana V. Sedneva-Lugovets, Oksana V. Madyarova

" } ["SUMMARY_EN"]=> array(37) { ["ID"]=> string(2) "39" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Description / Summary" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "39" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28684" ["VALUE"]=> array(2) { ["TEXT"]=> string(1141) "<p style="text-align: justify;">Automation of cell cultivation process allows solving the problems of standardization, reproducibility and cost effectiveness of the large scale manufacturing of cell-based therapy products. In this study we established the protocol for automated (employing CompacT SelecT cell culture platform) <i>in vitro</i> expansion of human dermal fibroblasts (here forth, HDFs). We have conducted a series of assays aimed to compare cell morphology, proliferation, viability and secretory activity of human HDFs under manual and automated cell cultivation strategies. Automation of cell cultivation did not have negative impact on HDFs proliferation and provided the higher uniformity of cell yield. Our data indicate that CompacT SelecT is suitable for scale-out HDFs manufacturing and has the potential to be used for various applications, including fibroblast-based regeneration therapies.</p> <h2>Keywords</h2> <p style="text-align: justify;">Сell culture, automated system, dermal fibroblasts, cell proliferation, scale-out manufacturing.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(1073) "

Automation of cell cultivation process allows solving the problems of standardization, reproducibility and cost effectiveness of the large scale manufacturing of cell-based therapy products. In this study we established the protocol for automated (employing CompacT SelecT cell culture platform) in vitro expansion of human dermal fibroblasts (here forth, HDFs). We have conducted a series of assays aimed to compare cell morphology, proliferation, viability and secretory activity of human HDFs under manual and automated cell cultivation strategies. Automation of cell cultivation did not have negative impact on HDFs proliferation and provided the higher uniformity of cell yield. Our data indicate that CompacT SelecT is suitable for scale-out HDFs manufacturing and has the potential to be used for various applications, including fibroblast-based regeneration therapies.

Keywords

Сell culture, automated system, dermal fibroblasts, cell proliferation, scale-out manufacturing.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Description / Summary" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(1073) "

Automation of cell cultivation process allows solving the problems of standardization, reproducibility and cost effectiveness of the large scale manufacturing of cell-based therapy products. In this study we established the protocol for automated (employing CompacT SelecT cell culture platform) in vitro expansion of human dermal fibroblasts (here forth, HDFs). We have conducted a series of assays aimed to compare cell morphology, proliferation, viability and secretory activity of human HDFs under manual and automated cell cultivation strategies. Automation of cell cultivation did not have negative impact on HDFs proliferation and provided the higher uniformity of cell yield. Our data indicate that CompacT SelecT is suitable for scale-out HDFs manufacturing and has the potential to be used for various applications, including fibroblast-based regeneration therapies.

Keywords

Сell culture, automated system, dermal fibroblasts, cell proliferation, scale-out manufacturing.

" } ["DOI"]=> array(37) { ["ID"]=> string(2) "28" ["TIMESTAMP_X"]=> string(19) "2016-04-06 14:11:12" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(3) "DOI" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(3) "DOI" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "28" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28679" ["VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-63-71" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-63-71" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(3) "DOI" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(38) "10.18620/ctt-1866-8836-2022-11-2-63-71" } ["NAME_EN"]=> array(37) { ["ID"]=> string(2) "40" ["TIMESTAMP_X"]=> string(19) "2015-09-03 10:49:47" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(4) "Name" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(7) "NAME_EN" ["DEFAULT_VALUE"]=> string(0) "" ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "80" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "40" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "Y" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> NULL ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28680" ["VALUE"]=> string(130) "Scale-out cultivation of human dermal fibroblasts using robotic cell culture system: comparison of manual and automated processing" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(130) "Scale-out cultivation of human dermal fibroblasts using robotic cell culture system: comparison of manual and automated processing" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(4) "Name" ["~DEFAULT_VALUE"]=> string(0) "" ["DISPLAY_VALUE"]=> string(130) "Scale-out cultivation of human dermal fibroblasts using robotic cell culture system: comparison of manual and automated processing" } ["ORGANIZATION_EN"]=> array(37) { ["ID"]=> string(2) "38" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:02:59" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Organization" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_EN" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "38" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28683" ["VALUE"]=> array(2) { ["TEXT"]=> string(651) "<p>Institute of Medical Cell Technologies, Ekaterinburg, Russia</p><br> <p><b>Correspondence:</b><br> Dr. Fedor A. Fadeyev, Institute of Medical Cell Technologies. 22A Karl Marx St., 620026, Ekaterinburg, Russia<br> Phone: +7 (912) 618-24-97<br> Fax: +7 (343) 355-62-42<br> E-mail: fdf79@mail.ru</p><br> <p><b>Citation:</b> Fadeyev FA, Sedneva-Lugovets DV, Madyarova OV. Scale-out cultivation of human dermal fibroblasts using robotic cell culture system: comparison of manual and automated processing. Cell Ther Transplant 2022; 11(2): 63-71.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(555) "

Institute of Medical Cell Technologies, Ekaterinburg, Russia

Correspondence:
Dr. Fedor A. Fadeyev, Institute of Medical Cell Technologies. 22A Karl Marx St., 620026, Ekaterinburg, Russia
Phone: +7 (912) 618-24-97
Fax: +7 (343) 355-62-42
E-mail: fdf79@mail.ru

Citation: Fadeyev FA, Sedneva-Lugovets DV, Madyarova OV. Scale-out cultivation of human dermal fibroblasts using robotic cell culture system: comparison of manual and automated processing. Cell Ther Transplant 2022; 11(2): 63-71.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Organization" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(555) "

Institute of Medical Cell Technologies, Ekaterinburg, Russia

Correspondence:
Dr. Fedor A. Fadeyev, Institute of Medical Cell Technologies. 22A Karl Marx St., 620026, Ekaterinburg, Russia
Phone: +7 (912) 618-24-97
Fax: +7 (343) 355-62-42
E-mail: fdf79@mail.ru

Citation: Fadeyev FA, Sedneva-Lugovets DV, Madyarova OV. Scale-out cultivation of human dermal fibroblasts using robotic cell culture system: comparison of manual and automated processing. Cell Ther Transplant 2022; 11(2): 63-71.

" } ["AUTHOR_RU"]=> array(37) { ["ID"]=> string(2) "25" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(12) "Авторы" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "AUTHOR_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "25" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28676" ["VALUE"]=> array(2) { ["TEXT"]=> string(129) "<p>Федор А. Фадеев, Даяна В. Седнева-Луговец, Оксана В. Мадиярова</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(117) "

Федор А. Фадеев, Даяна В. Седнева-Луговец, Оксана В. Мадиярова

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(12) "Авторы" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(117) "

Федор А. Фадеев, Даяна В. Седнева-Луговец, Оксана В. Мадиярова

" } ["SUBMITTED"]=> array(37) { ["ID"]=> string(2) "20" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(21) "Дата подачи" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(9) "SUBMITTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "20" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28674" ["VALUE"]=> string(22) "06/20/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "06/20/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(21) "Дата подачи" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "06/20/2022 12:00:00 am" } ["ACCEPTED"]=> array(37) { ["ID"]=> string(2) "21" ["TIMESTAMP_X"]=> string(19) "2015-09-02 17:21:42" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(25) "Дата принятия" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(8) "ACCEPTED" ["DEFAULT_VALUE"]=> NULL ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "21" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(8) "DateTime" ["USER_TYPE_SETTINGS"]=> NULL ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28675" ["VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> string(22) "07/05/2022 12:00:00 am" ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(25) "Дата принятия" ["~DEFAULT_VALUE"]=> NULL ["DISPLAY_VALUE"]=> string(32) "07/05/2022 12:00:00 am" } ["SUMMARY_RU"]=> array(37) { ["ID"]=> string(2) "27" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(29) "Описание/Резюме" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(10) "SUMMARY_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "27" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28678" ["VALUE"]=> array(2) { ["TEXT"]=> string(2373) "<p style="text-align: justify;">Автоматизация культивирования клеток позволяет решить вопросы стандартизации, воспроизводимости и снижения себестоимости данного технологического процесса при получении клеточной культуры для терапевтического применения. В данной работе был разработан протокол автоматизированного культивирования фибробластов кожи человека с использованием роботизированной станции CompacT SelecT и проведено сравнение морфологии, скорости пролиферации, жизнеспособности и секреторной активности фибробластов, выращиваемых вручную и в автоматическом режиме. Автоматизация процесса культивирования не оказала негативного влияния на скорость пролиферации фибробластов, но при этом обеспечивала большую стабильность, как объемов клеточного урожая, так и морфологических характеристик клеток. Таким образом, применение роботизированной станции позволяет масштабировать производство фибробластов. Технология автоматизированного культивирования клеток может находить применение в различных областях, в том числе, для получения фибробластов, используемых в регенеративной медицине.</p> <h2>Ключевые слова</h2> <p style="text-align: justify;">Культивирование клеток, автоматизированная система, фибробласты кожи, пролиферация клеток, масштабирование производства.</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(2317) "

Автоматизация культивирования клеток позволяет решить вопросы стандартизации, воспроизводимости и снижения себестоимости данного технологического процесса при получении клеточной культуры для терапевтического применения. В данной работе был разработан протокол автоматизированного культивирования фибробластов кожи человека с использованием роботизированной станции CompacT SelecT и проведено сравнение морфологии, скорости пролиферации, жизнеспособности и секреторной активности фибробластов, выращиваемых вручную и в автоматическом режиме. Автоматизация процесса культивирования не оказала негативного влияния на скорость пролиферации фибробластов, но при этом обеспечивала большую стабильность, как объемов клеточного урожая, так и морфологических характеристик клеток. Таким образом, применение роботизированной станции позволяет масштабировать производство фибробластов. Технология автоматизированного культивирования клеток может находить применение в различных областях, в том числе, для получения фибробластов, используемых в регенеративной медицине.

Ключевые слова

Культивирование клеток, автоматизированная система, фибробласты кожи, пролиферация клеток, масштабирование производства.

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(29) "Описание/Резюме" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(2317) "

Автоматизация культивирования клеток позволяет решить вопросы стандартизации, воспроизводимости и снижения себестоимости данного технологического процесса при получении клеточной культуры для терапевтического применения. В данной работе был разработан протокол автоматизированного культивирования фибробластов кожи человека с использованием роботизированной станции CompacT SelecT и проведено сравнение морфологии, скорости пролиферации, жизнеспособности и секреторной активности фибробластов, выращиваемых вручную и в автоматическом режиме. Автоматизация процесса культивирования не оказала негативного влияния на скорость пролиферации фибробластов, но при этом обеспечивала большую стабильность, как объемов клеточного урожая, так и морфологических характеристик клеток. Таким образом, применение роботизированной станции позволяет масштабировать производство фибробластов. Технология автоматизированного культивирования клеток может находить применение в различных областях, в том числе, для получения фибробластов, используемых в регенеративной медицине.

Ключевые слова

Культивирование клеток, автоматизированная система, фибробласты кожи, пролиферация клеток, масштабирование производства.

" } ["ORGANIZATION_RU"]=> array(37) { ["ID"]=> string(2) "26" ["TIMESTAMP_X"]=> string(19) "2015-09-02 18:01:20" ["IBLOCK_ID"]=> string(1) "2" ["NAME"]=> string(22) "Организации" ["ACTIVE"]=> string(1) "Y" ["SORT"]=> string(3) "500" ["CODE"]=> string(15) "ORGANIZATION_RU" ["DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["PROPERTY_TYPE"]=> string(1) "S" ["ROW_COUNT"]=> string(1) "1" ["COL_COUNT"]=> string(2) "30" ["LIST_TYPE"]=> string(1) "L" ["MULTIPLE"]=> string(1) "N" ["XML_ID"]=> string(2) "26" ["FILE_TYPE"]=> string(0) "" ["MULTIPLE_CNT"]=> string(1) "5" ["TMP_ID"]=> NULL ["LINK_IBLOCK_ID"]=> string(1) "0" ["WITH_DESCRIPTION"]=> string(1) "N" ["SEARCHABLE"]=> string(1) "N" ["FILTRABLE"]=> string(1) "N" ["IS_REQUIRED"]=> string(1) "N" ["VERSION"]=> string(1) "1" ["USER_TYPE"]=> string(4) "HTML" ["USER_TYPE_SETTINGS"]=> array(1) { ["height"]=> int(200) } ["HINT"]=> string(0) "" ["PROPERTY_VALUE_ID"]=> string(5) "28677" ["VALUE"]=> array(2) { ["TEXT"]=> string(138) "<p>Институт медицинских клеточных технологий, Екатеринбург, Россия</p>" ["TYPE"]=> string(4) "HTML" } ["DESCRIPTION"]=> string(0) "" ["VALUE_ENUM"]=> NULL ["VALUE_XML_ID"]=> NULL ["VALUE_SORT"]=> NULL ["~VALUE"]=> array(2) { ["TEXT"]=> string(126) "

Институт медицинских клеточных технологий, Екатеринбург, Россия

" ["TYPE"]=> string(4) "HTML" } ["~DESCRIPTION"]=> string(0) "" ["~NAME"]=> string(22) "Организации" ["~DEFAULT_VALUE"]=> array(2) { ["TEXT"]=> string(0) "" ["TYPE"]=> string(4) "HTML" } ["DISPLAY_VALUE"]=> string(126) "

Институт медицинских клеточных технологий, Екатеринбург, Россия

" } } } }